ID: 968505651

View in Genome Browser
Species Human (GRCh38)
Location 4:970178-970200
Sequence GCCGGATGCCCGCCAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968505651 Original CRISPR GCCGGATGCCCGCCAGTGGC AGG Intronic
900341128 1:2189870-2189892 GCCGGATCCTCTCCAGCGGCAGG - Intronic
901857471 1:12053563-12053585 GTGGGACGCCAGCCAGTGGCCGG + Intergenic
902377340 1:16036062-16036084 GCCCATTGCCCGGCAGTGGCAGG - Intergenic
904567088 1:31434540-31434562 GCCGGATGCCCCACTGTGGTGGG - Exonic
915626399 1:157116564-157116586 GCTGGATGCCAGGCTGTGGCTGG - Intergenic
920694351 1:208170505-208170527 GCTGGATGCCTGCCAGAGCCGGG + Intronic
922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG + Intronic
922801035 1:228364889-228364911 GACGGATGCCTGCCACAGGCAGG - Intronic
924382042 1:243474396-243474418 GCCGGCTGCCCTCCAGGTGCGGG + Intronic
1067346599 10:45442751-45442773 GCCTGCTGCCCTCCTGTGGCTGG + Intronic
1073353702 10:102837241-102837263 GCAGGCTGCCCACCAGGGGCAGG + Exonic
1076750914 10:132542535-132542557 TCAGGATGCCCCGCAGTGGCTGG - Intronic
1077491471 11:2862781-2862803 GCTGGGTGCCCGCCCGTGCCCGG - Intergenic
1085423081 11:76380664-76380686 CCCGGGAGCCCGCCAGGGGCCGG + Intronic
1094219059 12:27974209-27974231 GCCAGATGCCTGCCCTTGGCTGG + Intergenic
1095465488 12:42483959-42483981 GCCGGGAGCCCGCCTGGGGCCGG + Intronic
1096079525 12:48824329-48824351 GCCGGATGCTCTCCAGGCGCTGG - Exonic
1096794063 12:54062969-54062991 GCAGGATCCCAGGCAGTGGCTGG - Intergenic
1103795793 12:123502298-123502320 GACGTCTGCCCGGCAGTGGCCGG - Intronic
1118039733 14:61903822-61903844 GCTAGCTGCCAGCCAGTGGCAGG + Intergenic
1125647440 15:41284200-41284222 GCCGGCTGCCCGCAACTCGCAGG - Intergenic
1126739082 15:51759880-51759902 GCCTGAGGCCAGCCAGGGGCAGG + Intronic
1128737689 15:70062533-70062555 GCCGCCTGCCAGCCAGAGGCGGG - Intronic
1131405867 15:92163877-92163899 GGTGGATGCCCGCCACTGGGAGG - Exonic
1132466181 16:78305-78327 GCCGGATGCCCGCGCGCAGCGGG + Exonic
1132577562 16:671006-671028 GCCGGGTGCCCGCCTGTGCCTGG + Intronic
1136366649 16:29812121-29812143 GCCGGAGGCTCGCGAGGGGCGGG + Intronic
1137531909 16:49283209-49283231 GCCGGATCCCAGTCAGAGGCCGG + Intergenic
1139643645 16:68311294-68311316 GCCGGGTGCCTGCCACTCGCGGG + Exonic
1142761041 17:2042074-2042096 GCCGGAAGCCCGCCAGGCACAGG - Exonic
1143101861 17:4508974-4508996 GCCGGCTGGCCGGCAGGGGCTGG + Intronic
1143830232 17:9645455-9645477 GCCGGATTCCCGCGCGGGGCGGG + Intronic
1145012694 17:19378706-19378728 GCCGGGGGCCCGCCAGGGTCGGG - Intronic
1147164147 17:38584522-38584544 GGCGGGCGCCCCCCAGTGGCCGG + Intronic
1151819423 17:76489680-76489702 GCCGGAAGCCCTCCCGGGGCCGG + Intronic
1152579045 17:81157941-81157963 GCTGGATGCCCGGCTGTGTCAGG - Intronic
1161078895 19:2300698-2300720 GACGGAGGCCTGGCAGTGGCGGG - Intronic
1165328313 19:35126701-35126723 GCTGGCTGCCCGCCTGTGGGGGG - Exonic
925217429 2:2109402-2109424 GCCGGATGGGCGCCAGAGGTAGG + Intronic
