ID: 968493286

View in Genome Browser
Species Human (GRCh38)
Location 4:901811-901833
Sequence GGCGCCGCTCCCGATTAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968493279_968493286 18 Left 968493279 4:901770-901792 CCAAGGACAGCACAGGGCATCCT 0: 1
1: 0
2: 1
3: 33
4: 285
Right 968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 19
968493283_968493286 -5 Left 968493283 4:901793-901815 CCACAAGCCGTGGCCAGAGGCGC 0: 1
1: 0
2: 1
3: 9
4: 80
Right 968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 19
968493281_968493286 -2 Left 968493281 4:901790-901812 CCTCCACAAGCCGTGGCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968493286 Original CRISPR GGCGCCGCTCCCGATTAGCG AGG Intronic
903275235 1:22217408-22217430 GGCCCCACTCCCTATTAGCTAGG - Intergenic
904283042 1:29434682-29434704 GGCACCATTCCCGATCAGCGTGG + Intergenic
906650194 1:47507824-47507846 GGGGCCCCTCCCGCTCAGCGGGG + Intergenic
924289434 1:242523622-242523644 GGCGCCGCTAGCGACCAGCGTGG - Intronic
1071966430 10:90857518-90857540 GGCGCCGCACCTGCTGAGCGAGG - Exonic
1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG + Intronic
1127588323 15:60398161-60398183 GGGGCCGCTCCCGCGTGGCGCGG - Intronic
1129360908 15:75023586-75023608 GGGGCCGCTCCCAAATATCGCGG - Exonic
1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG + Intronic
1146885039 17:36464845-36464867 GGCGCCGATCCGGGTTAGCCAGG + Intergenic
1161490492 19:4558349-4558371 GGAGCCGCCGCCGCTTAGCGTGG - Exonic
1165458740 19:35931556-35931578 GGCGCCGCGCCCGAAAAGGGCGG - Intergenic
1176173693 20:63707925-63707947 GGCGCCGCGCGGGGTTAGCGCGG - Exonic
1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG + Intronic
1182688779 22:32141448-32141470 GGCAGCGCTCCCGAGTAGCAGGG - Intergenic
1184568888 22:45309939-45309961 GGCGCCGCTGCCGGCTAACGCGG + Intronic
1185420608 22:50732308-50732330 GGGGCCGCTCTGGACTAGCGCGG + Intergenic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
1039634776 8:39152604-39152626 GCCTCCGCTCCCGAGTAGCTGGG - Intronic
1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG + Intronic