ID: 968496811

View in Genome Browser
Species Human (GRCh38)
Location 4:922894-922916
Sequence CAGCCCAGATGTCCTTCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1074
Summary {0: 2, 1: 7, 2: 39, 3: 201, 4: 825}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968496809_968496811 -10 Left 968496809 4:922881-922903 CCAAAACAGGAAACAGCCCAGAT 0: 1
1: 11
2: 79
3: 363
4: 1229
Right 968496811 4:922894-922916 CAGCCCAGATGTCCTTCCACGGG 0: 2
1: 7
2: 39
3: 201
4: 825
968496807_968496811 28 Left 968496807 4:922843-922865 CCTATACGCAAGTGTCACAGCAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 968496811 4:922894-922916 CAGCCCAGATGTCCTTCCACGGG 0: 2
1: 7
2: 39
3: 201
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968496811 Original CRISPR CAGCCCAGATGTCCTTCCAC GGG Intronic
900835065 1:4996819-4996841 CAGCTCAGATGTCCTTCAGCAGG + Intergenic
900890761 1:5448129-5448151 TAGCCCAGAAGTCCATCCATAGG + Intergenic
901121905 1:6902320-6902342 CAACCCAAATGTCATTCAACTGG + Intronic
901188845 1:7391908-7391930 CAGCCCAGACATCCTTCAATAGG - Intronic
901303297 1:8215305-8215327 CTGTCCTGAGGTCCTTCCACTGG - Intergenic
901616638 1:10545235-10545257 CAACCCAAATGTCCATCAACAGG - Intronic
901840644 1:11952076-11952098 CAGTCCAGATGGCCTTGCCCTGG + Intronic
902110276 1:14072602-14072624 AAGCCCTGGTATCCTTCCACTGG + Intergenic
902903612 1:19537645-19537667 CAACCAAGATGTCCTTTGACAGG - Intergenic
903470994 1:23587400-23587422 CAGCCCAGGTGTCCTGACTCTGG - Intronic
903687734 1:25144538-25144560 CAATCCAGATGTCCTTCAACGGG + Intergenic
903818126 1:26080190-26080212 CAGCCCAAATGTCCATCAATGGG + Intergenic
903855016 1:26331972-26331994 CAGCCCAGATGTCCATCAATAGG + Intronic
903964007 1:27074702-27074724 CAGCCCCCAAGTCCCTCCACAGG - Intergenic
904257531 1:29265001-29265023 CAGCCCAGATGTCATTCAACAGG - Intronic
904309152 1:29614601-29614623 CAACCAAGATGTCCCTCAACAGG - Intergenic
904339130 1:29822159-29822181 CAACCCAGATGTCCTTCAGTAGG - Intergenic
904481169 1:30794351-30794373 CAACCCAAATGTCCATCCACAGG + Intergenic
905595565 1:39203842-39203864 CAACCCAAATGTCCATCAACTGG - Intronic
905954414 1:41980300-41980322 CAGCCCAAATGTCTATCTACTGG + Intronic
905970863 1:42141339-42141361 CAGCCCAGACCCCATTCCACTGG - Intergenic
906394470 1:45449440-45449462 CAACCAAGATGTCCTTCAATAGG + Intronic
906968291 1:50482368-50482390 CAGCTCAGGTGTCCCTCAACTGG - Intronic
907007083 1:50925837-50925859 CAGCCTAAATGTCCATCAACAGG + Intronic
907728622 1:57044250-57044272 CAACCCAGGTCACCTTCCACGGG - Intronic
908444275 1:64187066-64187088 CCACCCAGGTTTCCTTCCACTGG - Intergenic
908875522 1:68670070-68670092 CAACCCAGATGTCCTTCTGTAGG - Intergenic
908885719 1:68786249-68786271 CAGCCCAGGTGCTCTTCCATAGG + Intergenic
908989325 1:70066626-70066648 TAACCCAGATATCCTTCCATAGG - Intronic
909705251 1:78574325-78574347 CAGCCAAGATATCCATCAACAGG - Intergenic
909911369 1:81261674-81261696 CAACCAAGATGTCCTTCAATAGG + Intergenic
910404035 1:86867046-86867068 CAATCAAGATGTCCTTCCACAGG + Intronic
910890089 1:92009454-92009476 CAACCAAGATGTCCTTCAATAGG - Intronic
910976466 1:92911564-92911586 CAGCTCAGATGTCCTTCAGTAGG - Intronic
911409724 1:97488016-97488038 TAACCCAGATATCCTTCAACAGG + Intronic
911637549 1:100251684-100251706 CAGCCCAGATGTCCATTAACAGG + Intergenic
911851301 1:102824834-102824856 CAACTCAGATGTCCTTCAATGGG - Intergenic
913084226 1:115420621-115420643 CAGCCCAGATACCTTTCAACAGG - Intergenic
913193731 1:116435042-116435064 CAGCCCAGATATCCTTCAATGGG - Intergenic
914077900 1:144373841-144373863 CAACCAAGATGTCCTTCAATAGG - Intergenic
914101279 1:144592664-144592686 CAACCAAGATGTCCTTCAATAGG + Intergenic
914172809 1:145242381-145242403 CAACCAAGATGTCCTTCAATAGG - Intergenic
915613895 1:157019608-157019630 CAGCCCAGATGTCCATGAACAGG + Intronic
917172140 1:172188574-172188596 CAGCCAAGATGTCCCTCTATGGG - Intronic
917911825 1:179655858-179655880 CAACCCAAATGTCCTTCAATGGG - Intronic
918418159 1:184333977-184333999 CAACCCAAATGTCCATCAACTGG + Intergenic
918921003 1:190709562-190709584 CTACCCAGATGTCTTTCAACAGG - Intergenic
919037014 1:192325363-192325385 CAACCAAGATGTCCATCAACTGG - Intronic
919144769 1:193620262-193620284 GAGCCCACATGTCCAACCACTGG - Intergenic
919168558 1:193926172-193926194 CAAACAAGATGTCATTCCACAGG - Intergenic
919708452 1:200702110-200702132 CAGCCCACATGTCTTTCAGCAGG + Intergenic
920136747 1:203775666-203775688 TAACCCAGATATCCTTCAACAGG + Exonic
920276541 1:204809499-204809521 TAGCCCAGATGTCCTTCAACAGG - Intergenic
920404530 1:205699200-205699222 CAACCCAAATGTCCTTTGACAGG + Intergenic
920483868 1:206350025-206350047 CAACCCAAATGTCCATCAACAGG + Intronic
920531974 1:206708987-206709009 CAGCCCAAATGTCCATCAACAGG - Intronic
921120622 1:212133534-212133556 CAGCCCAGATGTCCTTCAGTGGG + Intergenic
921191615 1:212713950-212713972 CAGCCCAGATGTCCTTGACAAGG - Intergenic
921627261 1:217390599-217390621 CAACCAAGATGTCCTTCCCTAGG + Intergenic
921698529 1:218240426-218240448 CAGCCCAAATGTCCATCAACAGG + Intergenic
921735697 1:218625484-218625506 CAAACCAAATGTCCTTCAACAGG + Intergenic
921958493 1:221009585-221009607 CAGACCAGGTGTCCTACAACAGG - Intergenic
921998728 1:221451748-221451770 CAACCCAAATGTCCATCAACTGG - Intergenic
922164310 1:223102178-223102200 CAACCCAGGTGTCCCTCAACAGG + Intergenic
922172061 1:223163825-223163847 CATCCTAGATGTCCATCAACAGG + Intergenic
922918672 1:229281025-229281047 CAACCCAGATGTTCTTTAACAGG - Intronic
924184449 1:241473038-241473060 CAACCAAGATGTCCTTCAATAGG - Intergenic
924662371 1:246033144-246033166 CAACACAGATGTCCTTCAAAGGG + Intronic
924840186 1:247701269-247701291 CATCCCAGAAGTCCTTCAATAGG + Intergenic
1062897535 10:1115839-1115861 CGCCCCAGAGGCCCTTCCACAGG - Intronic
1062926984 10:1324479-1324501 CCGCCCAGATGTTCTTTCACAGG + Intronic
1063089982 10:2855947-2855969 CAACTCAAATGTCCTTCAACAGG + Intergenic
1063205776 10:3829627-3829649 CAGCCCAGCTCTCAGTCCACAGG - Intergenic
1063912054 10:10840106-10840128 CAACCAAGATGTCCTTCAACAGG - Intergenic
1064168800 10:13010701-13010723 CAACCCAAGTGTCCATCCACAGG + Intronic
1064281308 10:13954056-13954078 CTGCCCTGATGTCCTAGCACAGG - Intronic
1064369662 10:14740199-14740221 CAACCAAGATGTCCTTCAATAGG + Intronic
1064387731 10:14912515-14912537 CAACCCAGATGTCCATCAGCTGG + Intronic
1065062862 10:21925530-21925552 CAACCCACATGTCCATCAACTGG + Intronic
1065948816 10:30632834-30632856 CAACCAAGATGACCTTCAACAGG + Intergenic
1066510094 10:36085604-36085626 CAACCAAGATGTCCTTCAATAGG - Intergenic
1066623843 10:37385709-37385731 CTGCCCTGAGGTCCTGCCACAGG + Intergenic
1066672144 10:37851918-37851940 TAACCCAGAGGTCCTTCAACAGG + Intronic
1067158753 10:43804611-43804633 CAGCATAGAAGTCCTCCCACAGG + Intergenic
1067332624 10:45335648-45335670 CAGCCAAGATGTTTTTCAACAGG + Intergenic
1067530794 10:47070843-47070865 CAGGCTAGATGTCCTTTAACAGG - Intergenic
1067834367 10:49629000-49629022 CAGCCCAGGTGTCCGGCCTCAGG + Intronic
1069341762 10:67417949-67417971 CAACCCAAATGTCCATCAACTGG + Intronic
1069367230 10:67706573-67706595 CTGACCAGATGTCCTCCCAAGGG - Intergenic
1069670802 10:70201415-70201437 CAGCCCAGATGTCCTTCAACAGG + Intergenic
1069770368 10:70894872-70894894 CAATCCAGATGTCCATCAACAGG + Intergenic
1070047759 10:72855985-72856007 CAACCCAGATGTTCGTCAACTGG + Intronic
1070387878 10:75942270-75942292 CACCCCAGATGCCCATCCAGAGG + Intronic
1070574016 10:77663684-77663706 CAGCCCAGGTGTCCGTTCAGAGG - Intergenic
1070822438 10:79368248-79368270 CAACCCAAATGTCCATCCATGGG + Intergenic
1071070792 10:81691100-81691122 CAACCCAGCTGTCCTTCAATGGG - Intergenic
1071196795 10:83170070-83170092 CAGCTCAAATGTCCATCTACTGG - Intergenic
1071199036 10:83196221-83196243 CAACCAAGATGTCCTTCAATTGG - Intergenic
1071443128 10:85721438-85721460 CAACCCAGATGTCCTCCAATGGG + Intronic
1071850203 10:89561085-89561107 CAACCAAGATGTCCTTCAATAGG + Intergenic
1071934460 10:90512379-90512401 CAACCCAGATGTCCATCAACAGG + Intergenic
1072464643 10:95651969-95651991 CAACCCAGATGTCCTTTAATGGG + Intronic
1072545847 10:96437799-96437821 CAATCCAGATATCCTTCAACAGG - Intronic
1072823648 10:98583903-98583925 CAGCCCAAATGTTCATCAACTGG - Intronic
1072851669 10:98900946-98900968 CAACCCAAATGTCCATCAACAGG + Intronic
1073334210 10:102693090-102693112 CATCCAAGATGTCCTTCAATAGG - Intronic
1073389598 10:103163185-103163207 CAGCCCAAATGTTCTTCAGCAGG - Intronic
1073576371 10:104629392-104629414 CATCTCAGATGTCCCTCAACAGG + Intergenic
1073601991 10:104854957-104854979 CAACCCAAATGCCCTTCAACAGG - Intronic
1074083393 10:110186163-110186185 CAACCCAGATGTCCTTCAACAGG - Intergenic
1074100648 10:110352308-110352330 CCGTGCAGATGTACTTCCACTGG + Intergenic
1074117314 10:110466195-110466217 AATCCCAGATGTCCTTTGACTGG + Intergenic
1074139899 10:110662755-110662777 CAACCCAGATGTCCATCACCAGG + Intronic
1074518215 10:114191620-114191642 CAACCCAGGTGTCCTTCAATAGG - Intronic
1074697647 10:116065034-116065056 CAGCACAGCTGTCCTTCCCCAGG + Intronic
1075355536 10:121770092-121770114 CAACTGAGATGTCCTTCAACAGG + Intronic
1075361830 10:121844679-121844701 CAACCAAGATGTCCTTCAATAGG + Intronic
1075398613 10:122145259-122145281 CAACCCAGATATCTATCCACTGG + Intronic
1075431482 10:122385881-122385903 CAACCCAAATGTCCTTCAACTGG - Intronic
1075447291 10:122521975-122521997 CAGCACTGATGACCTTTCACAGG - Intergenic
1075730642 10:124634146-124634168 CAGCCCAAATGTCTATCAACTGG + Intronic
1076000723 10:126910956-126910978 AAACTCAGATGTCCTTCGACAGG - Intronic
1076042024 10:127258541-127258563 TAGCCCAGACGTCCTTCAACAGG - Intronic
1076150243 10:128156098-128156120 CAGCCAATATGTCCTTCAATAGG - Intergenic
