ID: 968497798

View in Genome Browser
Species Human (GRCh38)
Location 4:927845-927867
Sequence ACCCAGAGCCTGAAGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968497798_968497804 17 Left 968497798 4:927845-927867 CCACCGCACTTCAGGCTCTGGGT 0: 1
1: 0
2: 2
3: 19
4: 279
Right 968497804 4:927885-927907 AAGCAAGGATGACAGAACCCTGG 0: 1
1: 0
2: 1
3: 20
4: 248
968497798_968497803 2 Left 968497798 4:927845-927867 CCACCGCACTTCAGGCTCTGGGT 0: 1
1: 0
2: 2
3: 19
4: 279
Right 968497803 4:927870-927892 AGGAGAGGTACAAAGAAGCAAGG 0: 1
1: 0
2: 3
3: 35
4: 520
968497798_968497805 20 Left 968497798 4:927845-927867 CCACCGCACTTCAGGCTCTGGGT 0: 1
1: 0
2: 2
3: 19
4: 279
Right 968497805 4:927888-927910 CAAGGATGACAGAACCCTGGTGG 0: 1
1: 0
2: 0
3: 16
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968497798 Original CRISPR ACCCAGAGCCTGAAGTGCGG TGG (reversed) Intronic
901109962 1:6785944-6785966 ACCCAGCGCCGGGGGTGCGGGGG - Intronic
901506837 1:9690210-9690232 ACCCAGATCCTGAGGTCCTGCGG + Intronic
903118389 1:21196939-21196961 TCCCCCAGGCTGAAGTGCGGTGG + Intergenic
903816757 1:26069542-26069564 GCCCAGAGGCTGGAGTGCAGTGG + Intergenic
904000742 1:27337019-27337041 CCCCAGACCCTGCAGTGCTGTGG + Intergenic
904004504 1:27356801-27356823 CCCCAGACCCCAAAGTGCGGGGG + Intronic
904066599 1:27757017-27757039 ACCCACAGGCTGGAGTGCAGTGG - Intronic
905154005 1:35958023-35958045 ACCCAGAGGATGGAGTGCAGTGG - Intronic
905826481 1:41029250-41029272 ACCCAGGGGCTGGAGTGCAGTGG + Intronic
906316249 1:44787994-44788016 AACCAGATCCTGAACTGCTGCGG + Intergenic
907421595 1:54351406-54351428 AGGCAGAGCCTGAAGAGCCGGGG + Intronic
908898825 1:68932056-68932078 ACCAAGAGCCTGGAGTGGGAAGG - Intergenic
909388986 1:75095944-75095966 ACCCAGAGTCTGAAGTTCAAGGG - Intergenic
909991982 1:82234955-82234977 GCCCAGGGGCTGAAGTGCAGTGG + Intergenic
910469209 1:87533652-87533674 ACCCCCAGGCTGGAGTGCGGTGG + Intergenic
910691594 1:89970970-89970992 ACCCACAGACTGAAGTTCTGGGG - Intergenic
911963458 1:104336692-104336714 GCCCAGAGACTGGAGTGCAGTGG + Intergenic
912058528 1:105634930-105634952 TCACACAGCCTGGAGTGCGGTGG - Intergenic
912106188 1:106278684-106278706 ACCTAGAGTCTGAAGTCCGAGGG + Intergenic
912847038 1:113083692-113083714 ACCCAAAGCCTGATGGGCAGAGG - Intronic
912873220 1:113328705-113328727 ACCCACAGGCTAAAGTGCTGTGG - Intergenic
912908120 1:113728868-113728890 ACCCAGGGACTGGAGTGCAGTGG - Intronic
912927815 1:113929372-113929394 CCGCAGAGTCTGCAGTGCGGAGG + Intronic
912978210 1:114348559-114348581 GCTCAGAGCCTGAAGGGCTGGGG + Intergenic
913172734 1:116247335-116247357 ACCCAGAAGCTCAAGTGAGGGGG + Intergenic
913993371 1:143635310-143635332 ACCCTCAACCTGAAGTGCTGTGG - Intergenic
915196341 1:154192745-154192767 TCCCAGAGCTTCAAGTGGGGTGG + Intronic
