ID: 968505230

View in Genome Browser
Species Human (GRCh38)
Location 4:968278-968300
Sequence CGAGTGGTGCGGGGTCCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968505230_968505237 5 Left 968505230 4:968278-968300 CCACCTGGACCCCGCACCACTCG 0: 1
1: 0
2: 0
3: 10
4: 156
Right 968505237 4:968306-968328 CACGCCGGCCAGCACGTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 56
968505230_968505235 -10 Left 968505230 4:968278-968300 CCACCTGGACCCCGCACCACTCG 0: 1
1: 0
2: 0
3: 10
4: 156
Right 968505235 4:968291-968313 GCACCACTCGCAGCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968505230 Original CRISPR CGAGTGGTGCGGGGTCCAGG TGG (reversed) Exonic
900230671 1:1555447-1555469 CCAGTGCTGCAGGGGCCAGGTGG + Intronic
900534702 1:3171049-3171071 TGAGGGGTGCGGGGTCCCGCTGG - Intronic
903736914 1:25535618-25535640 GGAGGGGTGCGGGAGCCAGGTGG + Intergenic
903860108 1:26360022-26360044 CGAGCGGTGCGGAGGCCCGGGGG - Intergenic
908437447 1:64120671-64120693 TGAGTGTTGCTGGGTCAAGGAGG - Intronic
915247646 1:154567923-154567945 CGCCTGGAGCTGGGTCCAGGTGG - Exonic
915741112 1:158118997-158119019 GGAGTGGTGGGGGGTGGAGGTGG + Intergenic
1067145473 10:43690513-43690535 AGAGCTGCGCGGGGTCCAGGAGG + Intergenic
1072728601 10:97829844-97829866 CGGGAGGTGTGGGATCCAGGAGG - Intergenic
1076116367 10:127904546-127904568 GGAGTGGTGAGGTGTTCAGGAGG + Intergenic
1076379015 10:130012343-130012365 CAAGTGGCGAGGGGTGCAGGTGG + Intergenic
1079259626 11:18865891-18865913 AGAGTGGTGCTGGGTCCAAAGGG - Intergenic
1083648257 11:64185601-64185623 CGAGTGCCGCGAGTTCCAGGCGG - Exonic
1083795467 11:65014297-65014319 CGAGGGTGGCGGGGTCCAGCCGG + Intronic
1083997072 11:66278006-66278028 CGAGGGGTGCGGGGTGCCGGGGG + Intergenic
1084438473 11:69157460-69157482 CGAGGGGGGCGGGCTCCCGGCGG + Intergenic
1085393476 11:76194470-76194492 CCAGTGGTGGGGGGTGCGGGGGG - Intronic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1094817906 12:34205041-34205063 TGAGTGGGGCGGGGGGCAGGGGG - Intergenic
1096241585 12:49962683-49962705 GGAGAGGTGAGGGGCCCAGGAGG - Intronic
1096980972 12:55728252-55728274 TGAGTGGCGAGGGGTCCTGGGGG - Intronic
1104693048 12:130840769-130840791 TGCCTGTTGCGGGGTCCAGGAGG - Intergenic
1105015881 12:132786651-132786673 GGGGAGGTGCGGGGGCCAGGTGG - Intronic
1107093981 13:36515038-36515060 CCGGTGGTGCGGGGTGCGGGTGG + Intergenic
1112334308 13:98501361-98501383 GGGGTGGGGCGGGGGCCAGGAGG + Intronic
1113808016 13:113121234-113121256 GGAGTCATGCGGGGTCCTGGTGG + Intergenic
1113944926 13:114038747-114038769 CGAGGGATGAGGGTTCCAGGAGG + Intronic
1117978837 14:61322175-61322197 CGAGTGGCGCAGGGACCAGCGGG - Exonic
1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG + Intronic
1122329906 14:100904945-100904967 GGAGTGGTGCATGGACCAGGGGG + Intergenic
1122783077 14:104151892-104151914 CGGATGGTGCGGTGGCCAGGCGG + Intronic
1122808777 14:104277381-104277403 GGAGTGGTGCGGGCTCCCTGAGG + Intergenic
1124340460 15:28886516-28886538 CGGGCGGGGCGGGGACCAGGCGG + Intronic
1124355712 15:28993386-28993408 AAAGTGGTGCTGGGTCCAAGTGG + Intronic