1076423053 10:130346224-130346246 CAACCCAAATGTCTATCCACGGG - Intergenic
1076444602 10:130504113-130504135 CAACCCAGATGTCCTTCAGCAGG - Intergenic
1076662366 10:132064330-132064352 CAGCCCAGCTGTCCTCCTGCTGG - Intergenic
1077079308 11:717316-717338 CAGCCTACATGTCCATCAACAGG - Intronic
1077275601 11:1705905-1705927 CAACCCAGACATCCTTCAACGGG + Intergenic
1077424631 11:2468789-2468811 CCGCCCACATGTCCATCAACAGG - Intronic
1077449026 11:2623668-2623690 CAACCGAGATGTCCTTCCATAGG - Intronic
1078050148 11:7958115-7958137 CAACCAAGATGTCCTTCAATAGG - Intergenic
1078792061 11:14553719-14553741 CAACCCAAATGTCCTTCAATGGG - Intronic
1081376431 11:42364188-42364210 CAACCAAGATGTCCTTCTAAAGG + Intergenic
1081459348 11:43257229-43257251 CAACCAAGATGTCCTTCAAAAGG + Intergenic
1081607665 11:44537319-44537341 CACCTCAGCTGTCCTCCCACAGG - Intergenic
1081651900 11:44829579-44829601 CAACCAAGATGTCCTTCAACAGG - Intronic
1083073668 11:60014498-60014520 CAACCAAGATGTCCTTCAATAGG - Intergenic
1083178789 11:60971180-60971202 CATCCCACAAGTCCTTCTACAGG - Intergenic
1083230393 11:61314101-61314123 GAGCCGAGATGTCCGTCCAGAGG + Exonic
1083558606 11:63653585-63653607 CAACCAAGATGTCCTTCAACAGG + Intronic
1083714892 11:64569553-64569575 CAGCCCAGCTTTCCTTCCCCTGG + Intronic
1084559328 11:69893871-69893893 GAGCCCAGAGGGCCTTCCTCCGG - Intergenic
1084735890 11:71105072-71105094 CAGCCCAGATGTCCTTTAGGAGG + Intronic
1085017132 11:73181633-73181655 CAGCTCAAATGTCCATCAACAGG - Intergenic
1085153771 11:74274257-74274279 CAGCCCAGATGTCTGTCAACAGG - Intronic
1085164957 11:74390479-74390501 CAGCTAAGATGTCCTTCAATAGG - Intronic
1085335700 11:75692769-75692791 CAACCCAAATGTCCTTCCATGGG - Intergenic
1085342002 11:75738124-75738146 CAACCAAGATGTCCTTCAATAGG + Intergenic
1085379891 11:76106086-76106108 CAACCCAGATGTCCCTCAACTGG + Intronic
1085741895 11:79084462-79084484 CAACCCAGATATCCTTCAACAGG + Intronic
1085756417 11:79205708-79205730 TAGCCTAGATGTCCTTCAACAGG - Intronic
1086146387 11:83556828-83556850 CATCCCAGCTTGCCTTCCACTGG - Intronic
1087005286 11:93464785-93464807 CAGCATAGATATCCTTCAACAGG + Intergenic
1087021768 11:93610349-93610371 CAGCCCACATGCCCTTGCAATGG + Intergenic
1087461261 11:98451527-98451549 CAACCAAGATGTCCTTCCATAGG - Intergenic
1087611626 11:100441471-100441493 CAACCAAGATGTCCTTCAATAGG + Intergenic
1087784963 11:102344168-102344190 CCACCCAGATGTCCATCCATAGG + Intergenic
1088163130 11:106898439-106898461 CAACCAAGATGTCCTTCTATAGG + Intronic
1088569464 11:111207811-111207833 CAACCCAAATGTCCATCAACAGG + Intergenic
1088781022 11:113134383-113134405 CAGCCCAGATGTCCATCAGTGGG - Intronic
1089058151 11:115604213-115604235 CAGCCCAGGTGTTCATCAACAGG + Intergenic
1090218816 11:124997123-124997145 CAACCCAGATGTCCATCAATAGG - Intronic
1090269504 11:125376187-125376209 CAGCCCAGCTCTCCTCCCCCAGG - Intronic
1090329432 11:125919188-125919210 CAGTCCAAATGTCCATCAACTGG - Intronic
1090505962 11:127314350-127314372 CAACCCAAATGTCCTTCAATGGG - Intergenic
1090507669 11:127336136-127336158 TAGCCCAGATGTCCTTCATTGGG - Intergenic
1091096547 11:132827985-132828007 CAACCAAGATGTCCTTCAATAGG + Intronic
1091135058 11:133180962-133180984 CACCCCAGGTGTCCTTCAACAGG + Intronic
1091318719 11:134634590-134634612 CAGCCAAGATGCCCTTCCATAGG - Intergenic
1091547813 12:1515212-1515234 AAGCCCAGATGTCCTTCAGTGGG - Intergenic
1091579941 12:1779263-1779285 CAACCCAGATGTCTATCGACTGG + Intronic
1092177209 12:6418296-6418318 CAACCCAAATGTCCATCAACAGG + Intergenic
1092235690 12:6807322-6807344 CAATCTAGATGTCCTTCAACTGG + Intronic
1092392669 12:8095128-8095150 CAACCTAGATGTCATTCCATGGG - Intronic
1092699479 12:11211812-11211834 CAATCAAGATGTCCTTCAACAGG + Intergenic
1092733741 12:11559125-11559147 CAACCAAAATGTCTTTCCACAGG - Intergenic
1092901396 12:13062823-13062845 CAGCCTATGTGTCCTTCCTCAGG + Exonic
1094087974 12:26614561-26614583 CAACCAAGATGTCCTTCAATAGG + Intronic
1094312629 12:29101546-29101568 CAACCAAGATGTCCTTTAACAGG - Intergenic
1094651221 12:32377637-32377659 CACCCCAGATGTTCGTCCACAGG - Exonic
1094780038 12:33780466-33780488 CAACCCAGATGTCCTTCAGTAGG - Intergenic
1095116392 12:38358046-38358068 CAACCAAGATGTCCTTACATAGG + Intergenic
1095166037 12:38973164-38973186 CAACCAAGATGTCCTTCAATAGG - Intergenic
1095324781 12:40875758-40875780 CAATCCAGATATCCTTCAACAGG - Intronic
1095413610 12:41950684-41950706 CAGCCCAGATGTCCATCAACAGG + Intergenic
1095443663 12:42263344-42263366 CAACCCAGATGTCCTTATACTGG - Intronic
1095556108 12:43506865-43506887 CAACCCAAATGTCTGTCCACAGG + Intronic
1096285275 12:50294371-50294393 CAACCCAAATGTCCATCAACTGG - Intergenic
1096703129 12:53400410-53400432 CAACCCAAATGTCCATCAACTGG - Intronic
1096902125 12:54895040-54895062 CAACCGAGATGTCCTTCAATAGG + Intergenic
1097126122 12:56776885-56776907 CAACCAAGATGTCCTTCAATAGG - Intronic
1097213475 12:57391180-57391202 CAACACAGAAGTCCTTCAACAGG + Intronic
1097483982 12:60170311-60170333 CAGCTCAGATATTCTTCAACAGG + Intergenic
1097553896 12:61113643-61113665 CAACTCAGATGTCCTTCAATAGG + Intergenic
1098698282 12:73588156-73588178 CAGCCCAAATGTCCATCAATAGG + Intergenic
1098913981 12:76238635-76238657 CAGCCCAGATGTCTTTCAACAGG - Intergenic
1099821213 12:87712918-87712940 CAACCAAGATGTCCTTCAATAGG + Intergenic
1100208016 12:92372347-92372369 CAACCCAAATGTCCATCAACAGG - Intergenic
1100322648 12:93510338-93510360 CAACCAAGATGTCCTTCAGCAGG - Exonic
1100327801 12:93555834-93555856 CAGCCCAAATGTCCATCAACAGG - Intergenic
1100915516 12:99416251-99416273 CAACCCAGATGTCCTTCATTGGG - Intronic
1101246961 12:102892531-102892553 CAACCAAGATGTCCTTCAATAGG + Intronic
1101257713 12:102995682-102995704 CAACCCAAATGTCCTTCAACAGG - Intergenic
1101421153 12:104552260-104552282 TTGCCCAGATGTTCTTCCTCTGG + Intronic
1101635444 12:106536748-106536770 CAACCAAGATGTCCTTCAATAGG + Intronic
1101769857 12:107739347-107739369 CAGCCAAGACGTCGTTCCTCAGG - Intronic
1101877423 12:108605089-108605111 CAGCCCAAATGTCCATCAACAGG + Intergenic
1102191089 12:110988847-110988869 CAGCCCAGGTGTCCATCAACGGG + Intergenic
1102205471 12:111087895-111087917 CACCCCAGATGTCCTTCACCAGG + Intronic
1102558720 12:113747148-113747170 TAGCCCAGATCTCCCTCCACGGG + Intergenic
1102855714 12:116291490-116291512 CAACCCTAATGTCCTTCAACTGG - Intergenic
1102876157 12:116450645-116450667 CAGCCCAAATGTCCCTCAGCTGG - Intergenic
1103484238 12:121272270-121272292 CAATCCAAATGTCCTTCAACAGG + Intronic
1103705990 12:122872872-122872894 CAGCCCAGGTGTCTTTTAACAGG + Intronic
1103965352 12:124635597-124635619 CAACCCAGATGTCTATCAACAGG - Intergenic
1104035034 12:125092095-125092117 CAGCCTATAGGTCTTTCCACGGG + Intronic
1104948756 12:132429326-132429348 CAGCTCAGATGTCCTTTCCATGG + Intergenic
1105368694 13:19784161-19784183 CAATTCAAATGTCCTTCCACTGG + Intergenic
1105435083 13:20369800-20369822 TTGCCCAGATGTCCATCAACAGG + Intergenic
1105678887 13:22705549-22705571 CAGGCCAGATCTCCTTGCTCAGG + Intergenic
1105766398 13:23564289-23564311 CAACCAAGATGTCCTTCAATAGG + Intergenic
1106007785 13:25787454-25787476 CGGCCCAAATGTCCTTCAACAGG - Intronic
1106058997 13:26267706-26267728 CAACCTAAATGTCCTTGCACTGG - Intronic
1106128199 13:26918342-26918364 CTACCTAGATGTCCTTCAACAGG - Intergenic
1106261825 13:28074316-28074338 CAGCCCAAATGTGTGTCCACAGG - Intronic
1106589094 13:31083901-31083923 CAACCCAGATGTCCATCAACTGG + Intergenic
1106616608 13:31336087-31336109 CACCCCTCATGTTCTTCCACAGG - Intergenic
1106940120 13:34768960-34768982 CACCTCAGCTGTCCATCCACAGG - Intergenic
1107128025 13:36865414-36865436 CAGCCCTGGGGTCCTTCCACAGG + Intronic
1107194154 13:37627667-37627689 CAGCCTAGCTATCCTTCCATGGG + Intergenic
1107543185 13:41412304-41412326 CAGCCCAAATGTCCATCAGCAGG + Intergenic
1107866590 13:44709195-44709217 CAGCCTAGATGTCCTTCAACTGG - Intergenic
1108012549 13:46034376-46034398 CAACTCAAATGTCCATCCACTGG + Intronic
1108046510 13:46388616-46388638 CAGCTCAGAGGTCCTTCCCCGGG - Intronic
1108269232 13:48742463-48742485 CAACCCACATGTCCTTCAATGGG - Intergenic
1110263931 13:73517283-73517305 CAGCTAAGATGTCCTTCAATAGG + Intergenic
1110721156 13:78763786-78763808 CAGTCCAGATGTCTTTCAAATGG - Intergenic
1110935691 13:81285244-81285266 CAGCCAAGATATCCTTCTATAGG - Intergenic
1111068220 13:83126033-83126055 CCGTTCAGATGTCCTTCAACAGG + Intergenic
1111075862 13:83234400-83234422 CAGCCCTAATGTCTTTCAACAGG + Intergenic
1111511117 13:89264077-89264099 CAACCAAGATGTCTTTCAACAGG - Intergenic
1112472859 13:99705189-99705211 CAACCCAGGTGTCCATCGACAGG + Intronic
1112524593 13:100132558-100132580 CAACCCAAATGTCCTTCAACAGG - Intronic
1112527440 13:100165069-100165091 CAGCCCAAATGTCCATCAACAGG - Intronic
1112714950 13:102173572-102173594 CAACCCAAATGTCCATCAACGGG + Intronic
1112833287 13:103479773-103479795 CAACCAAGATGTCCTTCCATGGG + Intergenic
1113239734 13:108323730-108323752 CAACCAAGATGTCCTTCAACAGG - Intergenic
1113461864 13:110487549-110487571 CAGCCCAAATGTCCATCAACAGG + Intronic
1113741491 13:112715146-112715168 CAACCCAAGTGTCCTTCAACAGG - Intronic
1113798156 13:113070830-113070852 CAACCCAGATACCCTTCAACAGG - Intronic
1113829374 13:113283095-113283117 CAACCCAAATGTCCTTCAACAGG + Intergenic
1114183216 14:20382254-20382276 CGGGCCTGATGTCCTTCCCCAGG - Exonic
1114350385 14:21843958-21843980 CAGCCTAGATCTCCTTTCCCAGG - Intergenic
1114389507 14:22291783-22291805 CAACCAAGATGTCCTTCAACAGG + Intergenic
1115054840 14:29110910-29110932 CAGCCCAAATGTCCATCAAATGG - Intergenic
1115856747 14:37638076-37638098 CAACCCAGATGTCCTTCAAGGGG + Intronic
1117239212 14:53811816-53811838 CAGCCCAGATGCACTTTAACAGG + Intergenic