916853724 1:168728726-168728748 ACCCAGAGCATGCAGTGGTGAGG + Intronic
919035294 1:192299851-192299873 ACACCTAGGCTGAAGTGCGGTGG + Intergenic
924461005 1:244258501-244258523 ACACAGAGGCTGGAGTGCAGTGG - Intergenic
1064106694 10:12506556-12506578 GCCCAGACTCTGAAGTGCAGTGG + Intronic
1065795774 10:29306892-29306914 TCACCCAGCCTGAAGTGCGGTGG + Intronic
1067256273 10:44645612-44645634 ACCCAGGGCCTGTCGTGGGGTGG + Intergenic
1068032542 10:51721172-51721194 ACCCAGAGGCTGGAGTGCAGTGG - Intronic
1068989976 10:63140096-63140118 ACCCAGAGGCTGGAATGCAGTGG - Intronic
1069572800 10:69504609-69504631 ACCCAGAGCCAGGACTGCTGTGG + Intronic
1069788604 10:71005339-71005361 AGCCAGGGCCTGAAGAGCTGAGG - Intergenic
1070660105 10:78299444-78299466 ACCCAGAGGCTGGAGTGCAATGG - Intergenic
1071548095 10:86544008-86544030 TCCCCGAGCCTGGAGTGCAGTGG + Intergenic
1075028220 10:119002664-119002686 ACCCAGTGCCTGAGGTGAGCTGG + Intergenic
1076178868 10:128390140-128390162 ACCCACAGGCAGAAGTGCCGCGG - Intergenic
1076345431 10:129775804-129775826 AACCAAAGCCTGAAGTGGGCTGG + Intergenic
1077097830 11:806620-806642 TCCCAGAGGCTGGAGTGCAGTGG + Intronic
1077519697 11:3025140-3025162 ACCCGGAGCCTGAAATGCCATGG + Intronic
1078281693 11:9908735-9908757 TCCCCCAGGCTGAAGTGCGGTGG + Intronic
1078741714 11:14072892-14072914 ACCCAGAGCCTGCAGGGAGATGG - Intronic
1080346310 11:31329555-31329577 CCCCAGAGCCTGTTGTGGGGTGG - Intronic
1081152378 11:39648184-39648206 CCCCAGAGCCTGAGGTGCTAAGG + Intergenic
1081367707 11:42256580-42256602 GCCCAGGGGCTGAAGTGCAGTGG - Intergenic
1081719674 11:45278959-45278981 ACCCAATGCCTGAAGTGTGATGG + Intronic
1083294885 11:61709968-61709990 ACCCACAGCCTGAGGAGAGGAGG + Intronic
1083781037 11:64917440-64917462 TCCCAGAGCCTGTAGAGGGGAGG - Intergenic
1084362835 11:68680148-68680170 ACCCAGATGCTGGAGTGCAGTGG + Intergenic
1085228757 11:74946687-74946709 ACTCACAGCCTGTAGTGAGGTGG - Intronic
1086972830 11:93102100-93102122 AACAAGAGTTTGAAGTGCGGTGG - Intergenic
1088172380 11:107013585-107013607 ACCCAGGGTCTGGAGTGCAGTGG + Intronic
1088836505 11:113582207-113582229 ACCCAGAGTCTGATGTTCGAGGG - Intergenic
1089439814 11:118505873-118505895 ACACAGACCCTGATGTGAGGTGG - Exonic
1090028366 11:123186557-123186579 ACCCAGAGGCTGGAATGCAGTGG + Intronic
1091209707 11:133845628-133845650 ACCCAGAGCCTGAAATGCAGGGG - Intergenic
1094433127 12:30392345-30392367 ACCCAGAGCCTGAAAAGCACAGG - Intergenic
1095811171 12:46373899-46373921 ACCCGAAGCCTCACGTGCGGCGG - Intergenic
1096155116 12:49337245-49337267 GCCCAGAGTGGGAAGTGCGGGGG + Intergenic
1097811783 12:64026824-64026846 ACCCCCAGGCTGGAGTGCGGTGG - Intronic
1101826141 12:108221514-108221536 ACCCAGAGGATGGAGTGCAGTGG - Intronic
1103920424 12:124396588-124396610 ACACAGAGCCTGACCTGCAGCGG + Intronic