1125597849 15:40899065-40899087 AGGGTGGTGTGGGGGCCAGGAGG + Intronic
1127877396 15:63122504-63122526 CGAGGTGGGCGGGGCCCAGGTGG + Intronic
1130078378 15:80709713-80709735 AGAGTGGTGCAGGGTGGAGGAGG - Intronic
1130910547 15:88267806-88267828 AGAGAGGTGTGTGGTCCAGGAGG - Intergenic
1132557499 16:579006-579028 CGAGTGGGGCGGGGGCGGGGCGG + Intronic
1133250027 16:4474656-4474678 CGAGTCCCGCGGGATCCAGGAGG - Exonic
1133332966 16:4987786-4987808 CCAGGGCGGCGGGGTCCAGGAGG + Intronic
1135552342 16:23408126-23408148 CGAGTGGGGCGGGAGGCAGGGGG + Intronic
1135552392 16:23408264-23408286 CGAGTGGGGCGGGAGGCAGGGGG + Intronic
1138408771 16:56821268-56821290 CGGGAGCAGCGGGGTCCAGGGGG - Intronic
1139754407 16:69131813-69131835 CGAGTGGGGTGGGGTCCTGGAGG - Intronic
1142184181 16:88686545-88686567 CGAGTGGGGCGGGGCCACGGGGG + Intergenic
1143024073 17:3930581-3930603 GGAGGGGTGCGGGGTCGGGGCGG + Intronic
1143376038 17:6468281-6468303 TCAGTGCTGCAGGGTCCAGGCGG + Exonic
1143659345 17:8315179-8315201 AGGGTGTTGCGAGGTCCAGGGGG - Exonic
1144474304 17:15571972-15571994 GGAGGGGTGCGGGGGACAGGAGG + Exonic
1145771276 17:27494992-27495014 CGGGCAGTGCGGGTTCCAGGTGG + Intronic
1147767868 17:42849137-42849159 CCAGTGCTCCGGGTTCCAGGGGG - Exonic
1148764481 17:50029137-50029159 AGAGAGGAGCGGGGTCCAGGTGG - Intergenic
1150833137 17:68541290-68541312 TGAGTGGCGCAGGGTCCAAGAGG - Intronic
1152993116 18:380648-380670 CTAGGGGTGTGGGTTCCAGGTGG + Intronic
1153778591 18:8475383-8475405 CAAGAGGTGTGGGGGCCAGGTGG - Intergenic
1155732648 18:29180231-29180253 CTATTGTTGCGGGATCCAGGAGG + Intergenic
1157983567 18:52411062-52411084 AGAGTGGTGGGTGGTCAAGGTGG - Intronic
1158434831 18:57428367-57428389 GGAATGGCGCCGGGTCCAGGCGG - Intergenic
1158940746 18:62404337-62404359 CGGGGAGGGCGGGGTCCAGGGGG + Intergenic
1160586842 18:79917822-79917844 GGTGTGGTGTGGGGTGCAGGTGG - Intronic
1160819039 19:1049533-1049555 GGAGTGGTGGGGGGTTCACGGGG - Intronic
1160819073 19:1049609-1049631 GGAGTGGTGGGGGGTTCACGGGG - Intronic
1160819096 19:1049660-1049682 GGAGTGGTGGGGGGTTCACGGGG - Intronic
1160819131 19:1049737-1049759 GGAGTGGTGGGGGGTTCACGGGG - Intronic
1160819154 19:1049788-1049810 GGAGTGGTGGGGGGTTCACGGGG - Intronic
1161037839 19:2095531-2095553 CGGGAGGTGCGGGGTCCTGCGGG + Intronic
1161344542 19:3761569-3761591 CGTGGGGAGCGGGGTCCTGGAGG - Exonic
1163821498 19:19498925-19498947 CGAGAGGCTCAGGGTCCAGGGGG + Intronic
1165245843 19:34498002-34498024 GGAGGAGTGCGGGGTCCCGGAGG - Intronic
1166409382 19:42546701-42546723 TGAGTGGTGGGTGTTCCAGGAGG + Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1168147614 19:54428861-54428883 CGGGTGGGGAGGGGTGCAGGGGG - Intronic
1168231155 19:55032437-55032459 CGGGAGCAGCGGGGTCCAGGCGG - Intronic
1168694502 19:58396868-58396890 CGTGGGGCGCGGCGTCCAGGCGG - Exonic
925478335 2:4243940-4243962 CGAGTGGAGTGGGATCCTGGTGG + Intergenic
926631268 2:15138336-15138358 CAAGTGGTGCAGAGTCCAGGTGG + Intergenic
928656720 2:33459656-33459678 GGAGTGGTGAGGGGACAAGGAGG + Intronic
929789739 2:45013931-45013953 CGGGTGGCGCCGGGACCAGGCGG + Intergenic
