ID: 968499956

View in Genome Browser
Species Human (GRCh38)
Location 4:945179-945201
Sequence TGCCTGGAATGGACCCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968499950_968499956 2 Left 968499950 4:945154-945176 CCTGTCATGGCAGTCCCAGTGAG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 968499956 4:945179-945201 TGCCTGGAATGGACCCTTGGAGG No data
968499946_968499956 24 Left 968499946 4:945132-945154 CCTCAGTGCAGACCCTAGGCAGC 0: 1
1: 0
2: 3
3: 16
4: 202
Right 968499956 4:945179-945201 TGCCTGGAATGGACCCTTGGAGG No data
968499948_968499956 12 Left 968499948 4:945144-945166 CCCTAGGCAGCCTGTCATGGCAG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 968499956 4:945179-945201 TGCCTGGAATGGACCCTTGGAGG No data
968499949_968499956 11 Left 968499949 4:945145-945167 CCTAGGCAGCCTGTCATGGCAGT 0: 1
1: 0
2: 2
3: 19
4: 177
Right 968499956 4:945179-945201 TGCCTGGAATGGACCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968499956 Original CRISPR TGCCTGGAATGGACCCTTGG AGG Intronic
No off target data available for this crispr