ID: 968495013

View in Genome Browser
Species Human (GRCh38)
Location 4:910576-910598
Sequence TCCCGCAGGCCGGCTAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968495013_968495017 3 Left 968495013 4:910576-910598 CCTGCGCTAGCCGGCCTGCGGGA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 968495017 4:910602-910624 GCTCCTCCTGGCTGCTGAGCAGG 0: 1
1: 0
2: 4
3: 53
4: 403
968495013_968495016 -9 Left 968495013 4:910576-910598 CCTGCGCTAGCCGGCCTGCGGGA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 968495016 4:910590-910612 CCTGCGGGAACAGCTCCTCCTGG No data
968495013_968495018 4 Left 968495013 4:910576-910598 CCTGCGCTAGCCGGCCTGCGGGA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 968495018 4:910603-910625 CTCCTCCTGGCTGCTGAGCAGGG 0: 1
1: 0
2: 5
3: 42
4: 439
968495013_968495022 9 Left 968495013 4:910576-910598 CCTGCGCTAGCCGGCCTGCGGGA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 968495022 4:910608-910630 CCTGGCTGCTGAGCAGGGGCTGG 0: 1
1: 0
2: 9
3: 110
4: 946
968495013_968495023 16 Left 968495013 4:910576-910598 CCTGCGCTAGCCGGCCTGCGGGA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 968495023 4:910615-910637 GCTGAGCAGGGGCTGGCTTGTGG 0: 1
1: 1
2: 2
3: 48
4: 507
968495013_968495019 5 Left 968495013 4:910576-910598 CCTGCGCTAGCCGGCCTGCGGGA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 968495019 4:910604-910626 TCCTCCTGGCTGCTGAGCAGGGG 0: 1
1: 0
2: 2
3: 77
4: 1513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968495013 Original CRISPR TCCCGCAGGCCGGCTAGCGC AGG (reversed) Intronic
901769690 1:11524023-11524045 GGCCTCAGGCCGGCTAGCCCAGG - Exonic
908132146 1:61083676-61083698 GGCCGCGGGCCGGGTAGCGCCGG + Intronic
908473885 1:64470419-64470441 GCCCGCAGGCCGGGGTGCGCGGG - Intergenic
916483459 1:165236000-165236022 TCCCGCAGCCCGGCCCGAGCCGG + Intronic
922581804 1:226703646-226703668 TGCTGCGGGCCCGCTAGCGCTGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1062837664 10:646488-646510 TCCTGCAGGCCGGCAGGAGCAGG - Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1075207099 10:120457235-120457257 TCCCGCAGCTCGGCCGGCGCCGG - Exonic
1075616175 10:123891993-123892015 CCCCGCAGGCCAGCCAGCGTGGG + Intronic
1076409309 10:130234619-130234641 TCCCGCAGGCCTGCCGGCGAGGG + Intergenic
1078023489 11:7673615-7673637 GCGCGGAGGCCGGCTAGAGCCGG - Intronic
1083886600 11:65576240-65576262 TCCCGCTGGCCCGCCACCGCTGG - Exonic
1084943316 11:72625817-72625839 TCCTGCAGACCGGCTGGGGCAGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1091973929 12:4810124-4810146 TCCCGGAGGCCGGCGGGGGCGGG + Exonic
1092905965 12:13101137-13101159 GCCAGCAGGCCGGCTGGGGCCGG + Intronic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1101494001 12:105236295-105236317 CCCCGCGAGCCGGCGAGCGCAGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1122383897 14:101330972-101330994 TCCCGGAGGCCGGCTCCCACGGG - Intergenic
1122555200 14:102575158-102575180 TCCCCCAGGCCTGCTATCGTTGG + Intergenic
1126300109 15:47185043-47185065 GCGCGCAAGCCCGCTAGCGCGGG - Intronic
1128460684 15:67864258-67864280 TCCCGCAGGACGGCGACCCCTGG + Intergenic
1129329595 15:74820272-74820294 TCTCGCAGGCTGGCTGGCTCAGG + Intronic
1131053478 15:89362607-89362629 GCCCGGAGGGCGGCTAGAGCTGG + Intergenic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1134443093 16:14310924-14310946 CCCCGCTGGCCAGCTAGAGCAGG + Intergenic
1135106654 16:19655586-19655608 ACCCTCAGGCAGGCTGGCGCAGG + Intronic
1136365236 16:29806542-29806564 TCCCGCCGGCCGGGGTGCGCGGG + Intronic
1141832103 16:86515653-86515675 GCCCCCAGGCCTCCTAGCGCGGG + Intergenic
1144394168 17:14827513-14827535 TCCCGCAGGCTGGCTCTCTCTGG - Intergenic
1146646248 17:34579243-34579265 TTCCCAACGCCGGCTAGCGCTGG - Exonic
1152577518 17:81149379-81149401 TCCCACAGGCCGGGGAGGGCAGG - Intronic
1153382507 18:4455015-4455037 TCCCGCAGTCCGGCCCTCGCTGG + Exonic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1162026930 19:7899764-7899786 TGCCGCGGGCCGGCTGGAGCTGG + Exonic
1163895145 19:20052061-20052083 TCCCGCAGCCCTGCCATCGCTGG - Intergenic
1166552492 19:43675628-43675650 TCCCGCAGGCAGGCAAGAGCTGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931762623 2:65431371-65431393 TCCAGCACGCCGGCCCGCGCGGG + Intronic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
936561227 2:113541571-113541593 CCCCGGAGGGCGGCGAGCGCGGG + Intergenic
937980044 2:127609415-127609437 TCCAGCAGGCCGGGCAGCACGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1169486978 20:6042042-6042064 TCCCGCAGGCCGGGTGGCGGGGG + Exonic
