ID: 968496712

View in Genome Browser
Species Human (GRCh38)
Location 4:922086-922108
Sequence CAGATGACCCTATGCGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968496706_968496712 1 Left 968496706 4:922062-922084 CCCAAAATGCATCTGCGGAAGCC 0: 1
1: 0
2: 3
3: 80
4: 590
Right 968496712 4:922086-922108 CAGATGACCCTATGCGGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 70
968496705_968496712 2 Left 968496705 4:922061-922083 CCCCAAAATGCATCTGCGGAAGC 0: 1
1: 0
2: 4
3: 78
4: 528
Right 968496712 4:922086-922108 CAGATGACCCTATGCGGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 70
968496704_968496712 3 Left 968496704 4:922060-922082 CCCCCAAAATGCATCTGCGGAAG 0: 1
1: 0
2: 7
3: 72
4: 591
Right 968496712 4:922086-922108 CAGATGACCCTATGCGGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 70
968496707_968496712 0 Left 968496707 4:922063-922085 CCAAAATGCATCTGCGGAAGCCC 0: 1
1: 0
2: 4
3: 103
4: 700
Right 968496712 4:922086-922108 CAGATGACCCTATGCGGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968496712 Original CRISPR CAGATGACCCTATGCGGAGA CGG Intronic
901184770 1:7365904-7365926 CTGATGACCCTGTGCGCGGAGGG - Intronic
910360386 1:86409837-86409859 CTGATGACCCCCTGCAGAGATGG - Intergenic
912790356 1:112643564-112643586 AATATGACTCTATGAGGAGATGG + Intronic
915375932 1:155395624-155395646 CAGATCATCCTATGAGGAGAGGG + Intronic
1067077852 10:43198254-43198276 CAGATGCCCCTCTGCAGAGCAGG + Intronic
1067116046 10:43436521-43436543 CAGAGGACCTGATGCGGAGCGGG + Intergenic
1069532936 10:69232297-69232319 CCGATGATCCTATGGGCAGAGGG - Intronic
1069877540 10:71572319-71572341 CAGCTGACCTGATGCTGAGAAGG - Intronic
1071474588 10:86015137-86015159 CAGATGAGACTTTGAGGAGATGG - Intronic
1076111182 10:127860929-127860951 CAGATGAATCTTTGTGGAGAAGG - Intergenic
1077291849 11:1799983-1800005 CACATGACCCTAAGCTGAGAAGG - Intergenic
1084480813 11:69419043-69419065 CCCATGACCCTATGTGGGGAAGG - Intergenic
1100050064 12:90437333-90437355 TAGATTTCCCTATGCGTAGAAGG + Intergenic
1113446503 13:110372225-110372247 CAGAGGACCCTGTGCGGGGGTGG + Intronic
1114210092 14:20606793-20606815 CTGATGACCCCCTGCAGAGATGG + Intronic
1117189165 14:53274237-53274259 CTGATGACCCCCTGCAGAGATGG - Intergenic
1125579465 15:40775309-40775331 CAGAAGACCCTCTCCTGAGAGGG + Intronic
1126736117 15:51733733-51733755 CAGAAGACCCCATGCTTAGAAGG - Intronic
1131271395 15:90949640-90949662 AAGAAGACCCTGTGGGGAGAAGG - Exonic
1140297957 16:73727125-73727147 AAGAAGACCCTATCCAGAGAGGG + Intergenic
1149164599 17:53736019-53736041 CAGACAAACCCATGCGGAGAAGG - Intergenic
1160113024 18:76051856-76051878 CTAATGACCTTGTGCGGAGAGGG - Intergenic
1160889806 19:1371256-1371278 CGCTTGACCCTGTGCGGAGACGG + Intronic
1164128516 19:22340363-22340385 AATATGTCCCTATGAGGAGAGGG + Intergenic
1166321769 19:42023165-42023187 AAGATGACCCCAAGCAGAGAGGG + Intronic
930259737 2:49131384-49131406 CAGATCACACTATGCTTAGAGGG - Intronic
931298896 2:60957606-60957628 CTGATGACCCCCTGCAGAGATGG + Intronic
938181436 2:129188621-129188643 CAGATGCCCCTCTGCTGAGCAGG - Intergenic
940911769 2:159215692-159215714 CAGATGACCCTCTCCCGAGATGG + Intronic
943320542 2:186437619-186437641 CTGATGACCCCCTGCAGAGATGG + Intergenic
