ID: 968498556

View in Genome Browser
Species Human (GRCh38)
Location 4:932428-932450
Sequence CAGCGCGTGCGCGGCGTCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968498551_968498556 14 Left 968498551 4:932391-932413 CCTGGCTGCGCGCGCAGGCGCGG 0: 1
1: 0
2: 1
3: 68
4: 228
Right 968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 88
968498548_968498556 28 Left 968498548 4:932377-932399 CCGCGGCCTCACTTCCTGGCTGC 0: 1
1: 0
2: 0
3: 36
4: 347
Right 968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 88
968498549_968498556 22 Left 968498549 4:932383-932405 CCTCACTTCCTGGCTGCGCGCGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968498556 Original CRISPR CAGCGCGTGCGCGGCGTCGC CGG Exonic
900123591 1:1059696-1059718 CAGCGCCTTCGCGGAGTTGCCGG + Intergenic
905043206 1:34976970-34976992 CAGCGCGCGCGGGGCGCCGTAGG + Intergenic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
918388788 1:184037154-184037176 CAGCGTGTGCGCCGCGTTGCGGG + Exonic
918458754 1:184754650-184754672 CTGCGCGTGCGCGGAACCGCGGG - Exonic
1065024312 10:21526348-21526370 CAGCCCTTCCGCGGCGTCGCGGG + Intergenic
1066697940 10:38095015-38095037 CTCCGCGTGCGCGGCCTCACAGG - Intronic
1071527303 10:86366134-86366156 CAGCGGGAGCGCGGCGCGGCCGG + Intronic
1072695819 10:97602003-97602025 CAGCGGGGGCGCGGCCTGGCGGG + Intronic
1076792902 10:132786186-132786208 CAGCGCGCGCGCCGCGCCCCGGG - Intergenic
1078771744 11:14358553-14358575 CCTCCCGGGCGCGGCGTCGCGGG - Intronic
1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG + Intergenic
1094839279 12:34336206-34336228 CTGCGCATGCGCGGGGTCTCCGG + Intergenic
1094841970 12:34346000-34346022 CCGCGCATGCGCGGGGTCCCGGG - Intergenic
1102289333 12:111686022-111686044 CAGCGATTGGGCGGCGTGGCAGG + Intergenic
1105349450 13:19602276-19602298 CGGCACGTGTGCGGCGGCGCCGG - Intergenic
1107481571 13:40789791-40789813 CGGCACGTGCGCTGCGACGCTGG - Intronic
1115771396 14:36666531-36666553 CACCGCGTGCGGGGCGGCGGCGG - Exonic
1121103312 14:91264583-91264605 CGGCGCCTGCGGGGCGTGGCGGG + Intergenic
1121751680 14:96363132-96363154 CAGCGCGAGCGGTGCGGCGCCGG - Exonic
1122418212 14:101560484-101560506 CAGCGGGCGCGGGGCGGCGCCGG - Intergenic
1127207291 15:56733700-56733722 CGGCATGTGCGCCGCGTCGCGGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1132942412 16:2514583-2514605 CAGTGCGCGGGCGGCGGCGCGGG + Intronic
1134482311 16:14630285-14630307 CAGCGCCTGCGCGGCGGCGGGGG + Intronic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1140481751 16:75265991-75266013 CGGCGCATGCGCGGCGCGGCTGG - Exonic
1141490453 16:84368785-84368807 CAGCGCGAACGCGGGGTCTCGGG - Intronic
1141957688 16:87383551-87383573 CAGCGCGGGGGCGGCGGCGAGGG + Exonic
1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG + Intergenic
1143599043 17:7932090-7932112 CCGCGCGTGCGCGGCTCCGGTGG - Intronic
1144339745 17:14301679-14301701 CAGCCCCGGCGCGGCGGCGCAGG - Exonic
1145904337 17:28508015-28508037 CAGCGCGGGCGGGGCGGGGCTGG - Intronic
1151755735 17:76074469-76074491 CTGCGTGTGCGCCGCGCCGCAGG - Intronic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1160204503 18:76822283-76822305 GGGCGCATGCGCGGCGCCGCGGG - Exonic
1160583288 18:79899773-79899795 CAGCGCATCCGCGGAGTCGTCGG - Exonic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160824923 19:1074997-1075019 CTGCGCATGCGCGGCCTCGCAGG + Intronic
1160961921 19:1725881-1725903 CAGCGCGGGCTCGGCGTGGCCGG + Intergenic
1161233259 19:3186146-3186168 GAACTCGTGCGCGGCGTCGGCGG - Exonic
1161317392 19:3624005-3624027 ACGAGCGTGCGCGCCGTCGCCGG + Exonic