1170897327 20:20427502-20427524 TCCCTCCGACCGGCTAGCCCAGG + Intronic
1171775341 20:29362350-29362372 TCACGCAGGCCGGGCAGTGCGGG - Intergenic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1177978866 21:27885476-27885498 GCACGCCGGCCGGCCAGCGCTGG + Intergenic
1179888517 21:44324715-44324737 ACACTCAGGCCGGCCAGCGCAGG + Intronic
1180320682 22:11318746-11318768 TCACGCAGGCCGGGCAGTGCGGG - Intergenic
1180612934 22:17109286-17109308 TGCCGCAGTCCGGCTGGCACTGG + Exonic
1184815012 22:46862586-46862608 TCCCGCAGCCCCGCTCTCGCTGG - Intronic
949133629 3:536093-536115 CCACGCCGGCCCGCTAGCGCCGG + Intergenic
949292724 3:2484941-2484963 TCGCGCTGGCCGGTGAGCGCAGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953493061 3:43365907-43365929 TACAGCAGGACGGCCAGCGCTGG + Exonic
956659476 3:71583784-71583806 TCCCGGAGCCCAGCCAGCGCCGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960874549 3:122283988-122284010 TGCCAAAGGCCGGCTGGCGCAGG - Exonic
968495013 4:910576-910598 TCCCGCAGGCCGGCTAGCGCAGG - Intronic
970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG + Intergenic
973764339 4:54149628-54149650 TCGCGCTGGCCGGCGAGCACGGG + Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
985129709 4:186726928-186726950 TCCCGGGCGCCGGCGAGCGCGGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987297765 5:16569118-16569140 TCTCGCAGGCCTCCTAGCGCAGG - Intronic
988796434 5:34656765-34656787 ACTCGCAGGCCGGCTGGGGCGGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
996717789 5:126601357-126601379 TCCTGGAGGCCGGCTTGCGGCGG + Intronic
1012237619 6:96837220-96837242 TCCCGCGGGCCGGGGATCGCGGG + Intronic
1018384590 6:163291180-163291202 ACCCGCAGGCCAGCTCGGGCAGG - Intronic
1018384648 6:163291408-163291430 ACCCGCAGGCCAGCTCGGGCAGG - Intronic
1018384660 6:163291454-163291476 CCCCGCAGGCCAGCTCGGGCGGG - Intronic
1020023547 7:4883364-4883386 ACCCGGAGGCCGGCTAGCGCGGG - Intronic
1027774215 7:82444080-82444102 TCCCGCCGCCCGGCGTGCGCAGG + Intergenic
1034522550 7:151632092-151632114 TCCAGCATGCCGGCTTCCGCGGG + Exonic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1049891460 9:73745-73767 CCCCGGAGGGCGGCGAGCGCGGG - Intergenic
1053732888 9:41074842-41074864 TCCCGGAGGGCGGCGAGCGCGGG - Intergenic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1061163327 9:128908620-128908642 TCACGCAGGAAGGCCAGCGCGGG - Exonic
1062600324 9:137316310-137316332 TCCCCCAGGCCGGCGCGCGAAGG - Intronic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1189321518 X:40090323-40090345 CCCCGCAGGCCGGCCACCCCTGG + Intronic
1196442426 X:115728711-115728733 TCCCGCAGGTGGGCCAGGGCTGG - Intergenic
1196443131 X:115732193-115732215 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196445452 X:115844108-115844130 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196446123 X:115847089-115847111 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196446794 X:115850070-115850092 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196447462 X:115853053-115853075 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196448133 X:115856032-115856054 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196448802 X:115859023-115859045 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196449473 X:115862014-115862036 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196450142 X:115864997-115865019 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196450812 X:115867982-115868004 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196451483 X:115870961-115870983 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196452154 X:115873948-115873970 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196452824 X:115876917-115876939 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196453494 X:115879910-115879932 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196454163 X:115882919-115882941 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196454830 X:115885908-115885930 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196455244 X:115887990-115888012 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196464461 X:115958439-115958461 TCCCGCAGGTGGGCCAGAGCTGG - Intergenic
1198214558 X:134544957-134544979 TCGCCCCGGCCGGCCAGCGCAGG - Intergenic
1201069381 Y:10130439-10130461 TCACGCAGGCCGGGCAGTGCGGG + Intergenic
1201161220 Y:11168681-11168703 GCCAGCAGGCCGGCTGGCACGGG + Intergenic