1117453198 14:55872356-55872378 CAACCCAAATGTCCTTCAATGGG - Intergenic
1117459325 14:55929126-55929148 CACCCCAAATGTCCATCAACAGG - Intergenic
1118089528 14:62457814-62457836 CACCCAAAATGTCCTTCAACAGG - Intergenic
1118576302 14:67244601-67244623 CAACTCAAATGTCCTTCAACTGG - Intronic
1118891322 14:69911750-69911772 CAACCCAAATGTCCTTCATCTGG - Intronic
1119209431 14:72819442-72819464 CAACCCAAATGTCCATCAACTGG + Intronic
1119257983 14:73216042-73216064 CAATCCAGATGTCCATCAACTGG + Intronic
1119278075 14:73378494-73378516 CAACCAAGATGTCCTTCAGCAGG + Intronic
1119297024 14:73541260-73541282 CAACCCAAATGTCCTTTAACTGG - Intronic
1119301263 14:73573163-73573185 CAACCCAAATGTCCTTTAACTGG - Intronic
1119442051 14:74635090-74635112 CAGGCCAGATGTGTGTCCACTGG - Intergenic
1119795906 14:77397140-77397162 CAACCCAGATGTCCTTCAACAGG + Intronic
1120452780 14:84691087-84691109 CAACCCTGATGTCCTTCAGCAGG - Intergenic
1121284328 14:92723458-92723480 CAACCCAAATGTCCATCAACTGG + Intronic
1121604813 14:95232851-95232873 CAGTCTTGATGTCCATCCACAGG - Intronic
1121804330 14:96802817-96802839 CAACCCACATGGCCTTCCATGGG - Intronic
1121824313 14:96998263-96998285 CACCCCAGATCTCCTTCTGCTGG - Intergenic
1122376132 14:101259683-101259705 CAACCCAAATGTCCATCAACAGG - Intergenic
1122449196 14:101790627-101790649 CAGCCCAAATGTCCATTAACTGG - Intronic
1122536453 14:102467064-102467086 CAATCCAAATGTCCATCCACTGG - Intronic
1122780002 14:104139537-104139559 CAGCCCAGATGTCCCACAGCTGG + Intronic
1122815837 14:104313473-104313495 CAACCCAGATGTCCTTCGATGGG + Intergenic
1122833461 14:104417310-104417332 CAGCCTAAATGTCCATCAACAGG + Intergenic
1122851415 14:104534116-104534138 CAACCAAGATGTCCTTCAATAGG - Intronic
1123754020 15:23382430-23382452 CAACCTAAATGTCCTTCCCCTGG - Intergenic
1123972274 15:25518834-25518856 CAGCTCAGATGTCCTTCAACAGG + Intergenic
1124071590 15:26398440-26398462 CAACCAAGATGTCCTTCAATAGG - Intergenic
1124138640 15:27057571-27057593 CAGCCCAGAGGCCTTTCCAGGGG - Intronic
1124433226 15:29625267-29625289 CAACCCAAATGTCCTTCAAAGGG - Intergenic
1124574209 15:30893692-30893714 CAACCCAAATGTCCTTCAGCAGG - Intergenic
1124580446 15:30949711-30949733 CAACCCAAATGTCCATCAACAGG + Intronic
1124585923 15:31006511-31006533 CAACCCAAATGTCCTTCAACAGG - Intronic
1125705992 15:41736670-41736692 AAGCCCAGATGTACTTGAACTGG - Exonic
1125987532 15:44069420-44069442 CAATCCAGATGTACTTCAACAGG + Intronic
1126262192 15:46706235-46706257 CAACCCAGATGACCTTTAACAGG + Intergenic
1126419100 15:48452846-48452868 CAACCAAGATGTCCTTCGATAGG + Intronic
1127315199 15:57788456-57788478 AAGCACAGGTGTCCTCCCACTGG + Intergenic
1127404361 15:58625749-58625771 CAGCCCAGATGTCTTTCAAATGG + Intronic
1127579710 15:60327327-60327349 CTCCCCAGGTGTCCTTCAACTGG + Intergenic
1128201192 15:65809518-65809540 TAGCCCAGATGTCCCTCAACTGG - Intronic
1128259088 15:66219846-66219868 TAGCCCAGATGTCCTCCAATGGG + Intronic
1128303004 15:66578980-66579002 CAGCCCTGATGTCCAGCCATAGG - Intergenic
1128438043 15:67675191-67675213 CAACTCAGATGTCCTTCAACAGG + Intronic
1128534093 15:68477608-68477630 CAATCCAGATGTCCTTTAACAGG + Intergenic
1128574664 15:68764437-68764459 CAACCCAGATGTCCTTCAATGGG + Intergenic
1129062984 15:72875292-72875314 CAACCCAAATGTCCATCAACAGG - Intergenic
1129136669 15:73558891-73558913 AAACCCAAATGTCCTTCAACTGG + Intronic
1130010046 15:80144854-80144876 CAACCAAGATGTCCTTCAATAGG + Intergenic
1130041567 15:80409475-80409497 CAACCCAGATGTCCTTCAGTAGG - Intronic
1130249442 15:82288075-82288097 CAACCCAGATGTCTTTCCACTGG + Intergenic
1130831015 15:87599656-87599678 CAACCCAGATGTCCTTCAAAAGG - Intergenic
1130961487 15:88662043-88662065 CAACCCAGACGTCCTTCAATGGG + Intergenic
1131101724 15:89696382-89696404 CAATCCAAATGTCCTTCAACAGG - Intronic
1131143077 15:89993431-89993453 CAGCCCTGAAGTCCACCCACAGG + Intergenic
1131528140 15:93168505-93168527 CAACCCAGATGTCCTTCAGCTGG - Intergenic
1131561439 15:93446468-93446490 CAACCCAAATGTCCATCAACTGG + Intergenic
1131641016 15:94293960-94293982 CAACCCAAATGTCCTTCAAGGGG + Intronic
1131728620 15:95254803-95254825 CAATCCAGATGTCCTTCAAGGGG - Intergenic
1132296676 15:100740271-100740293 CAGCCCAGATGTCCTTCAGTGGG - Intergenic
1132325701 15:100968251-100968273 TAGCCCAAGTGTCCATCCACAGG - Intronic
1132646689 16:1002490-1002512 CAGCCCCGATGTCCCTCCCCGGG + Intergenic
1133514419 16:6494582-6494604 CAACCCAGATATCCTTCAACAGG - Intronic
1133762352 16:8809226-8809248 CAGACCTGATGTCCTGGCACTGG - Intronic
1134381909 16:13735381-13735403 CAGCCCAAATGTCTTTCAACAGG - Intergenic
1134462363 16:14440597-14440619 CAACCTAAATGTCCTTCCCCTGG + Intronic
1134463750 16:14453811-14453833 CAGCCCAAATGTCCATCAACTGG - Intronic
1134903122 16:17956513-17956535 CAACCCAGATGTCCATCAACTGG + Intergenic
1134909534 16:18012004-18012026 CAGCCCAGACATCCTTCAACAGG - Intergenic
1135421811 16:22309946-22309968 CAACCCAGATGCCCATCCGCTGG + Intronic
1135781597 16:25307598-25307620 CAGCGCAGATGTCCTTCAACAGG + Intergenic
1136281723 16:29217459-29217481 CAGCCCACATGCCCATCCACAGG + Intergenic
1137271532 16:46905574-46905596 CAGCCCCCATGCACTTCCACAGG + Intronic
1137371295 16:47908359-47908381 CAACCCAAATGTCCATCAACAGG - Intergenic
1137656723 16:50165820-50165842 CAACCTAAATGTCCTTCTACAGG - Intronic
1138014509 16:53416544-53416566 AAACCCAAATGTCCTTCAACAGG + Intergenic
1138639501 16:58372393-58372415 CAACCTAGATGTCCTTCAACAGG - Intronic
1138725765 16:59137273-59137295 CAACCAAGATGTCTTTCAACAGG - Intergenic
1138769121 16:59641184-59641206 TAACCCAGATATCCTTCAACAGG - Intergenic
1139498126 16:67336237-67336259 CAACCAAGATGTCCTTCAATAGG - Intronic
1140248105 16:73269556-73269578 CAGCCCAGATGTCCATTTGCTGG - Intergenic
1140636058 16:76915197-76915219 TAGCCCAGATGTCCATCAACTGG + Intergenic
1140871594 16:79111811-79111833 GAGCCCAGATGTGTGTCCACTGG + Intronic
1141140318 16:81492999-81493021 CAGCCCAGAGTCCCTTCCAGGGG - Intronic
1141931433 16:87207086-87207108 GAACCCAAATGTCCTTCAACTGG + Intronic
1142084516 16:88169603-88169625 CAGCCCAAACGTCCTTCGGCAGG - Intergenic
1142086101 16:88183376-88183398 CAGCCCACATGCCCATCCACAGG + Intergenic
1142416011 16:89942605-89942627 CAGCCCAGACGTTCATCAACAGG + Intergenic
1142503515 17:347787-347809 CAACCAAGATGTCCTTCATCAGG + Intronic
1142507598 17:374896-374918 CAGCCCAGAGGTCCATCACCAGG + Intronic
1142783173 17:2198074-2198096 CAACCCAAATGTCTTTCCACAGG + Intronic
1142998900 17:3778147-3778169 CAACCCAAATGTCCATCAACAGG + Intronic
1143170869 17:4929521-4929543 CAGCTCAGAATTCCTTCCTCTGG - Intergenic
1143263553 17:5618761-5618783 CAACCCAAATGTCCATCAACAGG - Intronic
1143572328 17:7767335-7767357 CAACCCAAATGTCCATCAACTGG - Intronic
1143643709 17:8215650-8215672 CAGCCCAAATGTCCATCAACTGG + Intergenic
1144231983 17:13216529-13216551 CAACCAAGATGTCCTTCAATAGG + Intergenic
1144373511 17:14616138-14616160 CAACCAAGATGTCCTTCAACAGG - Intergenic
1144449969 17:15368623-15368645 AAGCCTAGATGTCCATCCCCAGG - Intergenic
1144659676 17:17060034-17060056 CAGCCTTGATGTCTTTGCACAGG + Intronic
1146109403 17:30074555-30074577 CAGCCCAGGTGTCCATACATAGG - Intronic
1146238557 17:31191374-31191396 CAGCCCAAATGTCCCTCAGCTGG + Intronic
1147305350 17:39560207-39560229 TAGTCCAGATGTCCTTCTACAGG - Intronic
1147431461 17:40373675-40373697 CAGCCCAGATGTCCATCAACAGG + Intergenic
1147450787 17:40502544-40502566 AAGGCCAGAAGCCCTTCCACTGG - Intergenic
1147516856 17:41126533-41126555 CAACCCAGGTGTCCTTCAATAGG + Intergenic
1148125147 17:45232737-45232759 CAGCCCATATGTCCATACATAGG + Intronic
1148129063 17:45252082-45252104 CAACCCGGATGTCCTTCCGTAGG + Intergenic
1148345266 17:46899006-46899028 CAACCCAAATGTCCATCCACTGG + Intergenic
1148641007 17:49187490-49187512 CAACCCAAATGTCCATCAACTGG + Intergenic
1148904567 17:50904096-50904118 CAACCCAGATGTCCAAACACAGG + Intergenic
1148976161 17:51530880-51530902 CAACCCAAATGTCCATCAACTGG - Intergenic
1149575553 17:57709395-57709417 CAGCCCAAAAGTCCATCAACAGG - Intergenic
1149625404 17:58076724-58076746 CAACCCAAATGTCCATCAACTGG + Intergenic
1149716693 17:58797613-58797635 CCGCTCAGATGTCCATCAACAGG - Intronic
1150191287 17:63242728-63242750 CATCCCAGATGCCCATCAACAGG + Intronic
1150481113 17:65511974-65511996 CAACCCAAATGTCCATCAACAGG + Intergenic
1150548193 17:66184831-66184853 CAGCCCAAATGTCCCTCAAATGG + Intronic
1150689068 17:67348019-67348041 CAGCTCAGATATCCTTCAACAGG - Intronic
1150769178 17:68026915-68026937 CAACCAAGATGTGCTTCCATAGG + Intergenic
1151107282 17:71630939-71630961 AAACCCAAATGTCCATCCACAGG + Intergenic
1151263399 17:72935110-72935132 CAACACAAATGTCCTTCAACTGG + Intronic
1151961103 17:77406023-77406045 CAGCACAGATGCCCTCCCGCAGG - Intronic
1152123794 17:78434378-78434400 CAGCCCAGCTTTCCTTGCAGCGG - Intronic
1152314024 17:79569477-79569499 CAGCCCAAATGTCCGTCAACAGG - Intergenic
1152806287 17:82357929-82357951 CAACCAAGATGTCTTTCCATAGG + Intergenic
1153532399 18:6060904-6060926 CAACCAAGATGTCCTTCAATAGG - Intronic
1153613037 18:6907408-6907430 AAGCCTAGGTGTCCTTCAACAGG + Intronic
1154337835 18:13480156-13480178 CAACCCAGATGTCCTTCAGTAGG + Intronic
1155031399 18:21987984-21988006 CAACCCAGATGTCCTTCAACAGG + Intergenic
1155440023 18:25852257-25852279 CAGCCCAGAGCTCCTTCCCCAGG - Intergenic
1155862147 18:30915497-30915519 CAATCCAAATGTCCTTCAACAGG + Intergenic
1156310179 18:35914991-35915013 CAATCCAGATGTGCTTCCATGGG - Intergenic
1156413606 18:36862604-36862626 CAACACAAATGTCCTTCAACAGG - Intronic
1157352711 18:46903809-46903831 CAACCCAGATGTCCCTCAACAGG + Intronic
1157509471 18:48260100-48260122 CAGCCCAAATGTCTATCAACAGG + Intronic