1163720439 19:18895967-18895989 CAGCGCGCTGGCGGCGGCGCGGG - Exonic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164990090 19:32676628-32676650 CAGCGCGCGCGCCGCCACGCCGG - Exonic
1165349523 19:35268525-35268547 CTGCGCGCGCGCGGCGGCGGCGG - Intergenic
1165493545 19:36139539-36139561 CAGCGCCTGCGCCGCCTCCCAGG - Intergenic
1167650163 19:50724533-50724555 CAGGGCTTGCACGGCATCGCGGG - Exonic
1168718934 19:58544397-58544419 ATGCGCGTGCGCGGCGGCGTCGG + Intronic
927997271 2:27494976-27494998 CGGCGCGGGCCCGGCGACGCGGG + Exonic
931584105 2:63808472-63808494 CAGCGCGTGCCCGCAATCGCAGG - Intronic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
947723254 2:232381698-232381720 CCCCGGGTGCGCGGCGTCGGTGG - Exonic
947727598 2:232409775-232409797 CCCCGGGTGCGCGGCGTCGGTGG - Exonic
948809319 2:240466736-240466758 CAGCCCGTGCGGGGCTTCTCTGG - Exonic
949040183 2:241844332-241844354 AAGTGAGTGCGCGGCGGCGCGGG + Intergenic
1172245660 20:33443636-33443658 CAGGGCGAGCGCGGCGGCCCGGG - Exonic
1176092063 20:63322552-63322574 CAGCGCATGCGCGGCGTGCAGGG + Intronic
950729785 3:14947604-14947626 CAGCGCGCGGGCGGCGGCGGCGG + Intronic
955911536 3:63863788-63863810 CATGGCGTGCGCGGCGGCGGCGG + Exonic
956892355 3:73624901-73624923 GAGCGCGCGGGCGGCGTAGCCGG - Exonic
968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG + Exonic
969394243 4:6910130-6910152 CAGCGCGTGCGTGGCGCCCGGGG + Intronic
969436551 4:7192461-7192483 CGGTGCGCGCTCGGCGTCGCGGG + Intergenic
992067403 5:73120508-73120530 CTGCGCGGGCGCGGCGGCCCGGG - Exonic
996403452 5:123086526-123086548 CAGAGCGCGCGCAGCGTCGGGGG + Intergenic
997584063 5:135034363-135034385 CAGTGAGGGCGCGGCGGCGCGGG - Intronic
1003905351 6:10694433-10694455 CAGCGCGAGCGCTGCGCCGCTGG + Intronic
1011983967 6:93419159-93419181 CAGCTCGTCCGCGGCGCTGCCGG - Intronic
1013242798 6:108261276-108261298 CACCGCGAGCGCGCCGCCGCGGG + Intergenic
1018613006 6:165662029-165662051 CAGCGCGGCCGCGGCGGCGAGGG + Exonic
1018769367 6:166957478-166957500 CAGCCCGTGGGCGGGGCCGCGGG - Intergenic
1018872998 6:167797141-167797163 CAGCGCGTGCGCCGCGGCCAGGG - Intergenic
1019453126 7:1109939-1109961 CAGTGCGAGCGCAGCCTCGCCGG + Intronic
1025089669 7:56051786-56051808 CAGAGCCGGCGCGGCGTGGCCGG - Exonic
1035266030 7:157690775-157690797 CAGCGGCTGCGCGGCGGCACGGG + Intronic
1035751709 8:2001435-2001457 CAGCGCGGGCGCCGCGTCCCCGG + Exonic
1036454256 8:8893580-8893602 GAGCGCGGGCGCCGCGTCCCCGG + Exonic
1039467796 8:37796723-37796745 CAGGGCGGGCGCGGGGACGCAGG + Intronic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1049724225 8:144138068-144138090 GAGCGCGCGGGCGGCGTCCCGGG - Exonic
1051641801 9:19230672-19230694 CTGCGCCTGCGCCGCCTCGCGGG - Exonic
1052192651 9:25677597-25677619 CAGGGCGTGCGCGAGGTCGGGGG + Exonic
1053643676 9:40109347-40109369 CAGCGCTTGCGCTGCGCCCCAGG + Intergenic
1053762477 9:41356143-41356165 CAGCGCTTGCGCTGCGCCCCAGG - Intergenic
1054324531 9:63706578-63706600 CAGCGCTTGCGCTGCGCCCCAGG + Intergenic
1054541074 9:66267260-66267282 CAGCGCTTGCGCTGCGCCCCAGG - Intergenic
1055612025 9:78032422-78032444 GAGCGCGTGCGGGGCTCCGCGGG - Intergenic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1061128244 9:128689842-128689864 CAGCGCGGCCGCCGCGGCGCGGG - Intronic
1061522285 9:131125881-131125903 CAGCGCGTCTGCCGCGCCGCTGG + Intronic
1061859353 9:133460213-133460235 GAGCGCATGCGCGGCGGGGCCGG - Intronic
1062022685 9:134326739-134326761 CGGCGCGCGCGGGGGGTCGCCGG + Intronic
1186496555 X:10015918-10015940 CAGCGCATCCGCGGTGGCGCCGG - Intronic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1197870506 X:131058679-131058701 GAGCGCGTGGGCGGAGTCGCTGG + Intronic
1200098203 X:153673902-153673924 CAGCGCGGCCGCGGCGCCGCAGG + Intronic