933747285 2:85580416-85580438 TGAGGGGTGCAGGCTCCAGGTGG - Intronic
934763699 2:96869301-96869323 GGAGGGGTGCGGGATCCAGGCGG + Intronic
937260209 2:120580723-120580745 CCAGTGGGAAGGGGTCCAGGAGG - Intergenic
937298293 2:120823072-120823094 CGGGTGGCGGGGGGTGCAGGGGG - Intronic
938543311 2:132304831-132304853 CGAGAGGGGCGCGGTCCAGCCGG - Intergenic
1168830244 20:841642-841664 CTAGTGGGGAGGGGGCCAGGTGG + Intronic
1171872195 20:30537667-30537689 CGAGAGGGGCGCGGTCCAGGCGG - Intergenic
1172483319 20:35284567-35284589 CGAGAGGGGCGGGGTCGCGGCGG - Intronic
1174196530 20:48776331-48776353 TGAGGGGGGCGGGGTCCATGGGG - Intronic
1174578310 20:51553280-51553302 GTAGTTGTGCGGGGACCAGGTGG - Intronic
1174855203 20:54038141-54038163 CTAGTGGTGAGGGCTGCAGGTGG - Intronic
1175199389 20:57267118-57267140 TGAGTGGGGAGAGGTCCAGGCGG - Intergenic
1175415019 20:58795402-58795424 CGTGTGGGGCAGGGGCCAGGAGG - Intergenic
1175522259 20:59609438-59609460 CAAGTGGGGTGGGCTCCAGGAGG - Intronic
1176081011 20:63273020-63273042 AGGGTGGAGCGGGGTCCGGGTGG - Intronic
1176081786 20:63277095-63277117 CGGGTGGTGGGTGCTCCAGGCGG + Intronic
1179613333 21:42566227-42566249 CCAGGGGTGCAGGGTGCAGGTGG - Intronic
1179675098 21:42975273-42975295 CGGGTGGGTCGGGGTCCTGGGGG + Intronic
1179897186 21:44369518-44369540 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897204 21:44369576-44369598 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897222 21:44369636-44369658 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897256 21:44369754-44369776 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897274 21:44369814-44369836 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897292 21:44369874-44369896 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897310 21:44369932-44369954 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG + Intronic
1182295856 22:29311015-29311037 CGAGGAGTGAGGGGTCCAGAGGG + Intronic
1183269203 22:36850158-36850180 GGAGAGGTAGGGGGTCCAGGAGG + Intergenic
1183458809 22:37937204-37937226 CCAGGGGTGGGGGGTCCTGGGGG + Intronic
1183782873 22:40009794-40009816 CGTGGGGTGCAGGGGCCAGGTGG + Intronic
1184640587 22:45867992-45868014 GGAGTGGTGGGGGGCCCGGGGGG - Intergenic
1185241694 22:49750464-49750486 CGAGGGCTACGGGGTCCTGGGGG + Intergenic
952307833 3:32161154-32161176 GGAGGGGTGCTGGGTGCAGGGGG - Intronic
955029906 3:55205824-55205846 CCAGTGATGCTGGGTCCTGGAGG + Intergenic
956062318 3:65360054-65360076 CGAGGGGTCCGAGGTACAGGGGG - Intronic
960856397 3:122106656-122106678 TGAGTGATGCAGGGTCCAGGAGG + Intronic
961786452 3:129349981-129350003 CTGGTGGTGCCGGGGCCAGGTGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
968505188 4:968165-968187 GGAGAGGCGCGGGTTCCAGGTGG - Intronic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
970150148 4:13081099-13081121 GGTGTGGTGCAGGGTCCAGGAGG - Intergenic
975514239 4:75227335-75227357 TGTGTGGTGGGGGGTGCAGGGGG + Intergenic
978376495 4:108079567-108079589 CCAGTTGTGTGGGGACCAGGAGG + Exonic
983577559 4:169274871-169274893 GCAGTGGTGCAGGGTCCAAGTGG - Intergenic
