ID: 968503970

View in Genome Browser
Species Human (GRCh38)
Location 4:963555-963577
Sequence CTGTTCACACGCAGCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968503970_968503973 -7 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503973 4:963571-963593 TGAACAGACCACACCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 87
968503970_968503972 -8 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503972 4:963570-963592 GTGAACAGACCACACCCGCCTGG 0: 1
1: 0
2: 1
3: 3
4: 62
968503970_968503982 30 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503982 4:963608-963630 TCCAGGCTGGAAATCCACGTGGG No data
968503970_968503981 29 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503981 4:963607-963629 GTCCAGGCTGGAAATCCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 134
968503970_968503978 13 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503978 4:963591-963613 GGGCCATGCAGCGCGAGTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 169
968503970_968503980 17 Left 968503970 4:963555-963577 CCCACTGAGCTGCGTGTGAACAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 968503980 4:963595-963617 CATGCAGCGCGAGTCCAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968503970 Original CRISPR CTGTTCACACGCAGCTCAGT GGG (reversed) Intronic
901480330 1:9520625-9520647 CTGTGCAGACGCAGCCCAGAAGG - Intergenic
902174028 1:14635950-14635972 CTGTTTACACCCAGGTCTGTGGG + Intronic
906349583 1:45046541-45046563 CTGTTAACAGGCATCTCAGTAGG - Intronic
906566758 1:46806413-46806435 CAGTTGACCCGAAGCTCAGTGGG - Intronic
907647199 1:56255940-56255962 CTGTGGACACGGAGCTCACTTGG - Intergenic
907855993 1:58303945-58303967 CTGTTCATCCCCAGCTGAGTTGG - Intronic
1065763081 10:29001414-29001436 CTGTCCACAGGCAGCTCTGATGG - Intergenic
1067429439 10:46233378-46233400 CTGTTGACACTCATCTCTGTTGG + Intergenic
1067444300 10:46331018-46331040 CTGTTGACACTCATCTCTGTTGG - Intergenic
1076461115 10:130648162-130648184 CTGGTCACCCTCAGCTCAGGTGG + Intergenic
1076549674 10:131270300-131270322 CTCTTCAAACTCAGCTCAGGAGG - Intronic
1081360417 11:42170661-42170683 CTTTTCACACAGAGCTCAGTGGG - Intergenic
1088326799 11:108609129-108609151 CTCTTCACACCCACCCCAGTGGG + Intergenic
1088817247 11:113430036-113430058 CTGTTCAAATGCAGCTCACTAGG + Intronic
1089114739 11:116085511-116085533 CTGATCACAGGCAGATAAGTAGG + Intergenic
1092762516 12:11822493-11822515 CTGTTCACATCCAGGTCTGTAGG + Intronic
1094380971 12:29842243-29842265 CTGTAGACACACTGCTCAGTAGG + Intergenic
1098740995 12:74172894-74172916 CTGTTCATGCTCAGCTCACTAGG + Intergenic
1104542186 12:129676098-129676120 CTGCTCACACAGAGCTCAGAAGG + Intronic
1105544945 13:21344480-21344502 TTGTTCACACACAGCCAAGTTGG + Intergenic
1107429046 13:40322339-40322361 CTGTACACAAGCAGCACAGCAGG - Intergenic
1110195987 13:72789012-72789034 CAGTTAACAAGCAGCTGAGTGGG - Intronic
1113654865 13:112061664-112061686 CTGTTCCCACCCAGCCCAGCTGG - Intergenic
1116256709 14:42566381-42566403 CAGTTCAGACAGAGCTCAGTGGG - Intergenic
1118476232 14:66120039-66120061 CTGTTCTCACACAACTCAGGAGG + Intergenic
1122705004 14:103615366-103615388 ATGTTCACTCACAGCTCAGCCGG + Intronic
1128543277 15:68551417-68551439 CTCTTCACCCACAGCCCAGTGGG - Intergenic
1130152317 15:81320427-81320449 CTGTTCCCAGGCAGGTCATTAGG - Intronic
1131125001 15:89852459-89852481 CTGTTTCCAAGCTGCTCAGTGGG + Intronic
1136625343 16:31458816-31458838 TTCTTCACTCGCAGCGCAGTCGG - Intronic
