ID: 968493283

View in Genome Browser
Species Human (GRCh38)
Location 4:901793-901815
Sequence GCGCCTCTGGCCACGGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968493283_968493290 17 Left 968493283 4:901793-901815 CCACAAGCCGTGGCCAGAGGCGC 0: 1
1: 0
2: 1
3: 9
4: 80
Right 968493290 4:901833-901855 GTCTGAGAGAAGCCACACTTTGG 0: 1
1: 0
2: 0
3: 16
4: 146
968493283_968493291 18 Left 968493283 4:901793-901815 CCACAAGCCGTGGCCAGAGGCGC 0: 1
1: 0
2: 1
3: 9
4: 80
Right 968493291 4:901834-901856 TCTGAGAGAAGCCACACTTTGGG 0: 1
1: 0
2: 0
3: 20
4: 182
968493283_968493286 -5 Left 968493283 4:901793-901815 CCACAAGCCGTGGCCAGAGGCGC 0: 1
1: 0
2: 1
3: 9
4: 80
Right 968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 19
968493283_968493293 28 Left 968493283 4:901793-901815 CCACAAGCCGTGGCCAGAGGCGC 0: 1
1: 0
2: 1
3: 9
4: 80
Right 968493293 4:901844-901866 GCCACACTTTGGGAAAACCAGGG 0: 1
1: 0
2: 0
3: 8
4: 157
968493283_968493292 27 Left 968493283 4:901793-901815 CCACAAGCCGTGGCCAGAGGCGC 0: 1
1: 0
2: 1
3: 9
4: 80
Right 968493292 4:901843-901865 AGCCACACTTTGGGAAAACCAGG 0: 1
1: 0
2: 0
3: 22
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968493283 Original CRISPR GCGCCTCTGGCCACGGCTTG TGG (reversed) Intronic
901804848 1:11731949-11731971 CCGCCTCTGGCCCCAGCTGGTGG + Intergenic
902239041 1:15076069-15076091 GAGCCTGTGGCCAGGGCATGTGG + Intronic
903522171 1:23959350-23959372 CCGCCTCGGGCCTCGGCTTCTGG - Intronic
903849163 1:26295960-26295982 CCGCCTGTGGCCACTGCTCGGGG + Intronic
904498782 1:30902364-30902386 GCCCCTCTGGCCATGGCGGGAGG + Intronic
907401278 1:54226329-54226351 GCCCCTCTGGCCACAGGATGAGG + Intronic
907966485 1:59335228-59335250 GCGCCTCTGACTGGGGCTTGGGG - Intronic
910615959 1:89198566-89198588 GCGCCTCTGGTCGCCGCCTGTGG + Intronic
916005745 1:160658527-160658549 GCGCCCCAGGCCAAGGCTGGAGG - Intergenic
916233326 1:162561593-162561615 GCCCCTCTCGCCACGACTAGTGG - Exonic
922758138 1:228108030-228108052 ACGCCTCTGACCACAGCCTGTGG - Exonic
1080383259 11:31795916-31795938 CCGCCTCTGGCCAAGTTTTGAGG - Intronic
1081983121 11:47282450-47282472 GCGCCTCTTTCCTCGGCCTGTGG + Exonic
1085636283 11:78161809-78161831 GGGCCTCTCTCCTCGGCTTGCGG + Intergenic
1086062920 11:82718647-82718669 GCGCCTCTGGCCAAGCCTTCTGG - Intergenic
1091118740 11:133039412-133039434 GCGCCTCTGATCAGGGCTGGAGG - Intronic
1091831275 12:3552717-3552739 ACGCCTCTGGCCACGCCTTGAGG - Intronic
1096461279 12:51822362-51822384 GCTGCTCTGGCCACTGGTTGAGG + Intergenic
1096618693 12:52848898-52848920 GCCCCTCTGGGCCCGGCATGGGG + Exonic