1157557591 18:48622807-48622829 CAGCCCATATGCCCATCCACAGG - Intronic
1157759340 18:50248880-50248902 CAACTCAAATGTCCTTCAACAGG + Intronic
1158343672 18:56492848-56492870 CAATCCAGATGTCCATCAACAGG - Intergenic
1158354672 18:56604676-56604698 CAGTCCATAAGTCCTTCAACTGG + Intronic
1158370839 18:56801848-56801870 CAACCCAGATGTCCCTAAACAGG - Intronic
1158380534 18:56925175-56925197 CAACCCAAATGTCCATCAACAGG - Intronic
1158512752 18:58106151-58106173 CAGCACGGATGTCCCTACACAGG - Intronic
1158645591 18:59242930-59242952 CGGCCCAGATATCCTTCAATAGG - Intergenic
1159453510 18:68632347-68632369 CAACCCAGATTTCCTTCAACTGG + Intergenic
1160065675 18:75572129-75572151 CAGAGCAGATGTCCTTCAACTGG - Intergenic
1160175512 18:76590925-76590947 CAGCCCACATGTCCATCAATGGG + Intergenic
1160940193 19:1617148-1617170 CAGCCAAGTTGCCCTCCCACAGG - Intronic
1161202359 19:3022694-3022716 CAGCCCAGATGTCTGTCTTCAGG - Intronic
1161479224 19:4502374-4502396 CCGCCCAGCTCTCCTGCCACTGG - Exonic
1161553244 19:4926206-4926228 CAACCCAGGTGTCCATCAACAGG - Intronic
1161717317 19:5883670-5883692 CAGCCAAGATGTCCTTCAGCAGG + Intronic
1161773813 19:6246377-6246399 CAACACAGACGTCCTTCAACAGG + Intronic
1163008385 19:14410239-14410261 CAGGCCGGATGTCCTTGCTCAGG + Exonic
1163013560 19:14440381-14440403 CAGGCCAGTAGTCCTTCCCCGGG + Intronic
1163376464 19:16935644-16935666 CAGCCCGGATGTCCTTCAGCAGG - Intronic
1163643558 19:18475583-18475605 TAGCCCAAATGTCCGTCAACTGG + Intronic
1163775002 19:19212561-19212583 CAGCGCAGATACCCTTCCATTGG - Intronic
1164420323 19:28086039-28086061 CAACCCATATGTCCTTCAATAGG + Intergenic
1164493786 19:28738811-28738833 CAACCCAGACGTCCTTCAATAGG + Intergenic
1164618883 19:29682119-29682141 CAGCCCAGATGACCAGCCCCAGG - Intergenic
1165896954 19:39147396-39147418 AAACCCAGATGTCCTCCAACGGG - Intronic
1166155284 19:40906712-40906734 CAACCAAGATGTCCTTTAACAGG - Intergenic
1166188050 19:41154983-41155005 CAGCTCAGATGTCCATCAACAGG + Intergenic
1167518641 19:49938804-49938826 CAGCCCAGATGGCCTTCCCTCGG + Intronic
1168413143 19:56152447-56152469 CAACCCAAATGTCCTTCAACAGG - Intronic
1168421645 19:56207970-56207992 AAGCAGACATGTCCTTCCACCGG + Intronic
1168518084 19:57025298-57025320 CAGCCAAGATGTCCTTCAGTCGG + Intergenic
925253177 2:2459716-2459738 CAACCAAGATGTCCTTCAGCAGG + Intergenic
925451605 2:3973858-3973880 AAGCCCAGCTCTCCCTCCACGGG + Intergenic
925543963 2:4998839-4998861 CAACCAAGATGTCCTTCAATAGG + Intergenic
925550644 2:5070362-5070384 CAACCTAGATGTCCTTATACAGG + Intergenic
925688929 2:6500149-6500171 AAGCCCAGTTCTCTTTCCACTGG - Intergenic
926040875 2:9672105-9672127 CATCCCAGATGTCCTTTAATAGG - Intergenic
926212560 2:10881793-10881815 CAGCCCAGATGTCCTTCAGCAGG - Intergenic
926794341 2:16606592-16606614 CTGCCCAGCTTTCATTCCACAGG + Intronic
926845132 2:17128308-17128330 CAGCCCAGATGTCCTTCAACTGG - Intergenic
927179093 2:20431468-20431490 TAGCCCAAATGTCCAACCACGGG + Intergenic
927795880 2:26048108-26048130 CAGCCCAGATGTCGGTCAATGGG - Intronic
927839000 2:26425319-26425341 CAACCCAAATGTCCATTCACAGG - Intronic
928068529 2:28191484-28191506 CAACCCAAATGTCCATCAACAGG + Intronic
929213495 2:39385110-39385132 CAACCCAGATACCCTTCAACTGG - Intronic
929220605 2:39461332-39461354 CAGCCCAAATATCCAACCACTGG + Intergenic
929236811 2:39614022-39614044 CAACCAAGATGTCCTTCAATAGG - Intergenic
929319367 2:40523016-40523038 CAACTCAGATGTTCTTCAACAGG - Intronic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
929567151 2:42995969-42995991 CAACCCAAATGTCCATCAACCGG - Intergenic
929623288 2:43379784-43379806 CAATCAAGATGTCCTTCAACAGG + Intronic
929949006 2:46392127-46392149 CAACCCAAATGTCCTTCGACAGG + Intergenic
929985117 2:46722577-46722599 TAACCCATATGTCCTTCAACAGG - Intronic
930466819 2:51763787-51763809 CAACCCAGATGCTCTTCAACTGG + Intergenic
931424634 2:62159514-62159536 CAGCCCAGATGTCCTTCCACAGG + Intergenic
931489644 2:62730544-62730566 CAACTAAGATGTCCTTCAACAGG - Intronic
932419496 2:71593019-71593041 TACCACAGATGCCCTTCCACTGG - Intronic
933263816 2:80159035-80159057 CAACCCACATGTCCTTCAATGGG - Intronic
933356652 2:81218677-81218699 CACCCAAGATGTCCTTCAGCAGG + Intergenic
933526760 2:83450870-83450892 CAGCCCAGATGTCTTTATTCAGG + Intergenic
933611229 2:84437806-84437828 CAACCCAGATGTCTCTCAACAGG + Intronic
933657011 2:84896909-84896931 CAACCAAAATGTCCTTCAACAGG + Intronic
934478149 2:94606598-94606620 CAACCCAAATGTCCATCCACAGG + Intergenic
934614462 2:95762656-95762678 GAGCCCAGATGTACTTCCCTGGG - Intergenic
934646443 2:96061843-96061865 GAGCCCAGATGTACTTCCCTGGG + Intergenic
935049942 2:99516859-99516881 CAGCCTAGATGTCCTTCAGTGGG - Intergenic
935231875 2:101105959-101105981 CAGCCAAGATGTCCTTCAATAGG + Intronic
935271510 2:101438478-101438500 CAGCCTAGATGTCCTTCATTAGG - Intronic
935449852 2:103196871-103196893 CAACCCAGATGTCCTTCAGGGGG + Intergenic
935620190 2:105123033-105123055 CAGCCCAAATGTCTATCAACAGG + Intergenic
935625072 2:105165541-105165563 CAGCCCAAATGTCCATCAATTGG - Intergenic
936727728 2:115341840-115341862 CAACCAAGATGTCCTTCAATAGG - Intronic
936800889 2:116264206-116264228 CATTCCAGATGTCCTTCAACAGG + Intergenic
937235548 2:120429848-120429870 GAGCCCAGAAATCCTTCCAGGGG + Intergenic
937349003 2:121148059-121148081 CAACCCAAATGTCCTTCAATGGG + Intergenic
937978733 2:127598010-127598032 CAGCCCAGATGTCCTTCTACAGG - Intronic
938019904 2:127897717-127897739 GAGCCCAGATGTCCTTCAACAGG + Intergenic
938090480 2:128428308-128428330 CAGCCCAGATGTCCTTCAACAGG - Intergenic
938255943 2:129859804-129859826 GAAGCCAGATGTCTTTCCACTGG - Intergenic
938705598 2:133922087-133922109 CAACCAAGATGTCCTTCGGCAGG - Intergenic
938970745 2:136429182-136429204 CAACCAAGATGTCCTTCAATGGG - Intergenic
939007715 2:136808484-136808506 CAACCAAGATGTCCTTCAATAGG - Intronic
939205392 2:139095870-139095892 CATCCAAGATGTCCTTCCCTCGG - Intergenic
939573655 2:143869799-143869821 CAACCCACATGTCCTTCAAAGGG + Intergenic
939697275 2:145342430-145342452 CACCCCAGATGTCCTTCAACAGG + Intergenic
939859822 2:147406070-147406092 CAACTCAGATGTCCTTTCACTGG + Intergenic
939962046 2:148573749-148573771 CAACCCAGGTGTCCTTCAATAGG + Intergenic
940015954 2:149104151-149104173 CAACCCAAATGTCCATCAACAGG - Intronic
940258720 2:151759039-151759061 CAGCCCAAATATCCTTACACTGG - Intergenic
940670832 2:156665895-156665917 CAACCAAGATGTCCTTCGACAGG - Intergenic
940853314 2:158708597-158708619 CAACCTAGATGTCCTTCAATAGG - Intergenic
941036383 2:160573404-160573426 CAACCTAGAAGTCCTTCAACAGG + Intergenic
941101449 2:161300337-161300359 CAACCCAAATGTCCATCAACTGG + Intergenic
941996730 2:171608304-171608326 CAACCTAAATGTCCTTCAACAGG + Intergenic
942589940 2:177532714-177532736 CAGCCCAGATGTCCTTCAGCTGG + Intronic
942747425 2:179251019-179251041 CAGCCTAGATATCCTTCAATGGG + Intronic
942796804 2:179830470-179830492 CAACCTAGATGTCCTTCAAAAGG + Intronic
943040435 2:182797917-182797939 CAACCCAAATGTCCATCAACAGG + Intergenic
943068390 2:183113108-183113130 CAACCCAGATGTTCTTCAATGGG + Intergenic
943265012 2:185718563-185718585 CAGCCCAAGTGTCCTTCAAAAGG - Intergenic
943434928 2:187853250-187853272 CAACCAAGATGTCCTTCAATAGG - Intergenic
943596218 2:189860477-189860499 CAACCCAAATGTCCATCAACTGG - Intronic
943719368 2:191187326-191187348 CAGCCCAAGTGTCCTTCAACAGG - Intergenic
943748991 2:191491599-191491621 CAGCTCAAATGTCTTTCAACTGG - Intergenic
943801394 2:192062394-192062416 CAACCCAGATATCCTTCAACAGG - Intronic
943848347 2:192681154-192681176 CAACACAGATGCCCTTCAACAGG - Intergenic
944091659 2:195918516-195918538 CAACCAAGATGTCCTTCGACAGG + Intronic
944524902 2:200609015-200609037 CAGCCAAAATGTCCTTCACCTGG - Exonic
944538959 2:200738691-200738713 CAGCCAAGATGTCCTGCATCTGG - Intergenic
944620703 2:201512677-201512699 CAACCCAGATGTCCTTTAACTGG - Intronic
944630743 2:201621462-201621484 GAGCCCAGATATCCTTCAATAGG + Exonic
944758867 2:202792431-202792453 CAACCCAAATGTCCATCAACTGG + Intronic
945351002 2:208779721-208779743 CAACCCAAATGTACTTCAACAGG - Intronic
945722929 2:213441247-213441269 CACCCCAGATGTCCTATCAGTGG + Intronic
945787812 2:214265026-214265048 CAGCCAAGATGTCCTTCAATAGG - Intronic
945931766 2:215862402-215862424 CAGCCCAAATATCCATCAACAGG + Intergenic
946144779 2:217722133-217722155 TAACCCAGATGTCCTTTAACAGG + Intronic
946204095 2:218090924-218090946 CAACTCAGATGTCCATCCACAGG - Intergenic
946290778 2:218743445-218743467 CAACCCAAATATCCTTCAACAGG - Intronic
946307218 2:218863040-218863062 GAGCCCAGATCCCCTTCCCCTGG + Intronic
946598256 2:221330761-221330783 CAACCAAGATGTCCTTCAACAGG + Intergenic
946661432 2:222004398-222004420 CAACCAAGATGTCCTTCCATAGG - Intergenic
946947772 2:224839447-224839469 CACTCCAAATGTCCTTCAACAGG + Intronic
947131235 2:226927375-226927397 CAACCCAAATATCCTTCAACTGG - Intronic
947273250 2:228362921-228362943 CAACCCAGATGTTCTTCAACTGG - Intergenic
947683988 2:232064434-232064456 CAACCAAAATGTCCTTCAACTGG - Intronic
947784004 2:232798307-232798329 CAACCCAGATGTCCTTCAATGGG - Intronic
947848350 2:233263805-233263827 CAGCCAAGCTGTCCTTCAACAGG + Intronic
948397829 2:237660744-237660766 TAGCTCAGAGCTCCTTCCACAGG - Intronic
948787750 2:240361798-240361820 CAACCCAGATATCCCTGCACAGG + Intergenic
1168817790 20:752405-752427 CAGCGCAGATGTCCACCAACAGG + Intergenic
1169294615 20:4383648-4383670 CAGCCCAGATGTTTTTCAACAGG + Intergenic
1169297744 20:4414582-4414604 CAACCCAAATGCCCTTCAACAGG - Intergenic
1169312630 20:4559390-4559412 CAACCCAAATGTCCTTCAATAGG + Intergenic
1169331285 20:4718410-4718432 CCGCCCAAATGTCCATCAACAGG + Intergenic
1170161565 20:13318580-13318602 CAGCCAAGATGTCCTTCAGTAGG + Intergenic