1104376219 12:128267221-128267243 AGCCAGAGCCGGAGCTGCGGCGG + Intergenic
1105378747 13:19866852-19866874 ACCCAGATGCTGGAGTGCAGTGG - Intergenic
1106493464 13:30251096-30251118 GCCCAGAGACTGGAGTGCAGTGG - Intronic
1107128668 13:36871595-36871617 GCACAGAGCCTGAAATGCAGTGG - Intronic
1107846839 13:44523598-44523620 TGCCAGAGCCTGAGGTGGGGAGG + Intronic
1111291343 13:86174688-86174710 ACCCAGAGGCTAAAATGTGGTGG + Intergenic
1111700434 13:91681052-91681074 ACCCAAAGCTTGTATTGCGGTGG - Intronic
1112545867 13:100370121-100370143 GCCCAGAGGCTGGAGTGCAGTGG + Intronic
1112643326 13:101301679-101301701 TCCCCGAGGCTGGAGTGCGGTGG - Intronic
1115593728 14:34889008-34889030 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
1117749977 14:58911190-58911212 CTCCAGAGGCTGAAGTGCAGTGG + Intergenic
1121766816 14:96494872-96494894 ACCCAGGGACTGGAGTGCAGTGG + Intergenic
1122792084 14:104188217-104188239 GCCCAGGACCTGAAGTGCAGTGG - Intergenic
1124063669 15:26319682-26319704 ACCCAGAGCCTGCAGAGCTGAGG + Intergenic
1124671006 15:31639092-31639114 AGACAGAGGCTGGAGTGCGGTGG - Intronic
1125252757 15:37724739-37724761 ACCAAAAGCCTGAAATGAGGAGG - Intergenic
1128675266 15:69603854-69603876 CCCCTGAGCCTGAAGTGCTTGGG + Intergenic
1128695081 15:69755737-69755759 TAACAGAGCCTGAAGTGAGGAGG + Intergenic
1129172101 15:73814381-73814403 AGGCAGAGCCTGAAGTGATGTGG - Intergenic
1132105220 15:99058557-99058579 ACCCCCAGGCTGGAGTGCGGTGG - Intergenic
1132251677 15:100340095-100340117 ACCCAGAGCATGAACCGCAGGGG - Intronic
1133873796 16:9714075-9714097 ACCCAGAGACTGAAGCACGCTGG - Intergenic
1135565055 16:23505645-23505667 ACCCAGAGCCAAAGGTGGGGAGG - Intronic
1135770655 16:25215909-25215931 ACTCTGAGGCTGAAGTGCAGTGG + Intronic
1135790758 16:25392425-25392447 TCGCAGAGGCTGAAGTGCAGTGG - Intergenic
1136714831 16:32269829-32269851 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
1136753086 16:32659918-32659940 GCCCAGAGACTGGAGTGCAGTGG + Intergenic
1136815027 16:33210447-33210469 GCCCAGAGACTGGAGTGCAGTGG - Intronic
1136821503 16:33320527-33320549 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
1136828066 16:33377066-33377088 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
1136833132 16:33475837-33475859 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
1137288706 16:47037473-47037495 CCCGAGGGCCTGGAGTGCGGAGG - Intergenic
1137892187 16:52174399-52174421 ACCCTGAGCCTGCAGTGCTGAGG - Intergenic
1138515404 16:57533238-57533260 ACCCTGGGCCTGAAGTGCAAAGG - Intronic
1139270045 16:65673360-65673382 GCCCAGTGCCTGCAGTGTGGTGG + Intergenic
1139418474 16:66833048-66833070 AGGCAGAGACTGAAGTGCTGTGG - Intronic
1139475887 16:67202383-67202405 TCTCAGAGCCTGGAGTGGGGGGG - Exonic
1140553369 16:75892439-75892461 ACCCAGAGGCTGGAATGCAGTGG + Intergenic