1141039156 16:80656471-80656493 CATTTCACACGCAGGACAGTGGG - Intronic
1148485262 17:47986792-47986814 CTGCCCGCAAGCAGCTCAGTGGG - Intergenic
1151687953 17:75660672-75660694 CTGTTCACTCACATCTCAGTAGG - Intronic
1152764002 17:82125821-82125843 CTGTTCACAGGCAGTTCCATTGG - Intronic
1154475161 18:14748144-14748166 CAGCTCACGCGCAGCTCAGCAGG - Intronic
1158055739 18:53277997-53278019 CTGTTCACACACAGATAATTGGG + Intronic
1160719577 19:591284-591306 CTGTTCACACACAGCCCACGGGG - Intronic
1163028239 19:14526569-14526591 CGGTTGACACGCAGCATAGTAGG + Intronic
1165991680 19:39818774-39818796 CTGTTCTCAGGCAGCTGGGTTGG - Intergenic
1166347360 19:42175088-42175110 CTGTCCACACCCTTCTCAGTGGG + Intronic
1166455609 19:42937635-42937657 CAGTTCACACACAGCACAATGGG - Intronic
1168048436 19:53810682-53810704 CTGTTAAGAAGCAGCTCCGTGGG + Exonic
925073018 2:986182-986204 CTGAGCACAGGCAGCTCATTTGG + Intronic
927242401 2:20930436-20930458 CTGTTCACACCCATGTCAGCTGG + Intergenic
933285069 2:80376658-80376680 CTGTTCAGACCCAGCTCTGGAGG + Intronic
937445872 2:121957409-121957431 GTGTTCACACTCAGCTCTGGGGG + Intergenic
938207608 2:129437539-129437561 CTGTGCTCAGGCAGCTCAGCAGG + Intergenic
948406805 2:237727678-237727700 CTGCTCCCCCGCAGCTCAGGAGG - Intronic
1172479075 20:35260437-35260459 CTGTCCACAGGGAGCTCAGCTGG - Intronic
1178820094 21:35967055-35967077 CTGTTATAAAGCAGCTCAGTAGG - Intronic
1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG + Exonic
1181807469 22:25383725-25383747 CTGTTCACCCGCAGCTGCCTGGG - Intronic
950065556 3:10108621-10108643 CTCATCACACTCTGCTCAGTGGG + Intergenic
959691934 3:109207094-109207116 CTGCTGACTGGCAGCTCAGTTGG - Intergenic
961428932 3:126866333-126866355 CTGTTATCACCCAGCTCACTGGG - Intronic
963176048 3:142298954-142298976 TTGTCCACTCGCAGCTCAGCAGG + Intergenic
968503970 4:963555-963577 CTGTTCACACGCAGCTCAGTGGG - Intronic
978431594 4:108638885-108638907 CTGTTCATACCCAGCTGTGTTGG + Intergenic
985347423 4:189021191-189021213 CTGTTCAGATGCAGCACAGAAGG + Intergenic
985813695 5:2110958-2110980 CTGTTCCTAAGCAGCTCTGTTGG - Intergenic
986456539 5:7926464-7926486 CTTTTCACTTGCAGCTTAGTTGG - Intergenic
990978062 5:61576332-61576354 CTGTGCATAAGCAGCTCAGTTGG + Intergenic
992341838 5:75832275-75832297 CTGTTCACACACAGCCACGTTGG + Intergenic
997447754 5:133953900-133953922 CTGTTCTCAAGCAACTCACTCGG + Intergenic
998062280 5:139128183-139128205 TTGTTCACATGCAGATCAGTTGG - Intronic
998807666 5:145934775-145934797 GTGTTCAGACACAGCTCAATGGG - Intergenic
1002284728 5:178154544-178154566 CGGTGCAGACGCAGGTCAGTGGG - Intergenic
1014643020 6:123937340-123937362 CTGTTCATAAGCAGCACAATTGG + Intronic
1018369845 6:163157469-163157491 CTGTTCACAGGGAGCTCTGCTGG - Intronic
1019401462 7:856548-856570 CTGTCCTCACGCAGCCCAGCAGG - Intronic
1024526738 7:50355514-50355536 CTCTTAGCACGCAGCCCAGTGGG - Intronic
1029245288 7:99195098-99195120 CTGTTCACACACAGCCACGTTGG + Exonic
1049759144 8:144324051-144324073 CTGCTCACAGGCACCCCAGTCGG - Intronic
1059685360 9:116629866-116629888 TTGTGCACAAGCATCTCAGTGGG - Intronic
1059961962 9:119574345-119574367 CTGTTCTCATCCATCTCAGTGGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1192268891 X:69559792-69559814 ATGTTCATAGGCAGCTCAGAGGG + Intergenic
1195367570 X:104140795-104140817 GTGTTCACAAGCAGGCCAGTGGG - Intronic
1198653206 X:138886243-138886265 CTGTTCAGATGCAGCTCATTGGG - Intronic