1170193156 20:13663664-13663686 CAACCAAGATGTCCTTCAATAGG - Intergenic
1170205852 20:13797338-13797360 CAGCCAAGATGTCCTTCAGTAGG + Intronic
1170741546 20:19062839-19062861 CAACACAGATGTCCTTCAATAGG + Intergenic
1170815746 20:19712741-19712763 TGGCCCAGATGTCCATCAACAGG + Intronic
1170894402 20:20400776-20400798 CAGCCCGAATGTCCATCAACTGG + Intronic
1171182521 20:23101240-23101262 CAACCCAATTATCCTTCCACAGG + Intergenic
1171795157 20:29560662-29560684 CACCCCAGTTGTCCTTGCTCTGG + Intergenic
1171853300 20:30323603-30323625 CACCCCAGTTGTCCTTGCTCTGG - Intergenic
1172019324 20:31901753-31901775 CAGCTGAAAGGTCCTTCCACAGG + Intronic
1172440975 20:34966226-34966248 CTGTCCAGATATCCTTCCACAGG + Intergenic
1173262860 20:41451997-41452019 GAGTCAGGATGTCCTTCCACCGG + Exonic
1174024527 20:47562150-47562172 CAACCAAGATGTCCTTCAATAGG - Intronic
1174656417 20:52175970-52175992 CGGCCCAAATGTCCCTCCCCAGG + Intronic
1174675742 20:52352411-52352433 CAACCCACATGTCCATCAACAGG - Intergenic
1174686532 20:52461321-52461343 CAGCCTCAATGTCCATCCACAGG - Intergenic
1174974927 20:55321343-55321365 CAACCCAGATGTCCACCCATAGG - Intergenic
1174982601 20:55413557-55413579 TAACCCAGATGTTCTTCAACAGG + Intergenic
1175261595 20:57677791-57677813 CAATCCAGATGTCCCTCAACAGG + Intronic
1175270864 20:57733367-57733389 CAGCCCAAATGTCCCGCAACAGG - Intergenic
1175272073 20:57741452-57741474 CAGCCTAAATGTCCATCCACAGG - Intergenic
1175519753 20:59592894-59592916 CAACCAAGATGTCCTTCAGCAGG - Intronic
1175534810 20:59702106-59702128 AAGCCAAGATGTCCTTCCACAGG - Intronic
1175687758 20:61043975-61043997 GGGCCCTGTTGTCCTTCCACTGG - Intergenic
1175730984 20:61353760-61353782 CACCCCAGTTCACCTTCCACTGG + Intronic
1175747125 20:61465078-61465100 CATCCCAGGTGACCGTCCACAGG + Intronic
1175832124 20:61970445-61970467 CAGCCCAAATGCCCTTCAGCAGG - Intronic
1175876618 20:62233153-62233175 CAGCCCAGCTGTCTCTCCTCCGG + Intronic
1176273675 20:64250310-64250332 CAACCAAGATGTCCTTCAACAGG - Intergenic
1176878457 21:14161210-14161232 CATCCCAGATGCTCTTCAACAGG + Intronic
1177001087 21:15614060-15614082 CAACCCAGATGTCCTTTAGCAGG + Intergenic
1177274506 21:18891412-18891434 CAACCAAGATGTCCTTCAATAGG + Intergenic
1177447122 21:21212150-21212172 CAACCCATATGTCCTTCAAGAGG + Intronic
1177641398 21:23848329-23848351 CAGCCCAAATGTCCTTCAACAGG - Intergenic
1178598848 21:33978753-33978775 CAACCCAAGTGTCCATCCACAGG - Intergenic
1178603432 21:34014688-34014710 CAACCAAGATGTCCTTCAATAGG + Intergenic
1178675696 21:34629886-34629908 CAACCAAGATGTCCTTCAATAGG + Intergenic
1178999077 21:37437750-37437772 CAACCCAAATGTGCTTCAACAGG - Intronic
1179466073 21:41574106-41574128 CAACCCAAATGTCCTCCAACAGG - Intergenic
1179475866 21:41643630-41643652 CAACCCAAATGTCCATCAACAGG + Intergenic
1179715816 21:43287601-43287623 CAACCCAGATGTCCTTCACCAGG - Intergenic
1179963192 21:44783506-44783528 AAGCCCAAATGTCCATCAACTGG + Intronic
1180842234 22:18964797-18964819 GACCCCAGATGTCCTGACACAGG + Intergenic
1181442540 22:22944193-22944215 CAGCCCAGATGTCCATCCACTGG - Intergenic
1181545726 22:23601185-23601207 CAGCCCAATTGTCATTCAACTGG + Intergenic
1182505965 22:30782666-30782688 CAACTCAAATGTCCATCCACAGG - Intronic
1182992360 22:34780321-34780343 CAACACAAATGTCCTTCAACTGG + Intergenic
1183368059 22:37417591-37417613 CCACCCAGCTTTCCTTCCACAGG - Intronic
1183374032 22:37452364-37452386 CAACCCAAATGTCCATCAACAGG + Intergenic
1183589466 22:38771365-38771387 CAGTTCAAATGTCCTTCCTCTGG + Intronic
1184027888 22:41871521-41871543 CAACTCAAATGTCCATCCACAGG + Intronic
1184362795 22:44028548-44028570 CAACCAAGATGTCCTTCAGCAGG - Intronic
1184887634 22:47356137-47356159 GTGCCCAGGTGTCCTTCCTCAGG + Intergenic
1185077159 22:48689707-48689729 CAGCCCAGCTGTGCTTTCATGGG + Intronic
949238910 3:1846149-1846171 CAACCAAGATGTCCTTCAATAGG + Intergenic
949720400 3:6982877-6982899 CAGCCCAAATGTCCTTCTCTGGG - Intronic
949913184 3:8932723-8932745 CAGTCCAGTTGTCCATCAACAGG + Intronic
950629128 3:14270018-14270040 CAGCACAAATGTCCTTCAGCAGG - Intergenic
950635263 3:14309809-14309831 CAACCAAGATGTCCTTCAGCAGG + Intergenic
950909286 3:16571475-16571497 CAGCCCAGATATCCACCAACAGG + Intergenic
951091778 3:18582105-18582127 CAGCTCAGATGTCCTGCAACAGG + Intergenic
951635863 3:24775604-24775626 CAATCCAGATGTCCTTCAACTGG - Intergenic
951974000 3:28482397-28482419 CAACCAAGATGTCCTTTCATAGG - Intronic
951983866 3:28596212-28596234 CAGCCCAGAAGTACCTCAACTGG - Intergenic
952131338 3:30367010-30367032 CAGCCAAGATGTCCTTCAGTAGG - Intergenic
952767195 3:36964195-36964217 CAGCCTAAATGTCCCTCCACAGG - Intergenic
953273250 3:41467557-41467579 TAGCCCAGGTGTCCATCAACAGG + Intronic
953456615 3:43047399-43047421 CAGCCCAGATGTCCTCATTCAGG - Intronic
953508435 3:43509791-43509813 CAGACCAGATGTCCTTCAGTGGG + Intronic
954270495 3:49504397-49504419 CAACCCAGATGTCCTTCAATGGG - Intronic
954361152 3:50123561-50123583 CAGACCAGGTTTCCTTCCTCAGG - Intergenic
955381662 3:58443581-58443603 TAGCCCAAATGTCCTTCAATGGG - Intergenic
955570032 3:60294924-60294946 CAATCCAGATGTCCTTCTGCAGG - Intronic
956092647 3:65684350-65684372 ATGCCAAGATGTCCTTCAACAGG + Intronic
956238746 3:67105532-67105554 CAACCAAGATGTCCTTCAATAGG + Intergenic
956542238 3:70353813-70353835 CAACTCAGATGTCCTTCAATGGG + Intergenic
957554540 3:81749190-81749212 CAATCCAAATGTCCTTCAACAGG + Intronic
957902205 3:86509103-86509125 CAACCAAGATGTCCTTCAATAGG + Intergenic
959428910 3:106227608-106227630 CAGCCCAGATGCCCATCAATGGG + Intergenic
959509303 3:107191757-107191779 CAACCCAGATGTCCTTCAACAGG + Intergenic
961029949 3:123593173-123593195 CAACCAAGATGTCCTTCGATTGG - Intergenic
961065751 3:123875209-123875231 CAGCCCAAATGTCCTTCAACTGG + Intronic
961418266 3:126778167-126778189 CAGCCCAAATATCCATCAACTGG - Intronic
961612074 3:128147836-128147858 CAACCCAAATGCCCTTCAACAGG + Intronic
961652736 3:128425400-128425422 CAGCCCGAGTGTCCTTCCGCAGG - Intergenic
961677340 3:128575838-128575860 CTGCCCAGATGTGCTTCCTGTGG - Exonic
962062627 3:131946423-131946445 AAGCCCAAATGTCCATCAACAGG - Intronic
962121217 3:132562068-132562090 CAACCGAAATGTCCTTCAACAGG - Intronic
962121847 3:132569561-132569583 CAACCCAGATGTCCCTCAACAGG + Intronic
962594413 3:136925737-136925759 CCACCCAGATGTCCTTCAACAGG - Intronic
962597669 3:136963209-136963231 CGGCCCAGATGTCCTTCAACAGG - Intronic
962846810 3:139280510-139280532 CAGCCCAGATGTCCCTTGCCTGG - Intronic
963389080 3:144634494-144634516 CGGCCCAGATGTCCTTCAGTAGG + Intergenic
963424490 3:145109005-145109027 CAGCCAAAATGTCCTTCAATAGG - Intergenic
964163787 3:153676641-153676663 CAACCAAGATGTCCTTCCATAGG - Intergenic
965396771 3:168168644-168168666 CAACCCAGGTGTCCTTCAATGGG - Intergenic
965608706 3:170522381-170522403 CAACCCAGTTGTCCTCCAACTGG + Intronic
966615161 3:181905172-181905194 TACCCCAGATAGCCTTCCACAGG + Intergenic
966749417 3:183307730-183307752 CAGCCCAGAGCGCCTTCCAAGGG + Intronic
966956082 3:184880564-184880586 CAACCCAGATATTCTTCAACCGG - Intronic
967308217 3:188080225-188080247 CAACCAAGATGTCCTTCTATAGG + Intergenic
967374602 3:188786677-188786699 AAACCCAGATGTCTTTCAACAGG + Intronic
967401666 3:189069734-189069756 TAGCCTAGATGTGCTTCAACAGG + Intronic
967914717 3:194570178-194570200 CAGCCCAAATAACCTTCTACAGG + Intergenic
968063092 3:195741034-195741056 CAACCAAGATGTCCTTCAGCAGG - Intronic
968496110 4:916928-916950 CAACCCAAATGTCCATCAACAGG + Intronic
968496811 4:922894-922916 CAGCCCAGATGTCCTTCCACGGG + Intronic
968851577 4:3083881-3083903 CAGCTCAGATGTCCTTCAACAGG + Intronic
968951218 4:3693329-3693351 CAGCCCAAATGTCTATCAACAGG - Intergenic
968955944 4:3719487-3719509 CAGCCTAAATGTGCTTCAACAGG + Intergenic
969038035 4:4271834-4271856 CCACCCAGGTGTCCCTCCACAGG + Intronic
969068096 4:4506287-4506309 CAACACAAATGTCCTTCAACAGG + Intronic
969089911 4:4685936-4685958 CAGCCTAGATGTCCAGCCACGGG + Intergenic
969357166 4:6635618-6635640 CAATCTAGATGTCCTTCCATAGG - Intergenic
969421533 4:7100174-7100196 CAAACCAGATGTCCATCCAATGG - Intergenic
969505676 4:7585826-7585848 CAGTCAAGCTGTCCTTCAACAGG - Intronic
969621871 4:8282700-8282722 CAGCGGGGATGTCCTTCCCCAGG - Intronic
969699461 4:8760074-8760096 CAACCCAGATGTCCCTCAAGTGG + Intergenic
971815792 4:31487046-31487068 CAACCAAGATGTCCTTCAATAGG + Intergenic
972182469 4:36485778-36485800 CAACCCAGATGTCCTTCAGCAGG + Intergenic
972663309 4:41139514-41139536 CAACCAAGATGTCCTTCAATAGG + Intronic
972778135 4:42262253-42262275 CAACCAAGATGTCCTTCAATAGG + Intergenic
972784341 4:42313110-42313132 CAACCAAGATGTCCTTCAATAGG - Intergenic
973723907 4:53752972-53752994 CAACCCAAATGTCCATCAACAGG - Intronic
973875686 4:55216253-55216275 CAGCCCAAATGTCTATTCACAGG - Intergenic
974041767 4:56863702-56863724 CAGCCCAGATCTGCTTCCAAGGG + Intergenic
974259134 4:59502290-59502312 TAGCCCAAATGTCCTTCAACTGG - Intergenic
974451143 4:62061859-62061881 CAACCCAAATTTCCTTCAACTGG - Intronic
975225731 4:71869850-71869872 TAACGCAGATGTCCTTCAACAGG - Intergenic
975631288 4:76405285-76405307 CAGCCAAGATGTCCCTCAAAAGG + Intronic
975776237 4:77790307-77790329 CAACCCAGATGTCCTTCAGTAGG - Intronic
975884559 4:78949282-78949304 CAACCCAGATGTCCTTCAACAGG - Intergenic
975977072 4:80111675-80111697 CAACCAAGATGTCCTTCAATAGG + Intronic
976129478 4:81869775-81869797 GAGCCCAGGTGTCCATCAACAGG + Intronic
976318958 4:83689639-83689661 CCACCCATATGTCCTTCAACAGG - Intergenic
977488792 4:97685307-97685329 CAACCAAGATGTCCTTCAACAGG + Intronic
977973389 4:103236874-103236896 CAACTCAAATGTCCTTCAACGGG + Intergenic
978733055 4:112053128-112053150 CAGCCTAGATGTCCTTCAACAGG - Intergenic