1141417359 16:83886280-83886302 TCCCAGAGCATGAAGTGGGTTGG - Intergenic
1202993604 16_KI270728v1_random:33421-33443 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
1203055221 16_KI270728v1_random:919940-919962 GCCCAGAGACTGGAGTGCAGTGG + Intergenic
1142900221 17:3007104-3007126 AACCAGAGCCTGACGTCAGGAGG + Intronic
1143140213 17:4738374-4738396 AGGCAGAGCCTGAAGAGCAGTGG + Intronic
1144569467 17:16387037-16387059 ACCCAGAGGCTTGAGTGCAGCGG - Intergenic
1145361726 17:22217544-22217566 ACCCAGAGGCTTGAGTGCAGGGG - Intergenic
1147056780 17:37840938-37840960 ACCCCCAGGCTGAAGTGCAGTGG + Intergenic
1148028014 17:44601644-44601666 TCCAAGAGCCTGAAGTCAGGGGG + Intergenic
1151205851 17:72506250-72506272 TCCCAGAGGCTGGAGTGCGATGG - Intergenic
1151325746 17:73379034-73379056 CCACAGAGCCTGAAGGGCCGAGG + Intronic
1151448227 17:74181222-74181244 GCTCAGAGCCTAAAGTGCAGAGG - Intergenic
1152026298 17:77811602-77811624 ACTCAGAGGCTGAAGTGCCCAGG - Intergenic
1153808379 18:8730684-8730706 CCCCGGAGCCTGCAGTGCTGTGG - Intronic
1155863396 18:30932894-30932916 ACCCAGGGGCTGGAGTGCAGTGG - Intergenic
1156053678 18:32971179-32971201 AACCAGGGCCTGTAGTGGGGTGG - Intronic
1159806526 18:72964017-72964039 AACCAGAGCCTGAAGTTGAGAGG - Intergenic
1160771550 19:834118-834140 TCCCCTAGCCTGCAGTGCGGTGG - Intergenic
1160988666 19:1851808-1851830 CCCCAGAGCCTGGAGGCCGGCGG - Intergenic
1161181465 19:2885864-2885886 AACCAGAACCGGAAGTGCTGAGG + Intergenic
1161455612 19:4368334-4368356 CCCAAGAGCAGGAAGTGCGGGGG + Intronic
1161550903 19:4911560-4911582 ACCCTGAGCCTGCTGTGCTGCGG + Intronic
1161570483 19:5028014-5028036 GCCCAGAGGCTGGAGTGCAGGGG + Intronic
1161793774 19:6375255-6375277 ACCCAGAAGCTGCAGTGCTGGGG - Intronic
1162147710 19:8623067-8623089 ACCCAGAGGCTGGAGTGCAGAGG + Intergenic
1162159283 19:8699377-8699399 TCCCCCAGCCTGGAGTGCGGTGG - Intergenic
1162894638 19:13757906-13757928 ACAAAGAGCCTGAGTTGCGGGGG + Intronic
1163171371 19:15533635-15533657 ACCCAGAGGCTGGAGTGCAGTGG + Intronic
1163498210 19:17659401-17659423 ACCCAGCCCCTGGAGTGCAGAGG - Intronic
1163565883 19:18051241-18051263 ACCCAGAGGCTGGAGTGCAGTGG - Intergenic
1164432546 19:28200740-28200762 ACCCAGAGGCTTCAGTGGGGAGG - Intergenic
1165567097 19:36739945-36739967 ACCCAGGCTCTGAAGTGCAGTGG - Intronic
1165989057 19:39795684-39795706 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
1167875592 19:52409754-52409776 ACCCAGGGGCTGGAGTGCAGTGG + Intronic
1168560183 19:57375620-57375642 TCCCCGAGCCTGGAGTGCAGTGG - Intronic
924975149 2:166556-166578 ACCCAGAGCATGTGGTGCTGAGG + Intergenic
926033230 2:9611708-9611730 ACCCAGAGGCTGGAATGCAGTGG + Intronic
927203646 2:20593573-20593595 CACCAGAGGCTGAAGTGCGGGGG - Intronic
