ID: 968495300

View in Genome Browser
Species Human (GRCh38)
Location 4:912054-912076
Sequence ATCCCGCGCGTGGCAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968495294_968495300 -3 Left 968495294 4:912034-912056 CCACAGCGACACCAAAGTCCATC 0: 1
1: 0
2: 0
3: 11
4: 179
Right 968495300 4:912054-912076 ATCCCGCGCGTGGCAGGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 89
968495293_968495300 2 Left 968495293 4:912029-912051 CCTGACCACAGCGACACCAAAGT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 968495300 4:912054-912076 ATCCCGCGCGTGGCAGGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 89
968495292_968495300 11 Left 968495292 4:912020-912042 CCACACACACCTGACCACAGCGA 0: 1
1: 0
2: 0
3: 14
4: 219
Right 968495300 4:912054-912076 ATCCCGCGCGTGGCAGGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 89
968495291_968495300 15 Left 968495291 4:912016-912038 CCGGCCACACACACCTGACCACA 0: 1
1: 1
2: 5
3: 62
4: 530
Right 968495300 4:912054-912076 ATCCCGCGCGTGGCAGGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968495300 Original CRISPR ATCCCGCGCGTGGCAGGAGG AGG Intronic
902582843 1:17419752-17419774 AGCGCGCACGTGGCAGGAAGCGG + Intronic
904081272 1:27873814-27873836 ATCCCGCGTCAGGCAGGATGAGG - Intronic
912819300 1:112854460-112854482 ATCCCGCACGGGGCTGCAGGTGG + Intergenic
917136415 1:171792208-171792230 ATCGCCAGCTTGGCAGGAGGAGG + Exonic
920002275 1:202808057-202808079 ATCCAGCTCGTGGCTGGGGGAGG - Intronic
1065186620 10:23174934-23174956 ACCGCGCGAGTGGCAGGAGCAGG - Intergenic
1071292420 10:84197285-84197307 ATCCCGCGGGTGCCAGGGAGTGG - Intronic
1071332257 10:84571610-84571632 ATCTCGCGCCAGGCAGCAGGTGG - Intergenic
1074546244 10:114404204-114404226 CTCCCGGGCGCGGAAGGAGGGGG - Intronic
1076118718 10:127919446-127919468 AGCCCACGGGTGGCAGGAGCAGG - Intronic
1076342396 10:129758714-129758736 ATCCTGCACGCGGCTGGAGGTGG + Intronic
1076695655 10:132246103-132246125 CTCCTGTGCGAGGCAGGAGGGGG + Intronic
1077324981 11:1959780-1959802 ATCCTCAGCGTGGCAGGAGTGGG + Intronic
1080503013 11:32888159-32888181 ATCCCGCACCAGGCAGCAGGTGG + Intergenic
1081488398 11:43548405-43548427 ATTCCACGCATGGGAGGAGGAGG + Intergenic
1084795997 11:71504447-71504469 ATCCCCAGGATGGCAGGAGGAGG - Intronic
1084934635 11:72580311-72580333 ATCCCAAGTTTGGCAGGAGGGGG + Intronic
1090756230 11:129794322-129794344 ATCCCTAGTGTTGCAGGAGGGGG - Intergenic
1202807963 11_KI270721v1_random:14959-14981 ATCCTCAGCGTGGCAGGAGTGGG + Intergenic
1097029289 12:56080022-56080044 CTCCCGCGCGAGGCTGGAGTAGG - Exonic
1112692743 13:101916090-101916112 ACCCCGGGTGTGGCAGGAAGGGG + Intronic
1113074597 13:106455326-106455348 ATCCCCTGTGGGGCAGGAGGAGG + Intergenic
1116114426 14:40629587-40629609 ATCCCGCACGGGGCTGCAGGCGG + Intergenic
1121605395 14:95236551-95236573 GTCCCGTGCATGGCAGGATGTGG - Intronic
1122786574 14:104166911-104166933 GTGCCGCGGGTGGCTGGAGGCGG - Exonic
1128742914 15:70096073-70096095 ATCCCCCGCGGGGACGGAGGGGG - Intronic
1131133209 15:89913020-89913042 AGGCCGCGCGCGGCAGGAGTTGG + Intergenic
1132516900 16:370217-370239 ATCGCGAGCCTGGCGGGAGGTGG + Exonic
1132658906 16:1052976-1052998 GTCCCCAGCGTGGCAGGAGAGGG - Intergenic
1133027464 16:2995008-2995030 ATCCCGCCCCTGGGAGGAAGAGG - Intergenic
1133455121 16:5935339-5935361 ATCCTGCGTGTGGCAGAGGGTGG + Intergenic
1136242460 16:28952424-28952446 GTCCTGGGCGGGGCAGGAGGCGG + Intronic
1138216052 16:55206542-55206564 AACCCGCTCCTGGCAGCAGGTGG + Intergenic
1138975855 16:62206952-62206974 CTCCTGCTAGTGGCAGGAGGAGG + Intergenic
1140406733 16:74716493-74716515 ATCCTGCCCGAGGCAGTAGGGGG - Exonic
1143135883 17:4711987-4712009 CTCCCCAGCCTGGCAGGAGGTGG + Intronic
1148147635 17:45376086-45376108 CTCCAGCGCTGGGCAGGAGGGGG - Intergenic
