ID: 968503970

View in Genome Browser
Species Human (GRCh38)
Location 4:963555-963577
Sequence CTGTTCACACGCAGCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968503970_968503972 -8 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503972 4:963570-963592 GTGAACAGACCACACCCGCCTGG 0: 1
1: 0
2: 1
3: 3
4: 62
968503970_968503973 -7 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503973 4:963571-963593 TGAACAGACCACACCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 87
968503970_968503980 17 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503980 4:963595-963617 CATGCAGCGCGAGTCCAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 105
968503970_968503978 13 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503978 4:963591-963613 GGGCCATGCAGCGCGAGTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 169
968503970_968503981 29 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503981 4:963607-963629 GTCCAGGCTGGAAATCCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 134
968503970_968503982 30 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503982 4:963608-963630 TCCAGGCTGGAAATCCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968503970 Original CRISPR CTGTTCACACGCAGCTCAGT GGG (reversed) Intronic