978930621 4:114306989-114307011 CAACCCAAATGTCCATCAACAGG - Intergenic
979306017 4:119144356-119144378 CAACCCAGATGTACTTCAATGGG - Intronic
979374847 4:119934102-119934124 CAAGCCAGAAGTCCTTCAACAGG + Intergenic
979383798 4:120040307-120040329 CAAACCAGAAGTCCTTCAACAGG - Intergenic
979663131 4:123281682-123281704 CCACCAAGATGTCCTTCAACAGG + Intronic
979672489 4:123374635-123374657 CAATCCAGAGGTCCTTCAACAGG - Intergenic
980001368 4:127492942-127492964 CAACCAAGATGTCCTTCAGCAGG + Intergenic
980441984 4:132860622-132860644 CAACCAAGATGTCCTTCAATAGG - Intergenic
980502775 4:133678046-133678068 CAACCAAGATGTCCTTCAATAGG - Intergenic
981498583 4:145421362-145421384 CAGCTCAAATGTCCATCAACTGG - Intergenic
981554271 4:145976032-145976054 CAATCCAGATGTCCTTCGACGGG + Intergenic
981621282 4:146701912-146701934 TAGCCCAAATGTCCATCAACTGG - Intergenic
982098425 4:151944965-151944987 CAACCCAAATGTCCCTCAACAGG + Intergenic
982956943 4:161782137-161782159 CAGCCAAGTTGCCCTTCAACAGG - Intronic
983193630 4:164781384-164781406 CAGCCCAAATGTCCTTTAGCAGG + Intergenic
983921364 4:173349276-173349298 CAACCCAGATGTCCTTCACTGGG + Intergenic
984261658 4:177450331-177450353 CAGCCAAGATGTCCTTCAGTAGG - Intergenic
984996092 4:185431444-185431466 TAGCCCAAATGTCCATCAACAGG - Intronic
985015370 4:185628081-185628103 CAACCAAGATGTCCTTCAATAGG - Intronic
985083540 4:186290942-186290964 CAACCCAAGTGTCCGTCCACGGG - Intergenic
985841992 5:2313538-2313560 CAAACCAGATGTCCTTCAATGGG - Intergenic
985990522 5:3556414-3556436 CAACCAAGATGTCCTTCAACAGG + Intergenic
986325870 5:6673675-6673697 CAACCAAGATGTCCTTCAATAGG + Intergenic
986474653 5:8115095-8115117 CAGCCCAGAAGACCTCCCAGGGG + Intergenic
987102355 5:14603223-14603245 CAATCCAGATGTCCTTCAACTGG - Intronic
987688211 5:21232572-21232594 CAGCCAAGATGTCTTTCAATAGG + Intergenic
988372266 5:30386632-30386654 CTACCAAGATGTCCTTCAACAGG + Intergenic
988937213 5:36096484-36096506 CAACCAAGATGTCCTTCAATGGG - Intergenic
989462797 5:41720304-41720326 CAGCCCAGATATCCTTAAATGGG - Intergenic
989496682 5:42117078-42117100 CAACCCACGTGCCCTTCCACTGG + Intergenic
989642432 5:43595991-43596013 CAGCCCATATGTCCTTCAACAGG - Intergenic
989980056 5:50632850-50632872 CAACCAAGATGTCCTTCAATAGG + Intergenic
990562812 5:57000530-57000552 CAACCCAGATGTCCTTCAAAGGG + Intergenic
990611765 5:57464711-57464733 CAGTCCAGAAGTCATTACACTGG + Intergenic
990971560 5:61512362-61512384 CAATCTAGATGTCCTTCAACTGG - Intronic
990998672 5:61759522-61759544 CACTCCAAATGTCCTTCAACAGG - Intergenic
991621975 5:68554590-68554612 CAACCCAAATGTCCTTCAATAGG - Intergenic
992128826 5:73670404-73670426 CAGCCCAAATGTCTTTCAACAGG - Intronic
992333728 5:75743656-75743678 CAGCCCAAATGTCTATCCACAGG - Intergenic
992633703 5:78706868-78706890 CAGCCCAAATGTCATTCAATTGG - Intronic
992694118 5:79267781-79267803 CAACCAAGATGTCTTTCAACAGG - Intronic
992697737 5:79307147-79307169 CAACCAAGATGTCCTTCAATAGG - Intronic
992699921 5:79331660-79331682 TAACCCAGATGTCCATCAACAGG + Intergenic
992983284 5:82200033-82200055 CAGCCCAAAGGTCTTTCAACTGG - Intronic
993151585 5:84169788-84169810 TTGCACAGATGTCCTTCAACAGG - Intronic
993473284 5:88333013-88333035 TAACCCAGATATCCTTCAACAGG - Intergenic
993907287 5:93637327-93637349 CAACCCAAATGTCCTTCAACAGG - Intronic
994121293 5:96116347-96116369 TAACCCAGATGTCCATCAACTGG - Intergenic
994668576 5:102738227-102738249 CAACCCAGATGTCTTTCAACGGG + Intergenic
994813518 5:104554783-104554805 CAGCCAAGAAGTCCTTCCAAAGG + Intergenic
994918692 5:106013010-106013032 TATCCCAGATGTCCTTCAACAGG + Intergenic
995024429 5:107402828-107402850 CAGGCAAGCTGTGCTTCCACTGG - Intronic
995602726 5:113815985-113816007 CAACCCAAATGTCCATCAACAGG + Intergenic
995619037 5:114003008-114003030 CAGCCAAGATGACCTTCAATGGG + Intergenic
995758081 5:115532805-115532827 CAGTGCAGATGTCCATCAACGGG - Intronic
995988115 5:118205059-118205081 CAGCCCAGGTGCCATTCAACAGG + Intergenic
996096408 5:119403657-119403679 CAACCCAGATATCCTTCAATGGG - Intergenic
996187387 5:120493932-120493954 CAACCCAAATGTCCTTCAGCCGG - Intronic
996326357 5:122279023-122279045 CAACCCACATGACCTTCAACAGG + Intergenic
996495758 5:124153918-124153940 CAACCCAGATGTCCTTCAGTGGG + Intergenic
996622863 5:125531291-125531313 CAACGCAAATGTCCTTCAACAGG - Intergenic
996761848 5:126994110-126994132 CAACCCAAATGTCCTTCAGCTGG + Intronic
996811488 5:127520426-127520448 CAGCCTAAATGTCCTTCAGCAGG + Intronic
997053020 5:130405308-130405330 CAATCCAAATGTCCTTCAACAGG - Intergenic
997054914 5:130430642-130430664 CAGCCAAGATGTCCTTCAGTAGG + Intergenic
997982217 5:138475429-138475451 CAGCCCAGATGTCCCTCCACAGG - Intergenic
998040952 5:138950810-138950832 CAGCCCAGAGCTCCTTCGAATGG - Intronic
998118167 5:139554571-139554593 CAGCCCAAGTATCCATCCACAGG - Intronic
998127782 5:139635923-139635945 CAGCCCAGCTGGCCTTGCACTGG + Intergenic
998763858 5:145462657-145462679 CAGCCCTGATCTCCTGCCAGTGG - Intergenic
999186139 5:149710796-149710818 CAACACAAATGTCCTTCAACTGG - Intergenic
999273868 5:150315301-150315323 CAGCCCAAATGTCCTTTCAATGG + Intronic
999312408 5:150559895-150559917 CAACCTAGATGTCCATCCACAGG + Intergenic
999403312 5:151284288-151284310 AAGCACAAATGTCCTTCCCCAGG + Intronic
999552019 5:152699544-152699566 CAACCAAGATGTCCTTCAATAGG - Intergenic
999700890 5:154227091-154227113 CAACCCACATGTCCATCAACAGG - Intronic
999713136 5:154336231-154336253 CAGCCAAGATGTCCTTCAGTAGG - Intronic
999749226 5:154614274-154614296 GAACCCAAATGTCCTTCAACTGG + Intergenic
999833264 5:155341153-155341175 CAGCCTAGTCCTCCTTCCACTGG - Intergenic
1000280915 5:159781206-159781228 CAACCAAGATGTCCTTCAGCAGG - Intergenic
1000717826 5:164668523-164668545 CTACCCAGATGTCCTTCAAATGG - Intergenic
1001008519 5:168076136-168076158 CAACCCAAATGTCCATCAACAGG - Intronic
1001077368 5:168640282-168640304 CAGCCCATATGTCCATCAACAGG - Intergenic
1001439619 5:171731967-171731989 TAACCCAGATATCCTTCAACAGG + Intergenic
1001623714 5:173111657-173111679 CAACCCAAATGCCCTTCAACTGG - Intronic
1001868358 5:175125922-175125944 CACCCCAGATGTCCTTTGATGGG - Intergenic
1001870175 5:175147286-175147308 CAACCCAGGTGTCCTTCAATAGG + Intergenic
1001946829 5:175786170-175786192 CAGCCAAGATGTCCTTCAGTAGG - Intergenic
1002000142 5:176192716-176192738 CAGCTCAGGTATCCCTCCACAGG + Intergenic
1002014637 5:176310399-176310421 CAACCCAGATGTCCTACAACAGG + Intronic
1002063470 5:176640336-176640358 CAGCCCAGCTCTCCTTCAAAGGG - Intronic
1002129277 5:177069969-177069991 CAACCCAGTTGTCCCTCAACAGG - Intronic
1002142032 5:177147961-177147983 TGCCCCAGATGTCCTTCAACAGG - Intronic
1002327266 5:178417992-178418014 CAGCCCAGGGCTCCTTCCTCAGG - Intronic
1002444596 5:179281588-179281610 CAACCCACATGTCCATCAACCGG - Intronic
1002573413 5:180157257-180157279 CAACCAAGATGTCCTTCTGCAGG + Intronic
1002608434 5:180397693-180397715 CAGCCCACGTGTCTGTCCACAGG - Intergenic
1002761055 6:202725-202747 GGACCCAGATGTCCTTCAACTGG + Intergenic
1003129937 6:3386769-3386791 CTTTCCAGATGTCCTTCCAGTGG - Intronic
1003907035 6:10711093-10711115 CATTCCTGACGTCCTTCCACAGG - Intergenic
1003957151 6:11174529-11174551 CAGCCAAGAAGCCCTTCCCCGGG + Intergenic
1004444999 6:15689843-15689865 CAACCCATATGTCCATCAACTGG - Intergenic
1004490864 6:16114037-16114059 CAACCCAGATGCCCATCTACAGG - Intergenic
1005001694 6:21248192-21248214 CAGCCCAAATGTCCATCAGCAGG - Intergenic
1005590062 6:27313716-27313738 CAACCAAGAAGTCCTTCAACAGG + Intergenic
1005792201 6:29315117-29315139 CAACCCAGATGTCCATCAACGGG - Intergenic
1006216495 6:32448348-32448370 CAGCCAAAATGTCCTTCAATAGG - Intergenic
1006222283 6:32501471-32501493 CAGCCAAAATGTCCCTCAACAGG - Intergenic
1006546952 6:34788244-34788266 CAGCCCAGATGTCCTTCAGCAGG + Intergenic
1006753948 6:36398468-36398490 CAACCCAAATGTCCAACCACTGG + Intronic
1007048347 6:38800140-38800162 CAACCCAAATGTCCATCAACTGG - Intronic
1007250206 6:40490129-40490151 CTGACGAGATGTGCTTCCACGGG - Intronic
1007361057 6:41356070-41356092 CAACCCACAGGTCCTTCAACTGG + Intergenic
1007883252 6:45191161-45191183 CAACCAAGATGTCCTTCAATAGG + Intronic
1007885385 6:45222788-45222810 CAACTCAGATGTCCTTCAATGGG + Intronic
1008067726 6:47068314-47068336 TAACCCAGATGTTCTTCAACAGG + Intergenic
1008471122 6:51886389-51886411 CAGCCAAGATGTCCATCAATAGG + Intronic
1008518681 6:52342754-52342776 CAACCCAAATGTCCTTCAACTGG - Intergenic
1008948010 6:57120317-57120339 CAACCAAGATGTCCTTCAATCGG - Intronic
1009352558 6:62700379-62700401 CAGCCCAAATGTTCTTCAACAGG + Intergenic
1009786965 6:68352884-68352906 CAACCAAGATGTCCTTCAATAGG - Intergenic
1010018002 6:71126736-71126758 CAGTCCAGATGTCCTTCAATAGG - Intergenic
1010018407 6:71131205-71131227 CAGTCCAGATGTCCTTCAATAGG - Intergenic
1010021422 6:71164129-71164151 CAGCTCAGATACCCTTCAACAGG - Intergenic
1011133898 6:84079150-84079172 CAACCCAAATGTCCTTCAGCAGG + Intronic
1011254878 6:85409844-85409866 CAACTCAGATGTCCTTCAATGGG - Intergenic
1011278046 6:85648841-85648863 CAACCAAGATGTCCTTCAATAGG + Intergenic
1011305704 6:85923980-85924002 CAACCCTGATGTCCATCAACAGG - Intergenic
1011714098 6:90086230-90086252 CAACCCAGGTGTCCATCTACAGG - Intronic
1011747853 6:90424027-90424049 CAACCCAAATGTCCATCGACAGG - Intergenic
1011752506 6:90467422-90467444 CAACCCAAATGTCCATCTACTGG - Intergenic
1011796265 6:90956353-90956375 CAACACAGATGTCTTTTCACCGG + Intergenic
1012328283 6:97951594-97951616 CAACCAACATGTCCTTCCATGGG - Intergenic
1012394366 6:98779072-98779094 CAGCTCAAATGTCCTTTCTCTGG - Intergenic
1012703224 6:102489700-102489722 CAACCCAGATATCCTTGAACAGG + Intergenic
1012766471 6:103372871-103372893 TAACCCAGATGCCCTTCAACAGG - Intergenic