1151551730 17:74826304-74826326 CTCCCCAGGGTGGCAGGAGGTGG - Intronic
1152359782 17:79826521-79826543 ATCCTGTGCATGGCAGGGGGTGG - Intergenic
1152586042 17:81189944-81189966 AGCCCTCGCGAGGAAGGAGGAGG - Exonic
1160035878 18:75301316-75301338 GTCCCGCATGTGGCAGGTGGTGG + Intergenic
1161408404 19:4102939-4102961 CTGCCCCGCGTGGGAGGAGGCGG + Intronic
1165079830 19:33300899-33300921 AGCAGGCCCGTGGCAGGAGGAGG - Exonic
1165639283 19:37370579-37370601 ACCCCGCCCATGGCAGGAGATGG + Intergenic
1168110079 19:54187269-54187291 AGCCAGGGCGTGGCAGGAGCTGG + Exonic
926177140 2:10604130-10604152 ATGCCACGGCTGGCAGGAGGCGG + Intronic
928493138 2:31804054-31804076 ATCCCGCCCGGGGCTGCAGGTGG - Intergenic
928595705 2:32856990-32857012 ATCCCCAGGGTGGCAGGGGGTGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933206280 2:79512498-79512520 GTCCGACACGTGGCAGGAGGAGG - Intronic
935704350 2:105842792-105842814 ACCCAGCCCGTGGCAGGAGAGGG + Intronic
946340925 2:219067959-219067981 AGCCAGCTTGTGGCAGGAGGGGG + Intergenic
948987081 2:241532426-241532448 CTCCTGCGCTTGGCAGTAGGTGG + Intergenic
1169141538 20:3229808-3229830 CTCCAGCGTGTGGCAGGGGGAGG + Intronic
1169224431 20:3847208-3847230 GGCCCGCGGGCGGCAGGAGGAGG - Intronic
1176286333 21:5021193-5021215 ATCGCGCGCCTGGCAGGGGCGGG - Intergenic
1179792091 21:43761670-43761692 ACCCAGCCCCTGGCAGGAGGAGG + Exonic
1179870848 21:44242282-44242304 ATCGCGCGCCTGGCAGGGGCGGG + Intergenic
1181781578 22:25197652-25197674 AGCCAGAGGGTGGCAGGAGGAGG - Intergenic
1183063945 22:35351034-35351056 AGCTCGCGCGGGGCAGGAGCGGG - Intergenic
1184391175 22:44204540-44204562 ATCCAGCAGGTGGCTGGAGGTGG + Intronic
1185273090 22:49937569-49937591 ACCCTGGGCGTGGCGGGAGGGGG - Intergenic
950445377 3:13034459-13034481 ATCCCACTGGTGGCAAGAGGCGG - Intronic
951139803 3:19147231-19147253 AACTCGGGCGTGGCGGGAGGAGG - Intergenic
964698248 3:159534448-159534470 ATCCTGGTAGTGGCAGGAGGTGG + Intronic
965520171 3:169662891-169662913 GTCCCGGGTGTGGGAGGAGGGGG - Intronic
968495300 4:912054-912076 ATCCCGCGCGTGGCAGGAGGAGG + Intronic
968942938 4:3648525-3648547 AGCCCGGGCATGGCAGGAAGGGG - Intergenic
985409102 4:189664685-189664707 ATCCCGCACCTGGCCGCAGGTGG + Intergenic
986200378 5:5573638-5573660 AGCCAGAGCGTGGGAGGAGGAGG - Intergenic
987476611 5:18399606-18399628 ATCCCGCACGGGGCTGCAGGTGG + Intergenic
989795150 5:45460278-45460300 ATCCCTCACATGGCAGAAGGTGG - Intronic
1003956751 6:11171479-11171501 ATCCCGCACGGGGCCGCAGGTGG - Intergenic
1005854414 6:29850166-29850188 CTCCCGGGCGGGGCCGGAGGCGG + Intergenic
1006121169 6:31806837-31806859 AGCCCGCGCGTGGGGCGAGGCGG + Exonic
1006907057 6:37539616-37539638 ATCCCGGGCCTGTGAGGAGGAGG + Intergenic
1009685414 6:66949630-66949652 ATCCCGCACGGGGCTGCAGGTGG - Intergenic
1018101093 6:160441167-160441189 AGCCCGGGAGTGGCAGGAGATGG + Intronic
1019432919 7:1007698-1007720 GTCCTGCGTGTGGGAGGAGGGGG - Intronic
1022478466 7:30727428-30727450 ATCCCTCTGGAGGCAGGAGGAGG + Intronic
1023418182 7:39950965-39950987 GCCCCGCGCCGGGCAGGAGGCGG + Exonic
1023730660 7:43188776-43188798 ATCCTGCAAGTGGCTGGAGGGGG + Intronic
1027390177 7:77696414-77696436 AGCCGGCGCGGGGCAGGGGGCGG - Intergenic
1029551422 7:101239025-101239047 ATGCCGAGCCTGGCACGAGGGGG + Intergenic
1034885897 7:154798653-154798675 ATCCCGCCCATGGCAGCAGTTGG + Intronic
1036656728 8:10681776-10681798 ATCCCAGGCCTGGCAGGAGGCGG + Intronic
1036801437 8:11795178-11795200 ATCCCGCGCAGGGCCGCAGGTGG - Intergenic
1038394513 8:27237037-27237059 ATCCCGAGAGGGGCAGAAGGTGG + Intronic
1038613439 8:29073044-29073066 ATCCCGAGCAAGGCAGCAGGGGG + Intronic
1049544557 8:143223876-143223898 ATCCCCTGCGTGGCAGGGTGCGG + Intergenic
1052814011 9:33085766-33085788 ATCCCGCGCGTGGCTCGGGGGGG + Intergenic
1060759197 9:126234185-126234207 ATCCCAGGGCTGGCAGGAGGAGG + Intergenic