927560559 2:24069480-24069502 ACCCAGAGCCTGAACTGAGTGGG - Intronic
927713149 2:25338170-25338192 ACCCAGAGCCTGAGGCCTGGAGG - Intronic
927872136 2:26630376-26630398 TCCCAGAACCTGAACTGCTGTGG + Intronic
928126729 2:28621429-28621451 AGCCAAAGACTGAAGTGAGGTGG - Intronic
928286502 2:29994290-29994312 ACCCAGAGACTGGAGTACAGTGG - Intergenic
929941510 2:46337447-46337469 CCCTAGAGACTGAAGTGGGGCGG + Intronic
930021449 2:47004353-47004375 ACCCAGAGCCTGTGGTCTGGAGG + Intronic
930493415 2:52106697-52106719 AACCAGACCCTGAGGTGCTGAGG - Intergenic
931128552 2:59305033-59305055 TCCCAGAGGCTGGAGTGCAGTGG - Intergenic
931619695 2:64197658-64197680 ACACAGAGCCTGACATGCAGGGG - Intergenic
936458859 2:112696270-112696292 AACCAGAGCCTGAGGGGCAGGGG + Intergenic
938802678 2:134777473-134777495 ACCCCCAGGCTGGAGTGCGGTGG + Intergenic
939009363 2:136827587-136827609 ATCCAGAGCCTGAAGCTGGGAGG - Intronic
939180127 2:138794599-138794621 ACCCAGAGCCTCACTTGCTGAGG + Intergenic
941433339 2:165437488-165437510 ACCCAGAGGCTGGAGTGCAGTGG + Intergenic
943930698 2:193848319-193848341 AGCCACAGCCTGAAGAGCAGTGG - Intergenic
946078963 2:217099927-217099949 ACCCAGAGCCAGAAGGGGTGTGG + Intergenic
946258150 2:218462293-218462315 GCCCAGGGCCTGGAGTGCAGAGG - Intronic
946396827 2:219447611-219447633 ACCCAAAGGATGAAGTGGGGAGG - Intronic
948742159 2:240055215-240055237 ACTCAGAGCCTGAGGTGGTGAGG + Intergenic
1170747061 20:19109362-19109384 TGCCAGAGGCTGGAGTGCGGTGG + Intergenic
1172543990 20:35745124-35745146 TCCCACAGGCTGAAGTGCAGTGG + Intergenic
1172707143 20:36890502-36890524 ACCCCGAGGCTGGAGTGCAGTGG + Exonic
1172718131 20:36979126-36979148 ACCCCCAGGCTGCAGTGCGGTGG + Intergenic
1172760267 20:37316491-37316513 ACCCTGAGCCTGGAATGCGGGGG - Exonic
1173028924 20:39336437-39336459 CCCCAGAGCCTGTAGTTCTGAGG + Intergenic
1173619121 20:44423274-44423296 ACCCCCAGCCTGGAGTGCAGTGG - Intronic
1174468370 20:50735108-50735130 ACCCAGGCTCTGAAGTGCAGTGG - Intronic
1175476128 20:59275947-59275969 GCCCAGAGGCTGGAGTGCAGTGG + Intergenic
1175484893 20:59338836-59338858 ACCCCCAGCCTCAAGTGAGGAGG + Intergenic
1175487955 20:59358795-59358817 ACCCCCAGCCTCAAGTGAGGAGG - Intergenic
1175894298 20:62329286-62329308 GCCCAGAGCCTGCAGCGGGGAGG + Intronic
1175953550 20:62596498-62596520 ACCCAGAGACTGATCTGTGGGGG - Intergenic
1176090526 20:63316441-63316463 ACCCAGGGGCTGCAGTGCGGTGG - Intronic
1176111341 20:63412134-63412156 TCCCAGAGCGTGGAGTGCAGGGG + Intronic
1176966362 21:15217154-15217176 ACCCAGAGGCTGGAATGCGTTGG + Intergenic
1178472772 21:32908742-32908764 TCCCTGGGCCTGAAGTGCAGAGG + Intergenic
1179630158 21:42672850-42672872 AATCAGAGCCTGCTGTGCGGTGG + Intronic
1180205582 21:46257433-46257455 ACACACAGCCTGGAGTGCAGTGG - Intronic
1181312326 22:21952207-21952229 AGCCAGAGCCTCAGGCGCGGAGG - Intronic