1012810066 6:103945608-103945630 CAACCTAAATGTCCTTCAACAGG - Intergenic
1013222873 6:108095155-108095177 CAACCAAGATGTCCTTCAATAGG + Intronic
1013390100 6:109678155-109678177 CAACCCAGATGTTCTTCAAAAGG + Intronic
1013468611 6:110440358-110440380 CAGCCCAGAGCTCCTCCCAGGGG - Intronic
1013544508 6:111142961-111142983 CAACCAAGATGTCCTTCAATAGG + Intronic
1013564439 6:111343169-111343191 CAACCCAAATGTCCATCAACAGG + Intronic
1013638435 6:112050339-112050361 CAGTCCAGGACTCCTTCCACTGG - Intergenic
1014172040 6:118289245-118289267 ATGCCCAGATGTCCTTCACCAGG - Intronic
1014350271 6:120333919-120333941 CAACCAAGATGTCCTTCAATAGG + Intergenic
1014588847 6:123235932-123235954 TAACCCAAATGTCCTTCAACAGG - Intronic
1014596305 6:123344675-123344697 CAACCAAGATGTCCTTCAATAGG - Intronic
1014623703 6:123700516-123700538 CAGCCTTGATGTCCTTCAATGGG + Intergenic
1014659117 6:124145360-124145382 CAGCCAAGATGTTCTTTAACAGG + Intronic
1015105490 6:129531669-129531691 CATCCAAGATGTCCTTCAATAGG + Intergenic
1015512827 6:134056100-134056122 CAGCCCAGATGTCCATCAATAGG - Intergenic
1015558950 6:134494324-134494346 AAGCCCAGATGTCCATTAACAGG + Intergenic
1015828079 6:137336921-137336943 CAACCAAGATGTCCTTCAAGAGG - Intergenic
1016122558 6:140362306-140362328 CAGCCCAAATATCCCTCAACTGG - Intergenic
1016774284 6:147887574-147887596 CAACCCAAATGTCCATCAACAGG - Intergenic
1016942969 6:149499353-149499375 CAACCCAGATGTCCTTCAATGGG + Intergenic
1017548701 6:155480935-155480957 CAGCCCACATGTGCTGCCATTGG + Intergenic
1018036230 6:159884365-159884387 CAGCCCAGATATCCATCAGCTGG - Intergenic
1018097648 6:160405669-160405691 CAACCAAGATGCCCTTCCATAGG + Intronic
1018627181 6:165791423-165791445 CAACCCAAATGTCCATCAACAGG - Intronic
1019047163 6:169158019-169158041 CCGCCCTGAACTCCTTCCACAGG + Intergenic
1019208663 6:170385723-170385745 CAGCCAAGATGTCCTTCAGTGGG + Intronic
1019265216 7:111493-111515 CAGCCCAAATGCCCATCAACAGG - Intergenic
1019547277 7:1584586-1584608 CACCTCAGAGGTCCTTCCAGGGG - Intergenic
1019594707 7:1853107-1853129 CAGCCCAGATGCACTTCCTCGGG - Intronic
1019650592 7:2155700-2155722 CAGCCCAGGTGTCCACCGACGGG - Intronic
1019726715 7:2606800-2606822 CAGCCCAGCTGCCATTCCCCGGG - Intronic
1019779879 7:2933030-2933052 CAGCTCAGATGTGCTGCCTCAGG + Intronic
1019884345 7:3891132-3891154 AAGCCCAGTGGTACTTCCACTGG + Intronic
1020786084 7:12574139-12574161 CAGCCCAGATGCTTTTCAACAGG + Intronic
1021184930 7:17553293-17553315 AAGCCCAAATGTCCTTCAGCTGG + Intergenic
1021236386 7:18147991-18148013 CAGTCTAGATGTCCATCAACAGG - Intronic
1021456373 7:20833340-20833362 CAACCCAGATGCCCTTCCATGGG + Intergenic
1021559496 7:21955755-21955777 CAGCCCAGATGCTCATCCACAGG - Intergenic
1021591053 7:22262674-22262696 CAACCCAGATGTCCTTCAATTGG + Intronic
1021738409 7:23661274-23661296 TAGCCCAAATGTCCATCAACTGG - Intergenic
1021818151 7:24468328-24468350 TAACCCAGTTGTCCTTCGACAGG - Intergenic
1023033977 7:36114821-36114843 CAACCAAGATGTCCTTCAATAGG - Intergenic
1023172939 7:37407113-37407135 CAACTAAGATGTCCTTCAACAGG + Intronic
1023234461 7:38069230-38069252 CAGCCCAGGTGTCCCTCAGCAGG + Intergenic
1023276620 7:38525845-38525867 CACCCCAGATGTCCTTCAGGGGG - Intronic
1024012456 7:45281052-45281074 CAGCCGAGGTGTCCTTCAACAGG + Intergenic
1024032773 7:45478483-45478505 CAACCAAGATGTCCTTCAATAGG + Intergenic
1026080310 7:67212396-67212418 CAACCAAGATGTCCTTCAATAGG - Intronic
1026696780 7:72601606-72601628 CAACCAAGATGTCCTTCAATAGG + Intronic
1027335983 7:77151208-77151230 CCACCCACATGGCCTTCCACAGG + Intronic
1027533401 7:79365468-79365490 CAGCTCATATGTCCTTCAACAGG + Intronic
1027942153 7:84696445-84696467 CAGCCAAGATGTCCTACAAAAGG + Intergenic
1028048806 7:86157848-86157870 CAGTCCAGATGTCTATCAACAGG - Intergenic
1028064365 7:86363610-86363632 CAACCAAGATGTCCTTCAATAGG + Intergenic
1028329377 7:89570073-89570095 CAACCCAGAAATCCTGCCACTGG + Intergenic
1028437999 7:90827349-90827371 CAACCAAGATGTCCTTCCACAGG - Intronic
1028669293 7:93382792-93382814 CAACCCAGCTGTCCATCAACAGG + Intergenic
1029136921 7:98379666-98379688 CAACCCACATGTCCATCAACTGG + Intronic
1029385959 7:100243712-100243734 CAGCCCAGATGCCCATCAGCAGG + Intronic
1029779805 7:102719888-102719910 CCACCCACATGGCCTTCCACAGG - Intergenic
1029910895 7:104146402-104146424 GAACCCAGATGTCCTTCAACAGG + Intronic
1030116770 7:106067765-106067787 CAACCCAGATGCCCATCAACAGG + Intergenic
1030346554 7:108440108-108440130 CAGTCCATATGTCTATCCACTGG + Intronic
1030472763 7:109987812-109987834 AAGCCCAGATATCCTTCAATAGG + Intergenic
1030553745 7:110997293-110997315 CAACCCAAATATCCTTCAACAGG - Intronic
1030652354 7:112129144-112129166 CAACCCAAATGTCCTTCAATGGG + Intronic
1030905877 7:115182171-115182193 CAACCCAGATGTCCTTCAATGGG + Intergenic
1031225290 7:119029396-119029418 CAACCAAGATGTCCTTCAATAGG + Intergenic
1031664640 7:124468939-124468961 CATCCCAAATGTCCTTCTATAGG - Intergenic
1031910444 7:127511516-127511538 CAGTCCAGATGTCATTTAACAGG + Intergenic
1032010149 7:128340937-128340959 CAGCCCCCATGTTCTTCCATAGG + Intronic
1032027019 7:128451183-128451205 CAACCCAAATGTCCGTCAACTGG - Intergenic
1032198550 7:129803807-129803829 CAGCCCAGGGTTCTTTCCACCGG - Intergenic
1032272740 7:130425744-130425766 CAACCCCGATGTCCTTCAACAGG + Intronic
1032496604 7:132367668-132367690 CAGCCGATGTGTCCTTCCTCTGG - Intronic
1032586116 7:133148294-133148316 CAGCCAAGATGTCCTTCAAGAGG - Intergenic
1032680902 7:134182250-134182272 CAGTCCAGATGTCTTTCAACAGG - Intronic
1032738495 7:134714367-134714389 CAGCCGACTTGTCCTTCCTCTGG + Intergenic
1032772707 7:135075481-135075503 CAACCCACATGTTCTTCAACAGG - Intronic
1032937743 7:136753137-136753159 CAGCCCAAATGGCCTTCTATGGG - Intergenic
1032973358 7:137191900-137191922 CAATTCAGATGTCCTTCAACAGG - Intergenic
1033323031 7:140357372-140357394 CAACCCAAATGTTCATCCACAGG + Intronic
1033642209 7:143272421-143272443 CAACCCAAGTGTCCTTCAACAGG - Intergenic
1034727285 7:153348938-153348960 TAGCCAAGATGTCCTTCAATAGG - Intergenic
1035069534 7:156131859-156131881 CAACCCAGATGCCCTTCATCAGG - Intergenic
1035650380 8:1259647-1259669 CAGCCCAGCTCTGCTTCCACAGG + Intergenic
1035728782 8:1840809-1840831 CAGCCCAGCAGTGATTCCACAGG - Intronic
1035737071 8:1896894-1896916 CAGCACTGATGGCCTTCCTCAGG + Intronic
1035832762 8:2715260-2715282 CAGCCCAGATCTGCTTCCATGGG - Intergenic
1035857820 8:2995641-2995663 CAACCCAGACGTCCTTCAATGGG + Intronic
1036170985 8:6484614-6484636 CAGCACAGCTGTCCCTCCAGTGG + Intronic
1036931491 8:12960551-12960573 CAACCAAGATGTCCTTCAATAGG + Intronic
1037092266 8:14935398-14935420 TGACCCAGATGTCCTTCAACAGG - Intronic
1037406372 8:18546994-18547016 CAGCCCAGATGACCCACCAAAGG - Intronic
1037611549 8:20480420-20480442 AAGCCCAGAGGTCCTTTCATAGG - Intergenic
1038457198 8:27683740-27683762 CAGCCCATATATCCATCAACAGG + Intergenic
1038508084 8:28103456-28103478 CAACCAAGATGTCCTTCAATAGG - Intronic
1038685834 8:29717670-29717692 CGGCCCAGATATCCTTCAACAGG + Intergenic
1039080594 8:33730422-33730444 CAACCAAAATGTCCTTCAACAGG - Intergenic
1039471812 8:37818154-37818176 GAAACCAGATGTCCTTCCAGGGG + Intronic
1039526515 8:38221079-38221101 CAACCCAGATGTCCTTCAATAGG - Intergenic
1039607117 8:38890384-38890406 CAACCCAGATGTCTTTCTGCTGG - Intergenic
1039856410 8:41418596-41418618 CAGCTCAGATGTCTTTCAATGGG + Intergenic
1039870197 8:41539566-41539588 CAGGCCACATGTCCTTCCTCGGG + Intronic
1040565164 8:48558463-48558485 CTGCCTATATGTCCTTCCACCGG - Intergenic
1041012134 8:53555449-53555471 CATCTCAGATGTCCATCAACAGG + Intergenic
1041168975 8:55121113-55121135 CAACCAAGATGTCCTTCAATAGG - Intronic
1041186751 8:55308749-55308771 CAGCCCAGACATCCTTCAACAGG + Intronic
1041188106 8:55323590-55323612 CAACCCAAATGTCCTTTAACTGG - Intronic
1041498674 8:58515716-58515738 CAACTAAGATGTCCTTCAACAGG - Intergenic
1041709383 8:60879438-60879460 TAACCCAAATGTCCATCCACAGG - Intergenic
1041886231 8:62811266-62811288 CAACATAGATGTCCTTTCACAGG - Intronic
1041892189 8:62881634-62881656 CAACCAAGATGTCCTTCATCAGG - Intronic
1042165868 8:65945576-65945598 CAGCCAAGATGTCCTTCAATAGG + Intergenic
1042195348 8:66227376-66227398 CAGCCCTGATGTCCTTCAACAGG + Intergenic
1042673880 8:71295810-71295832 CAACCAAGATGTCCTTCAATTGG + Intronic
1042885300 8:73543024-73543046 CAACCCAAATGTCCATCAACAGG + Intronic
1043088462 8:75867501-75867523 GAACCCAGATGTCCATCAACAGG - Intergenic
1043500322 8:80848013-80848035 CAACCCACATGTCCTTCAATGGG + Intronic
1043698231 8:83249557-83249579 CAACCAAGATGTCCTTCAATAGG + Intergenic
1044654324 8:94531783-94531805 CTACCCAAATGTCCTTCAACAGG + Intronic
1044844618 8:96367883-96367905 CAACCCAGATGTCCTTCAACAGG - Intergenic
1045228499 8:100276192-100276214 GAGCCCAGATGACCTTCAAAAGG + Intronic
1045246004 8:100442206-100442228 CAGCTCAGATGTCATTCCTCAGG - Intergenic
1045251891 8:100489440-100489462 CAACCAAGATGTCCTTCAATAGG + Intergenic
1045661431 8:104441812-104441834 CAACCCAGATGTCCATCAATAGG + Intronic
1045704495 8:104905301-104905323 CAACCCAGATGTCCTTTAATGGG - Intronic
1046085033 8:109422615-109422637 CAACTCAAATGTCCTTCAACGGG - Intronic
1046317062 8:112518008-112518030 CAACCCAAATGTCATTCAACAGG + Intronic
1046478650 8:114783952-114783974 CAACCGAGATCTCCTTCTACTGG + Intergenic
1046774447 8:118148929-118148951 CAACCCAAATGTCCATCAACTGG - Intergenic
1047542353 8:125781955-125781977 CATCCCAGATGTTCATCGACTGG - Intergenic
1048300880 8:133250271-133250293 CAGGCCAGGTGTCCTTCCTGGGG + Intronic
1048371482 8:133781807-133781829 CTGTCCAAATGTCCTTCTACTGG + Intergenic
1048475721 8:134740706-134740728 GAGGCCAGAGGTCCTTCCAAAGG - Intergenic