948028537 2:234798149-234798171 CAGGTGTCCTTATACGGAGAAGG - Intergenic
1172169151 20:32918403-32918425 CAGCAGACCCTATGTGGAGCGGG + Intronic
1174420315 20:50395282-50395304 CAGATGACTGTATGTGGAGCTGG - Intergenic
1174883682 20:54308039-54308061 GAGACGACCCCATGAGGAGAGGG - Intergenic
1178827070 21:36025865-36025887 CAGATCACCCTGTGAGGAGCAGG + Intergenic
1179450698 21:41466573-41466595 CAGATGACCCCAGGAGGAGGAGG - Intronic
1180996215 22:19966887-19966909 CAGGTGACACTATGCTGAGGTGG - Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
950572331 3:13809169-13809191 CAGATGTCCTTATGGAGAGAAGG + Intergenic
951458040 3:22915461-22915483 CAGATGACGCTATAGGAAGATGG - Intergenic
953119363 3:40024820-40024842 CAGATGATCCAATGGAGAGATGG + Intronic
953844688 3:46418069-46418091 CTGATGACCCCCTGCAGAGATGG - Intergenic
953903225 3:46854946-46854968 CAGATGACACTATGAGCAAAGGG - Intergenic
957491816 3:80937160-80937182 CAGTTGACCCTATGCTCAGGAGG + Intergenic
958052457 3:88365724-88365746 CAGGTGACCCTATACCTAGAAGG - Intergenic
964697362 3:159524726-159524748 CAGATGACCCAAAGAGGAAAGGG + Intronic
967868646 3:194211431-194211453 TAGAGGACTCTATGCTGAGAAGG - Intergenic
968496712 4:922086-922108 CAGATGACCCTATGCGGAGACGG + Intronic
995791566 5:115893704-115893726 CAGGTGATCCTATGGGGAAAGGG - Intronic
997728659 5:136145937-136145959 GATATGACCCTTTGGGGAGAAGG - Intronic
1003073609 6:2963844-2963866 CAGATGAGCCCCTGAGGAGAGGG - Intronic
1004977200 6:20981495-20981517 GAGATGATCCTATGAGGATAGGG + Intronic
1005607595 6:27490150-27490172 AATATGACCGTATGTGGAGATGG - Intergenic
1007472056 6:42097417-42097439 CTAATGATCCTATGCTGAGATGG + Intergenic
1010926898 6:81754187-81754209 GCGATGGCCCTATGCGGACAGGG - Intergenic
1013163149 6:107565552-107565574 CAGATGACCATATGGGAAGTGGG - Intronic
1013176612 6:107683249-107683271 AGGATGACCCTATGATGAGATGG + Intergenic
1017541930 6:155412167-155412189 CAGATGTCTCTTTGGGGAGAAGG - Intronic
1018070590 6:160161287-160161309 CAACTGACCCTATGCGTAGATGG + Intergenic
1019986201 7:4657782-4657804 CAGATGACCCTATTAGAAAATGG + Intergenic
1025250653 7:57349204-57349226 CAGATGACTGTATGTGGAGCTGG + Intergenic
1028968391 7:96828160-96828182 CACAAGACCCTATGCTCAGAAGG - Intergenic
1035738017 8:1902925-1902947 CAGATGAACCCATGCACAGATGG - Intronic
1037192696 8:16146493-16146515 CAGATTAGGGTATGCGGAGAAGG - Intronic
1037593943 8:20338180-20338202 TAGGTGACCCTATGGAGAGAAGG + Intergenic
1041004863 8:53487950-53487972 CTGATGACCCCCTGCAGAGACGG + Intergenic
1041458682 8:58087598-58087620 CCGATGAGCCAATGAGGAGATGG - Intronic
1048142077 8:131804414-131804436 GAGATGACCCTTTGAGGAGCTGG - Intergenic
1050024360 9:1318975-1318997 CAGATGATCTTAGGAGGAGAGGG - Intergenic
1052193837 9:25688380-25688402 AAGATGACCCTATATGTAGAAGG - Intergenic
1055179577 9:73367822-73367844 CACATGACCTCATGTGGAGATGG + Intergenic
1057082216 9:92181434-92181456 CAGATGACTCTGTGAGGAGAAGG + Intergenic
1060765584 9:126293305-126293327 CTGATGACCCTATGGGGTCAGGG + Intergenic
1191233277 X:58114413-58114435 CAGGTGCCTCTATGCTGAGAAGG - Intergenic
1196215726 X:113049879-113049901 TTGATGTCCCTGTGCGGAGAGGG - Intergenic
1200928729 Y:8677978-8678000 CAGAAAACCCTATGCCGACAAGG + Intergenic