1182586352 22:31346188-31346210 TCCCGGAGCCTGGAGGGCGGTGG + Exonic
1183464996 22:37975273-37975295 ACCCAGAGTTGGAAGTGCTGTGG + Intronic
1184324687 22:43774414-43774436 CCCCAGAGCCTGCTGTGCTGTGG - Intronic
1184805511 22:46792783-46792805 AGCCACAGCCTGATGTGGGGAGG + Intronic
950303284 3:11899892-11899914 ACCCAAAGACAGAAGTGAGGTGG - Intergenic
950506775 3:13399963-13399985 ACCCAAAGACAGAAGTGAGGTGG + Intronic
951502983 3:23411176-23411198 ACCCACAGCCTCAACTGAGGCGG - Intronic
952825910 3:37524745-37524767 GCCCAGAGCCTGCAGTGCACGGG + Intronic
953337150 3:42103205-42103227 TCCCCCAGGCTGAAGTGCGGTGG + Intronic
953855924 3:46499032-46499054 ACCCAGAGTCAGCAGTGCAGAGG - Intronic
954552562 3:51494152-51494174 GCCCAGAGACTGGAGTGCAGTGG + Intronic
954650635 3:52160152-52160174 ACCCACAGCCTGGAGTACAGTGG + Intergenic
956662475 3:71612754-71612776 ACCCAGGGGCTGGAGTGCAGTGG - Intergenic
957118398 3:76057219-76057241 ACCCACAGCCTGCAGTGCCTGGG + Intronic
958940566 3:100308433-100308455 GCCCAGAGACTGGAGTGCAGTGG - Intronic
959849703 3:111071944-111071966 GCCCAGAGCCTGAGGCGCCGGGG + Exonic
961667180 3:128499754-128499776 ACCAAGGGCCTGAAGTGGGTGGG - Intergenic
962745199 3:138392245-138392267 CCCCAGAGGCTGGAGTGCAGTGG + Intronic
963016302 3:140827578-140827600 GCCTAGAGGCTGAAGTGAGGTGG + Intergenic
963232714 3:142925133-142925155 AACCAGAGCCTGACCTGCTGGGG - Intergenic
966604759 3:181811194-181811216 GCCCAGAGACTGGAGTGCAGTGG + Intergenic
966697332 3:182804283-182804305 ACCCCCAGGCTGAAGTGCAGTGG + Intronic
967036480 3:185652054-185652076 GCCCAGAGCCTGCAGGGCTGAGG + Intronic
967290087 3:187911127-187911149 TCCCAGAGCCTGAATTTCTGAGG - Intergenic
968148742 3:196320717-196320739 ACCCCCAGCCTGGAGTGCAGTGG + Intronic
968323503 3:197791710-197791732 ACCCAGAGCCTGGGGAGAGGCGG + Intronic
968497798 4:927845-927867 ACCCAGAGCCTGAAGTGCGGTGG - Intronic
969111157 4:4845139-4845161 ACACAGACCCTGATGTGCAGTGG + Intergenic
969240298 4:5892869-5892891 ACCCCGCGCCAGAAGTACGGCGG - Exonic
969344538 4:6562909-6562931 GCCCAGAGCCCGAAGAGCGTTGG - Intronic
972500677 4:39675133-39675155 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
972934422 4:44114754-44114776 ACCCAGAGACTGGAGTGCAGTGG - Intergenic
973272770 4:48278605-48278627 ACCCAGAGGCTGGAGTGCGGTGG + Intergenic
975662132 4:76698612-76698634 CCCCAGAGCCTGAAGTAGGAAGG + Intronic
976211025 4:82669814-82669836 AGCCAGAGCCTGACCTGCTGGGG + Intronic
976769039 4:88631413-88631435 ACCCAGGCCCTGGAGTGCAGTGG - Intronic
978838016 4:113176785-113176807 ACCCAGGGCCTGTTGTGGGGTGG - Intronic
979949722 4:126877077-126877099 ACAAAGGGCCTAAAGTGCGGTGG + Intergenic
982867017 4:160526086-160526108 ACACTCAGGCTGAAGTGCGGTGG + Intergenic
984693543 4:182755798-182755820 GCCCAGAGACTGGAGTGCAGTGG - Intronic