1097320981 12:58226105-58226127 ACACCTCTGGCCATGACTTGAGG - Intergenic
1104264934 12:127222780-127222802 GAGACCCTGGCCAGGGCTTGGGG + Intergenic
1113926324 13:113943793-113943815 GGGCCTGTGGCCAGGGCTGGTGG + Intergenic
1115646016 14:35369021-35369043 GTCCCTCTGGCCACGTCTTGGGG + Intergenic
1118905181 14:70018546-70018568 GCCCCTCTGGCCAGGGCTCCAGG + Intronic
1121665363 14:95667726-95667748 GTGCCTCTGGCCACAGAGTGAGG - Intergenic
1122207823 14:100156975-100156997 GCACCTGGGGCCAGGGCTTGGGG - Intronic
1122922913 14:104887328-104887350 GGGCCTGTGGCCACGCCTTATGG - Exonic
1122993109 14:105248242-105248264 CTGCCTCTGGCCGCGGCCTGTGG - Intronic
1126851225 15:52798394-52798416 GCCCATCTGGCCAAGGCTTTCGG + Intergenic
1132594301 16:741188-741210 GCGCCCCAGGCCCCGGGTTGGGG + Intronic
1133369904 16:5239610-5239632 GCGGGTCTGGCCACGGGTAGGGG + Intergenic
1134057046 16:11177095-11177117 GCACCTCCCGCCATGGCTTGGGG + Intronic
1137855374 16:51789561-51789583 GCTCCTCAGGCCTTGGCTTGGGG + Intergenic
1138179242 16:54931068-54931090 GCTCCTCTGGCCCCGGCTCCGGG - Exonic
1144460096 17:15451546-15451568 GCTGCTCTGGCCAAGGCTTGTGG - Intronic
1146560762 17:33867721-33867743 GCTGCTCTGGCAACTGCTTGAGG + Intronic
1147308237 17:39578357-39578379 GCGCCTCTGACCTCTGCCTGTGG - Intergenic
1147557264 17:41487311-41487333 GCGTCGCTGGCCACGGCCTGTGG - Intronic
1149661755 17:58337880-58337902 GACCCTCTGGCCCAGGCTTGTGG + Intergenic
1152465480 17:80463978-80464000 GTCCCTGTGGCCTCGGCTTGTGG - Intergenic
1160799184 19:959950-959972 TCGGCTCTGGCAGCGGCTTGAGG + Intronic
1163248290 19:16110838-16110860 GCGCTTCCGGGCACAGCTTGTGG + Intergenic
1165802490 19:38561637-38561659 TCGCCCCTGGCCACTTCTTGCGG + Intronic
926247334 2:11131160-11131182 GAGCCTGTGGCCAGGGCTGGAGG + Intergenic
929600920 2:43204096-43204118 GAGCCTCTGGCCGTGGCCTGTGG - Intergenic
932259902 2:70318343-70318365 GGACCTCTAGCCATGGCTTGTGG + Intergenic
934679287 2:96271124-96271146 GGGGCTCTGGCCACAGCTTGTGG + Exonic
934887642 2:98038922-98038944 GAGCCACAGGCCACTGCTTGGGG - Intergenic
935178543 2:100670476-100670498 GCCCCTCTGCCCAGGGCTTAGGG + Intergenic
946081435 2:217123076-217123098 GCTCCTCTGTCAAGGGCTTGGGG - Intergenic
947368124 2:229417476-229417498 TGGCCTCTGGCCACGTTTTGTGG - Intronic
947791092 2:232869872-232869894 GTGCCTGTGGCCTGGGCTTGGGG - Intronic
1173181118 20:40807078-40807100 GCGTCGCTGGCTCCGGCTTGAGG - Intergenic
1174408962 20:50321419-50321441 TCCCCTCTGGCCAGGGCTGGGGG - Intergenic
1174759240 20:53190487-53190509 GCACCTCTGCACACGGATTGGGG - Intronic