927298052 2:21477549-21477571 GCCTCATGCCCCCAAGTGGCAGG - Intergenic
927467351 2:23347499-23347521 CCCGGCAGCCCGCCAATGGCCGG + Intergenic
927645105 2:24872608-24872630 CCTGGAGGCCCGCCAGTCGCTGG - Exonic
932467522 2:71933198-71933220 GCAGGATGCCTGCTAGTTGCAGG - Intergenic
946066989 2:216996448-216996470 GCCTGAGGCCCACCAGGGGCAGG - Intergenic
948374944 2:237515303-237515325 GCCGAATGCTCGCCAGGTGCCGG + Intronic
1169218345 20:3806150-3806172 CCCAGAAGCCCGCCAATGGCGGG + Intergenic
1171235284 20:23519463-23519485 GCTGGAAGCCCACCAGTGTCAGG + Intergenic
1171388498 20:24786309-24786331 GCCGGATGCCCACCAGCATCTGG - Intergenic
1179984041 21:44911498-44911520 GCTGGATGCCCGCGGGTGCCAGG + Intronic
1181984374 22:26789404-26789426 GGCGGCTGCCTGCCAGTGTCTGG - Intergenic
1183186981 22:36297712-36297734 GCCGCATGCCCGCCAGCTGCAGG - Intronic
1184495244 22:44837324-44837346 CCCCGATGCCCTCCAGTGGGTGG + Intronic
961084679 3:124056685-124056707 GACAGATACCAGCCAGTGGCAGG - Intergenic
961680644 3:128597771-128597793 GCCGGATGCCCAGCAGGGGGTGG + Intergenic
966617693 3:181929722-181929744 GCAGGATGCCAGCCAGTGACAGG - Intergenic
967808391 3:193734860-193734882 CCCGGAAGCCAGCCAGTGCCAGG + Intergenic
968288632 3:197522549-197522571 GCAGGATGCCAGCCAGTGGAAGG + Intronic
968505651 4:970178-970200 GCCGGATGCCCGCCAGTGGCAGG + Intronic
968739919 4:2322265-2322287 GCCGGATTCCTGCAAGTGCCAGG - Intronic
982292159 4:153791069-153791091 GCCGCACGCCCGGAAGTGGCTGG + Intergenic
983253346 4:165369785-165369807 GCAGGATGTTTGCCAGTGGCTGG - Intronic
985652639 5:1114007-1114029 GCCGGCTGCCCGCCATGTGCTGG + Intergenic
986335648 5:6753443-6753465 GCCTGATCCCCGCCTGGGGCAGG + Intronic
986787950 5:11132276-11132298 GCCGGATACCCGCAGGTGGTAGG - Intronic
995047675 5:107670156-107670178 ACCGGATGCCAGCCAGATGCCGG + Intronic
1005945138 6:30589898-30589920 CCAGGATGCCCGCAAGTGCCTGG + Exonic
1006933478 6:37701389-37701411 GCCGGAGGCGAGCTAGTGGCAGG - Intergenic
1011655464 6:89547488-89547510 GCAGGCTGCCCCCCAGAGGCAGG - Intronic
1019354580 7:571951-571973 GCCGGGTGTCCGCCGGAGGCAGG + Intronic
1023909191 7:44541605-44541627 GCCGGGTCCCAGCCAGTGCCTGG - Intergenic
1023930094 7:44700259-44700281 TCCGGAAGCCGGTCAGTGGCAGG + Exonic
1024675079 7:51631042-51631064 GCGGGATGCACCGCAGTGGCAGG - Intergenic
1038013411 8:23493282-23493304 GCCCGACGGACGCCAGTGGCAGG + Intergenic
1056693626 9:88828157-88828179 GTGGGAGGCCTGCCAGTGGCCGG + Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1060266023 9:122111885-122111907 GCTGGCTGCCCGCCATGGGCAGG + Intergenic
1062084266 9:134640913-134640935 GCAGGAGGCCCGCCAGTCTCTGG - Intergenic
1062529144 9:136992321-136992343 GCCGGGTGCAGGCCAGTCGCGGG - Intergenic
1190390398 X:49925392-49925414 GCTGGCTGCCTGCCATTGGCTGG - Intronic
1195954882 X:110318157-110318179 GCCGGGGGCGCGCCAGAGGCTGG + Exonic
1200051013 X:153431729-153431751 TCAGGATGCCGGCCAGTGGGAGG - Intergenic