1048727736 8:137406132-137406154 AATCCCAGATGTCCTTACAAAGG - Intergenic
1048995244 8:139789965-139789987 CACACCAAATGTCCTTCCCCTGG - Intronic
1050051575 9:1607651-1607673 CAGCTCCGATATCCTTACACTGG + Intergenic
1050275139 9:3989482-3989504 CAGCCCAGATGTCTCTCACCAGG + Intronic
1050718385 9:8556039-8556061 CAGCCCAGATGTTTTCCCAAAGG - Intronic
1050843854 9:10189369-10189391 TAGCCCAGAATTCCTTACACGGG + Intronic
1051618219 9:19027188-19027210 CAGCACACTTGTCCTTCCTCTGG - Intronic
1052726778 9:32238054-32238076 CAACCCAGATGTCCTTCAATGGG + Intergenic
1052851796 9:33382978-33383000 CAACCCAAATGTCCATCCACAGG - Intergenic
1052882425 9:33611312-33611334 CAACCCAAATGTCCATCCACTGG - Intergenic
1053280158 9:36815332-36815354 TAGCTCAGATTTGCTTCCACTGG - Intergenic
1053417690 9:37956906-37956928 CAGCACAGACTACCTTCCACAGG - Intronic
1053493916 9:38534471-38534493 CAACCCAAATGTCCATCTACTGG - Intergenic
1053679903 9:40479516-40479538 CAACCCAAATGTCCATCCACAGG - Intergenic
1053791098 9:41686902-41686924 CACCCCAGTTGTCCTTGCTCTGG - Intergenic
1053929899 9:43107826-43107848 CAACCCAAATGTCCATCCACAGG - Intergenic
1054154055 9:61627870-61627892 CACCCCAGTTGTCCTTGCTCTGG + Intergenic
1054179445 9:61898596-61898618 CACCCCAGTTGTCCTTGCTCTGG - Intergenic
1054283811 9:63145419-63145441 CAACCCAAATGTCCATCCACAGG + Intergenic
1054292986 9:63315026-63315048 CAACCCAAATGTCCATCCACAGG - Intergenic
1054391008 9:64619519-64619541 CAACCCAAATGTCCATCCACAGG - Intergenic
1054473839 9:65558990-65559012 CACCCCAGTTGTCCTTGCTCTGG + Intergenic
1054504718 9:65896807-65896829 CAACCCAAATGTCCATCCACAGG + Intergenic
1054658093 9:67682225-67682247 CACCCCAGTTGTCCTTGCTCTGG + Intergenic
1054714027 9:68539685-68539707 TAGCCCAAATGTCCATCAACAGG - Intronic
1054822972 9:69542521-69542543 CAACCAAGATGTCCTTCGATAGG - Intronic
1054965595 9:71023576-71023598 CAACCCAGATGTCCTTCAACAGG + Intronic
1055096361 9:72418444-72418466 CACCCCAGTTGTCTTTCCACAGG - Intergenic
1055620150 9:78116661-78116683 CAGCCCAGATGTCCATCAGAAGG + Intergenic
1055958678 9:81798674-81798696 TAGCACTGATGTTCTTCCACTGG - Intergenic
1056066783 9:82943896-82943918 CGGCCCAGATGTCCTTCAGCTGG - Intergenic
1056267175 9:84909320-84909342 CAACCCAGATGTCCTTCAATAGG - Intronic
1056736405 9:89213708-89213730 CAACCCAGGTGTCCTTCAACAGG + Intergenic
1056972925 9:91223468-91223490 CAACCCAGGTATCCTTCCAGGGG - Intronic
1057091333 9:92260878-92260900 CAACCCAGATGTCCTTCAAGAGG + Intronic
1057107710 9:92435807-92435829 CAGCCCAGATGTTTTTTCAGTGG - Intronic
1057115829 9:92520699-92520721 CAGCCCAGATGTTCATCAACTGG + Intronic
1057160024 9:92882866-92882888 CATCGCAGAAGTCCCTCCACTGG - Intergenic
1057209910 9:93194799-93194821 CAACCCAGATGTCCTTCAGCAGG + Intronic
1057674653 9:97129297-97129319 CAACCCAAATGTCCATCTACTGG - Intergenic
1057728493 9:97587153-97587175 CAACCCAGACGCCCTTCAACAGG - Intronic
1057876675 9:98760797-98760819 CATCCCAAATGTTCTTCAACAGG - Intronic
1058230845 9:102422123-102422145 CAACCCAGATGTCCTTCAGCAGG + Intergenic
1058738713 9:107921256-107921278 CAGACCAGATCTCCTTCCCTTGG + Intergenic
1058822000 9:108741027-108741049 CAACCCAAATGTCCATCCACAGG + Intergenic
1058836566 9:108862945-108862967 CAGGCCGGAGGTCCTTCCATAGG - Exonic
1059016787 9:110526772-110526794 CAATCCAGATGTCCTTCAACAGG + Intronic
1059297968 9:113289250-113289272 CAGCCCAAGTGTCCATCAACAGG - Intronic
1059526607 9:114996971-114996993 CAAACCAGAAGTCCTTCAACAGG - Intergenic
1060083464 9:120675190-120675212 TAACCCAAATGTCCTTCGACTGG + Intronic
1060387444 9:123244895-123244917 CAATCCAAATGTCCTTCAACAGG + Intronic
1060476268 9:123989159-123989181 CAGCCCAAATATCCATCCCCAGG + Intergenic
1060539482 9:124419931-124419953 CAGCCCAGCTGGCCCTCCCCTGG + Intergenic
1060767072 9:126302857-126302879 CAGCCCAAATGTCTATCAACAGG + Intergenic
1060773489 9:126349754-126349776 CAACCAAGATGTCCTTCAATGGG - Intronic
1061011642 9:127959241-127959263 CAACCCAAATGTCCATCAACTGG + Intronic
1061139558 9:128756493-128756515 CAACCCAAATGTCCTTCAACTGG + Intronic
1061301417 9:129707445-129707467 CAACCCACATGTCCTTCAACTGG - Intronic
1061596283 9:131631508-131631530 CAGGCCAGATGTCCAGCAACAGG - Intronic
1062001043 9:134215813-134215835 CAACCCAGATGTCCCTCAGCTGG + Intergenic
1062327961 9:136021696-136021718 CAGCCCGGATGTCCTGCAATGGG + Intronic
1062442886 9:136579013-136579035 CCGCCCACATGTCCCTCCCCAGG - Intergenic
1062707519 9:137953636-137953658 CAGCTGAGATGTCCCTCCCCCGG - Intronic
1186221117 X:7350187-7350209 CAGCTGTGCTGTCCTTCCACCGG + Exonic
1186417514 X:9396570-9396592 CAGCCCTGATGTCCTTCCATGGG - Intergenic
1186424523 X:9453505-9453527 CAATCCAGGTGTCCTTCAACTGG - Intergenic
1186880362 X:13859471-13859493 CAGCCCAAATGTCCTTCAACTGG - Intronic
1186936345 X:14453783-14453805 CAACACAGATGTCCTTCAATGGG + Intergenic
1187207218 X:17194320-17194342 CAGCTCAGATGTCCTTCTACAGG + Intergenic
1187282667 X:17870956-17870978 CAGCCCAGATGTGCTCCAACAGG - Intergenic
1187284592 X:17892697-17892719 CAACCCAGATGTCCTACCACAGG + Intergenic
1187465326 X:19521595-19521617 CAACCAAGATGTCCTTCAAATGG - Intergenic
1187513910 X:19948294-19948316 CAACCCAAATGTCCATCAACTGG + Intronic
1187946909 X:24434929-24434951 CAACCCAAATGTCCATCAACTGG + Intergenic
1188121405 X:26312679-26312701 CAGCCCAGATATTCTTCAGCAGG + Intergenic
1188553941 X:31390830-31390852 CAGCTCAGGTGTACTTTCACAGG + Intronic
1188698353 X:33226311-33226333 CAACCCAGATGTCCTTCAACAGG + Intronic
1189493720 X:41490740-41490762 CAGCTCAGATATCCTTCAATGGG + Intergenic
1189565914 X:42240926-42240948 CAACCCAGATGTCCTTTGACTGG + Intergenic
1189761960 X:44331125-44331147 TAGCCCCAATGTCCTTCCAAAGG + Intronic
1189929874 X:45997749-45997771 CAGCCCATATGTCTTTCAACAGG - Intergenic
1189977014 X:46471862-46471884 CAACCAAGATGTCCTTCAATAGG - Intronic
1189981945 X:46519832-46519854 CAACCTAGATGTCCTTCAACAGG + Intronic
1190276327 X:48901882-48901904 CAGCACAGATGTCCTTGCCTTGG - Intronic
1190424177 X:50316374-50316396 CAACCCAAATGTCCTTCAATAGG - Intronic
1190436083 X:50427093-50427115 CAACCAAGATGTCCTTCAATAGG + Intronic
1190534823 X:51415900-51415922 GAACCCAAATGTCCTTCAACAGG - Intergenic
1190967690 X:55317117-55317139 CAGCCCAGATGTGCTTCAATGGG - Intergenic
1190989506 X:55531605-55531627 CAACCCAAATGTCCATCAACAGG - Intergenic
1191684642 X:63877821-63877843 CAGCCAAGAGGTCCTTCAATAGG + Intergenic
1191726855 X:64290855-64290877 CAACCCAGATGTCCTTCAACAGG - Intronic
1192270777 X:69577346-69577368 CAACCCAGATGTACTTCAATGGG - Intergenic
1192283942 X:69713765-69713787 AAGCCTTGATGTCCTTCAACAGG - Intronic
1192569303 X:72189824-72189846 CAACCCAGCTGTCCTTCAACAGG - Intronic
1192806821 X:74518019-74518041 CAACCCAAATGTACTTCAACTGG - Intronic
1192916203 X:75653773-75653795 CAACTCAAATGTCCTTCCATAGG + Intergenic
1193113561 X:77754694-77754716 CTGCCCAGATATCCTTCCTCTGG + Intronic
1193373587 X:80730314-80730336 CAACCCAAATGTCCATCAACGGG + Intronic
1193376969 X:80772833-80772855 CATCCCAGATGTCCTTCAATTGG + Intronic
1193493142 X:82174842-82174864 CAGCCCAGATATTCTTCAATAGG - Intergenic
1193854218 X:86578664-86578686 CTGCCAAGATGTCCTTCAATAGG - Intronic
1194407130 X:93510475-93510497 CAGCTCAGGTGTCCTTCAAATGG + Intergenic
1195071096 X:101280709-101280731 CAACCCAGATGTCCTTCAAAGGG + Intronic
1195398793 X:104439717-104439739 CAGCTCAGGTGTGCTTCCATTGG + Intergenic
1195637896 X:107138894-107138916 CAGCCCAGATGTCCTGCAACAGG + Intronic
1195745693 X:108115639-108115661 CAACCCAAATGTCCATCAACAGG - Intronic
1195819192 X:108924647-108924669 CAACCTAGATGTCCTTCAATGGG - Intergenic
1196000354 X:110777244-110777266 CAGCCAAGATGTCCTTCAGTAGG - Intronic
1196078308 X:111602032-111602054 CTACCCAGATGTCCATCAACAGG - Intergenic
1196178783 X:112668200-112668222 CAGCCTTGGTTTCCTTCCACTGG + Intronic
1196806818 X:119595534-119595556 CAGCCCAGATGTCCTTCAACAGG + Intronic
1197230301 X:123996796-123996818 TAACCCAAATGTCCTTCAACTGG - Intronic
1197523874 X:127537033-127537055 CAGCCCTAATGTCATTCAACAGG + Intergenic
1197580478 X:128276990-128277012 CAGCCTAGATGTCTTTCAAGAGG + Intergenic
1197842027 X:130758514-130758536 CAACCCAGATGTCCTTCAATGGG - Intronic
1197878054 X:131132635-131132657 CAACCCAGGTGTTCTTCAACAGG - Intergenic
1197925354 X:131641439-131641461 CAACCCAAATGTCCTTCAATAGG + Intergenic
1198205021 X:134457847-134457869 CTGCCCAAATGTCCATCAACAGG + Intergenic
1198324878 X:135559541-135559563 CAACACAGATGTCCTTCAACAGG - Intronic
1198367555 X:135957191-135957213 CAACCAAGATGTCCTTCAATAGG + Intergenic
1198407633 X:136330520-136330542 CAGCCCAAATGTCTTTCAACAGG - Intronic
1198817324 X:140605995-140606017 CAACCCAGATGTCCTTCAACAGG - Intergenic
1199073540 X:143505418-143505440 CAGCCCAGATGTCCTTCACCTGG + Intergenic
1199416771 X:147593551-147593573 CAATCAAGATGTCCTTCAACAGG + Intergenic
1199748256 X:150789938-150789960 CAACCAAGATGTCCTTCAGCAGG + Intronic
1199791112 X:151155988-151156010 CAGCCCAGATGCTCTTACAATGG + Intergenic
1199945422 X:152662135-152662157 CAGCCCAAATGACCTTCAATGGG + Intergenic
1199946590 X:152674259-152674281 CAACCCAAATATCCTTCCATGGG + Intergenic
1200050378 X:153426407-153426429 CAACCCAAATGTCCATCAACAGG - Intergenic
1200314936 X:155122595-155122617 CAACCCAGATGTCCTACAACAGG + Exonic
1200760116 Y:7029954-7029976 GCACCCAAATGTCCTTCCACAGG - Intronic
1201239117 Y:11941250-11941272 CAACCCAGGTGTCCATCAACAGG + Intergenic
1202275435 Y:23114003-23114025 CAGCCCAGATGTCCATCAAGAGG + Intergenic
1202290593 Y:23306688-23306710 CAGCCCAGATGTCCATCAAGAGG - Intergenic
1202428427 Y:24747722-24747744 CAGCCCAGATGTCCATCAAGAGG + Intergenic
1202442364 Y:24922367-24922389 CAGCCCAGATGTCCATCAAGAGG - Intergenic