991693193 5:69245379-69245401 ACCCAGGCCCTGGAGTGCAGTGG + Intronic
991729221 5:69567294-69567316 ACCAAGATCCTGATGTGGGGTGG - Intronic
991805653 5:70422440-70422462 ACCAAGATCCTGATGTGGGGTGG - Intergenic
991865732 5:71060581-71060603 ACCAAGATCCTGATGTGGGGTGG + Intronic
994521896 5:100849753-100849775 ACGCACAGGCTGGAGTGCGGTGG - Intronic
997965640 5:138353416-138353438 TCCCAGAGCCCCAAGTGGGGCGG + Intronic
998674113 5:144388117-144388139 GCCCAGAGACTGGAGTGCAGTGG + Intronic
999263852 5:150253790-150253812 CCCCAGATCTTGAAGTGGGGAGG - Intronic
999609636 5:153354819-153354841 ACCCAGTACCTGGAGTGCTGAGG - Intergenic
1000224540 5:159247530-159247552 TCCCATAGGCTGGAGTGCGGTGG - Intergenic
1001159620 5:169301268-169301290 ACCGAGAGCCTGGAGGGAGGAGG + Intergenic
1001305154 5:170567072-170567094 AGTCAGGGCCTGAAGTGCAGGGG + Intronic
1003572735 6:7266665-7266687 GCCCAGAGACTGAAGTGCAGTGG + Intergenic
1005010714 6:21332741-21332763 ACACAGATCCGGAAGTGCAGAGG - Intergenic
1005510099 6:26505006-26505028 ACCCAGAGCCCCAGGTGCAGTGG + Exonic
1005720351 6:28595289-28595311 ACACCGAGGCTGAAGTGCAGTGG - Intronic
1007436180 6:41812651-41812673 GCCCAGAGACTGGAGTGCAGTGG - Intronic
1007497604 6:42271143-42271165 TCACAGAGCCTGGAGTGCAGTGG - Intronic
1008535700 6:52504746-52504768 ACGCAGAGCCTGCAGAGCAGGGG + Exonic
1009767336 6:68097460-68097482 ACCCAGGGCCTAAAGTGCAGTGG + Intergenic
1011212809 6:84972338-84972360 TCCCACAGGCTGAAGTGCAGTGG + Intergenic
1013238898 6:108224783-108224805 ACCCAGAGCTTTAAAGGCGGAGG + Intronic
1013841252 6:114397093-114397115 ACCCACAGGCTGGAGTGCAGTGG - Intergenic
1015928628 6:138334772-138334794 TCCCTGAGCCTGAAGGCCGGTGG + Exonic
1017720756 6:157241521-157241543 AGGCAGAGCCTGGAGTGAGGTGG + Intergenic
1018104095 6:160466714-160466736 ACCCAGGGCCTGTTGTGGGGTGG - Intergenic
1018535962 6:164819046-164819068 ACCCAAATCCAGAAGTGCTGTGG - Intergenic
1019277447 7:183222-183244 ACACAGAGCCTGGTGTTCGGAGG + Intergenic
1019446306 7:1073412-1073434 AAGCAGAGCCTGAGGGGCGGCGG - Intronic
1023531948 7:41166999-41167021 CACCAAAGCCTGAAGTACGGAGG + Intergenic
1025936049 7:66038298-66038320 TCCCAGAACCTGAAGCGAGGAGG - Intergenic
1025948173 7:66120935-66120957 TCCCAGAACCTGAAGTGAGGAGG + Intronic
1026497460 7:70915596-70915618 ACCTAGAGGCTGGAGTGCAGTGG - Intergenic
1026692942 7:72565368-72565390 ACACAGAGCCGGCTGTGCGGGGG - Intronic
1027192538 7:76005396-76005418 ATCCAGTTCCTGAAGTGTGGAGG + Exonic
1028214109 7:88110780-88110802 TCCCACAGGCTGAAGTGCAGTGG + Intronic
1031900746 7:127408113-127408135 ACCCAGAGGCTAGAGTGCAGTGG + Intronic
1032476898 7:132217761-132217783 ACCCATAACCTGAAGTGGGGAGG + Intronic
1034891931 7:154847828-154847850 TACCAGAGGCTGAAGTGAGGGGG - Intronic