1176249782 20:64114993-64115015 GTACCTCTGTCCAGGGCTTGTGG + Intergenic
1178447626 21:32660144-32660166 GCGGCTCTGGCCAAGGCCAGTGG + Intronic
1182359456 22:29738153-29738175 CAGCCTCTGGCCAGGGCCTGGGG + Intronic
1182854475 22:33504997-33505019 ATGCCCCTGGCCATGGCTTGAGG - Intronic
1184275275 22:43406305-43406327 CCGCCTCTGCCCACTGCCTGAGG + Intergenic
953710274 3:45264133-45264155 GCTCCTCTGGCCAGAGCTGGTGG + Intergenic
954594870 3:51815699-51815721 GGTCCTCTGGCCACGGCCTGAGG - Intergenic
956468518 3:69542134-69542156 GCGCCCGTGGCCGCGTCTTGCGG + Intronic
962520851 3:136196224-136196246 GCGCCTCAGGCCTCTGCTGGCGG + Intronic
963945680 3:151143692-151143714 ACTCCTCTGGCCAGGTCTTGGGG - Intronic
968493283 4:901793-901815 GCGCCTCTGGCCACGGCTTGTGG - Intronic
974847952 4:67373961-67373983 GCGCTTCAGGCCAGGGCTTCTGG + Intergenic
976498851 4:85762706-85762728 GAGCTTCTGGCCAGGACTTGGGG - Intronic
984888826 4:184473749-184473771 GCGCCTCCAGCCACGGCCAGAGG - Intronic
992487679 5:77211188-77211210 GCGCCTCCGGCCCCTGCTGGTGG - Exonic
999754348 5:154653431-154653453 GCGCCTCTGGGCCCTGCCTGGGG - Intergenic
1002788759 6:423822-423844 GGGCCTCAGGGCAAGGCTTGGGG + Intergenic
1003872370 6:10412982-10413004 GCGCCGCTGGCACCGGCTCGCGG + Intronic
1006299214 6:33184994-33185016 GAGCCTCTTGCCACCCCTTGAGG - Exonic
1006299380 6:33185597-33185619 GTGCCTCTCCCCACGGCATGGGG + Intronic
1008613345 6:53204308-53204330 GCCACTCTGGGCAGGGCTTGCGG - Intergenic
1013665480 6:112343021-112343043 CCCCCTCTGGCCCCTGCTTGGGG + Intergenic
1014272270 6:119348789-119348811 GCGCCCCGGGCCCGGGCTTGTGG + Exonic
1026471016 7:70694276-70694298 GCGCCTCTGGCCGGAGCTTGCGG - Intronic
1026822195 7:73557332-73557354 GCGCCGCTGGCGTCGGCGTGAGG - Intronic
1031539498 7:122976522-122976544 GCCTCTCTGGCCAAGACTTGAGG - Intergenic
1045501941 8:102750081-102750103 TCGCCTCTGGCCTTGGCTTCTGG - Intergenic
1047113728 8:121818229-121818251 GGGCCACTGGCCCAGGCTTGAGG - Intergenic
1047277324 8:123416358-123416380 GGGTCTCTGGCGGCGGCTTGGGG - Intergenic
1049604520 8:143523081-143523103 GCACCTCTGGGCAGGGCTTGTGG - Intronic
1057833703 9:98427273-98427295 CCACCTCTGGCCTGGGCTTGGGG + Intronic
1060739314 9:126087880-126087902 ACCCCTCTGGCCAAGGCCTGAGG - Intergenic
1060810975 9:126611431-126611453 GCGCCTCTGGGCACAGCCAGCGG + Intergenic
1060824502 9:126680155-126680177 GGGCCTCTGGCCTGGGCTGGGGG - Intronic
1062037537 9:134389416-134389438 GCGCCTCTGTCCCGGGCTGGGGG + Intronic
1198100469 X:133417500-133417522 CCGCCTCTGAGCACGGCTTGGGG - Intergenic