983595737 4:169465311-169465333 CCAGTGGTGGGGGGGACAGGAGG - Intronic
985423562 4:189807199-189807221 CGCGGGGCGCGGGTTCCAGGTGG - Intergenic
985782392 5:1878118-1878140 CCAGAGGCCCGGGGTCCAGGAGG + Exonic
985788953 5:1915238-1915260 AGAGTGATGCGGGGACCCGGGGG - Intergenic
994177731 5:96730047-96730069 CCAGGTGTGGGGGGTCCAGGAGG - Intronic
997938932 5:138139118-138139140 CGGGTGGTGGGGGCTCGAGGGGG + Intronic
1002939590 6:1704367-1704389 AGAGTGGTGTGGGCTCCATGGGG + Intronic
1004275229 6:14230136-14230158 CTAGTGGTACTGGGTGCAGGGGG + Intergenic
1007742774 6:44022915-44022937 TGAGTGCTGTGGGGACCAGGGGG - Intergenic
1017525171 6:155236251-155236273 GGAGTGGTGCTGGCTCCAGTGGG - Intronic
1018876372 6:167826316-167826338 CGGGCGGTGCTGGGTCCAGACGG - Intergenic
1019427435 7:984244-984266 CCAGTGGTGCAGGGTGGAGGGGG - Intronic
1019625081 7:2011832-2011854 CCAGTGCAGCGGGGTCCTGGGGG + Intronic
1019767919 7:2865128-2865150 AGAGTGGGATGGGGTCCAGGTGG + Intergenic
1022253028 7:28627713-28627735 CCAGGGGTGCGGGGTAGAGGGGG - Intronic
1024933796 7:54691324-54691346 CGAGTGGAGTGGGGTAAAGGTGG - Intergenic
1025762263 7:64405629-64405651 CGAGTGGGGAGGGGGCGAGGGGG - Intergenic
1026672613 7:72403172-72403194 GGGGTGGCGCGGGGTCCAGGAGG - Intronic
1035435535 7:158856645-158856667 CGAAGGGTGCGGGGCACAGGTGG + Exonic
1037960849 8:23097143-23097165 CTAGTTGTGGGGGGACCAGGAGG - Intronic
1038024881 8:23579359-23579381 GGAATGGTGCTGGGTGCAGGGGG - Intergenic
1038418674 8:27417855-27417877 CCAGTGGTGGGGGCTCCAGGAGG + Intronic
1039900863 8:41751712-41751734 AGGCTGGTGCGGGGGCCAGGTGG - Intronic
1041047304 8:53899870-53899892 TGAGTGGTGAGGGGTCTAGCTGG - Intronic
1041196825 8:55409046-55409068 GGAGTGGACAGGGGTCCAGGAGG + Intronic
1041552939 8:59120136-59120158 GGAGGGGTGCGGGCTGCAGGCGG - Intergenic
1044519904 8:93187335-93187357 GAAGTGGTGGGGGGTCCTGGGGG + Intergenic
1045124335 8:99072545-99072567 CCAGGGGTGCGGGGCCGAGGTGG + Intronic
1048924169 8:139255922-139255944 TGAGTGGTGTGGGGTGCATGTGG - Intergenic
1049229342 8:141474003-141474025 CGAGTGGTCCAGGAACCAGGAGG - Intergenic
1057211052 9:93201329-93201351 GGAGTGGGGATGGGTCCAGGTGG + Intronic
1057454711 9:95197723-95197745 CCAGTGGTGCTGGGCCCAAGAGG + Intronic
1060222444 9:121771902-121771924 CAACTGTGGCGGGGTCCAGGGGG - Intronic
1060555272 9:124504717-124504739 CGAGAGGTGCGGGCTCCGCGCGG - Intronic
1061328025 9:129875725-129875747 AGTGTGGTGTGGGGTCCTGGTGG - Intronic
1062511786 9:136910166-136910188 TGAGTGGGCCGGGGGCCAGGTGG + Intronic
1189900242 X:45699118-45699140 CCAGTGGAGAGGGGTCCAGATGG - Intergenic
1199444033 X:147900370-147900392 AGAGTGGTGGGGGGTGCGGGGGG + Intergenic
1199874333 X:151919383-151919405 AGAGAGGTGCGGGGTTGAGGAGG - Intronic
1200061661 X:153486442-153486464 CGAGTTGGGAGGGGGCCAGGAGG + Intronic
1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG + Intronic
1200161739 X:154013127-154013149 TGAGGGGTGCTGGGTCCAGAGGG + Exonic
1200236434 X:154469921-154469943 AGAGTGGGGCAGGGGCCAGGTGG + Intronic
1201291073 Y:12421207-12421229 CGAGTGCTGAGGAGTACAGGTGG - Intergenic