1036665219 8:10733222-10733244 CCCCAAAGCCTGGAGTTCGGAGG + Intronic
1037262290 8:17022657-17022679 ACCCAGGGGCTGGAGTGCAGTGG + Intergenic
1037338022 8:17810790-17810812 ACCCCCAGCCTGAAGTGCAGTGG - Intergenic
1037504496 8:19516716-19516738 ACCCAGAGCCTGGTCTGTGGAGG - Intronic
1037813509 8:22100106-22100128 ACCCAGGCCCTGGAGTGCAGAGG + Intronic
1038332973 8:26624091-26624113 ACCAAGAGCCTCAAGGGCCGTGG - Intronic
1039915055 8:41853911-41853933 ACCCAGGGGGTCAAGTGCGGTGG - Intronic
1039988001 8:42464145-42464167 ACCCAGGGGCTGGAGTGCAGTGG + Intronic
1042240283 8:66656943-66656965 TCCCCCAGCCTGAAGTGCAGTGG + Intronic
1042592146 8:70406009-70406031 AGCAAGAGCCTGAAGTTCAGAGG - Intergenic
1042629523 8:70801974-70801996 GCCCAGAGACTGGAGTGCAGTGG + Intergenic
1042961303 8:74306513-74306535 ACCCAGACTCTGAAGTTCAGAGG + Intronic
1045133457 8:99184948-99184970 TCCCTGAGGCTGAAGTGCAGTGG - Intronic
1046193595 8:110831640-110831662 ACTCAAAGCCTGAAGAGCTGAGG - Intergenic
1047737677 8:127780887-127780909 ACCCAGGGGCTGGAGTGCAGTGG + Intergenic
1048817927 8:138351351-138351373 ACACAGAGGCTGATGTGCAGAGG + Intronic
1049268216 8:141680863-141680885 ACACAGTGCCTGGAGTGGGGAGG - Intergenic
1049337857 8:142096047-142096069 ACCCAGTGCCTGGCGTGTGGCGG - Intergenic
1050118225 9:2282126-2282148 ACCCAGAGCCCAAGGTGCAGAGG - Intergenic
1050295922 9:4205134-4205156 ACCCAGGGACTGGAGTGCAGTGG - Intronic
1050807429 9:9698609-9698631 AGCCAGAGACTGGAGTGGGGAGG - Intronic
1051080835 9:13291368-13291390 GCCCAGAGGCTGGAGTGCAGTGG - Intergenic
1053474155 9:38370031-38370053 ACCCAGATCCTGGAGAGCAGGGG + Intergenic
1055577122 9:77671449-77671471 ACCTGGAGCCTGAAGCGCCGAGG - Intergenic
1056094821 9:83242286-83242308 AACCAGACCCTGAAGAGGGGTGG - Intergenic
1057396701 9:94687152-94687174 GCCCAGAGACTGGAGTGCAGTGG - Intergenic
1057522095 9:95768278-95768300 ACCCAGAGGCTGGAGTGCAGTGG - Intergenic
1059282183 9:113144448-113144470 ACCCAGGGGCTGGAGTGCAGTGG + Intergenic
1060382504 9:123189683-123189705 ACCCAGGGCCTGTCGTGGGGTGG + Intronic
1061216034 9:129222526-129222548 ACCCTGGCCCTGCAGTGCGGCGG - Intergenic
1186609690 X:11127143-11127165 ACTCACAGCCAGAAGTGCAGAGG + Intergenic
1188685507 X:33064847-33064869 ACCCCGAGGCTGAAGTGCAGTGG - Intronic
1190283747 X:48948552-48948574 ACCCAAACCCTGCAGTGCGAGGG - Intronic
1192521323 X:71803997-71804019 ACCCAGATCCTGCAGTGGTGAGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1198569979 X:137944563-137944585 TCACAGAGGCTGAAGTGCAGTGG - Intergenic
1198820160 X:140638911-140638933 ACCCAGGGCCTGTCGTGGGGTGG + Intergenic
1201680980 Y:16643378-16643400 ACCCAGAGCCTGAAGACTTGTGG - Intergenic
1201938156 Y:19430059-19430081 ACTCAAAGCCTGAAGAGCTGAGG - Intergenic
1202601744 Y:26600625-26600647 ATCCAGAGCCAGAAGGGCCGGGG + Intergenic