ID: 968505822

View in Genome Browser
Species Human (GRCh38)
Location 4:971108-971130
Sequence GGGTAGGACAGCCATTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 10, 3: 38, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968505822_968505831 -2 Left 968505822 4:971108-971130 CCTACCCAATGGCTGTCCTACCC 0: 1
1: 0
2: 10
3: 38
4: 129
Right 968505831 4:971129-971151 CCAGGAAGTTAGAGGCCCCAGGG 0: 1
1: 0
2: 2
3: 20
4: 204
968505822_968505829 -3 Left 968505822 4:971108-971130 CCTACCCAATGGCTGTCCTACCC 0: 1
1: 0
2: 10
3: 38
4: 129
Right 968505829 4:971128-971150 CCCAGGAAGTTAGAGGCCCCAGG 0: 1
1: 0
2: 4
3: 18
4: 235
968505822_968505826 -10 Left 968505822 4:971108-971130 CCTACCCAATGGCTGTCCTACCC 0: 1
1: 0
2: 10
3: 38
4: 129
Right 968505826 4:971121-971143 TGTCCTACCCAGGAAGTTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968505822 Original CRISPR GGGTAGGACAGCCATTGGGT AGG (reversed) Intronic
900120683 1:1047478-1047500 GGGGAGGAAGGCCAGTGGGTAGG - Intronic
901303436 1:8215946-8215968 GGGCAGAAAGGCCATTGGGTTGG + Intergenic
902556700 1:17250960-17250982 CGGTGGGACAGCCACAGGGTGGG + Intronic
904450949 1:30611118-30611140 GGGTAGAGCAGGCATTGAGTTGG - Intergenic
905319316 1:37104715-37104737 AGGTAGGACAGCTATAGGCTTGG + Intergenic
906962188 1:50425503-50425525 GGGTAGGTGAGCCATGGGGTCGG + Intergenic
907459761 1:54598468-54598490 GGGCAGAACTGCCACTGGGTTGG + Intronic
907996673 1:59639803-59639825 GGGTATGACAGACATTGGCTAGG - Intronic
915025116 1:152820667-152820689 GAGAAGGACAGACATTAGGTGGG - Intergenic
919990181 1:202704049-202704071 GGGGAGGACAGCAGCTGGGTGGG - Intronic
923497859 1:234540630-234540652 GGTTGGTACAGCCATCGGGTTGG + Intergenic
923785326 1:237061825-237061847 TGGGAGAACAGCCTTTGGGTAGG - Intronic
924225711 1:241919974-241919996 GGGTGGGTCAGCCATGGGGAAGG + Intergenic
924477756 1:244396174-244396196 AGGTAGGGGAGCCTTTGGGTAGG - Intergenic
1062858728 10:793657-793679 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858736 10:793705-793727 GGGTAGGACTGACATTGCGTAGG - Intergenic
1062858742 10:793737-793759 GGGTAGGACCGACATTGCGTAGG - Intergenic
1062858744 10:793753-793775 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858752 10:793801-793823 GGGTAGGACTGACATTGCGTAGG - Intergenic
1062858754 10:793817-793839 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858758 10:793833-793855 GGGTAGGACCGACATTGCGTAGG - Intergenic
1062858760 10:793849-793871 GGGTAGGACCGACATTGGGTAGG - Intergenic
1062858764 10:793865-793887 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858768 10:793881-793903 GGGTAGGACCGACATTGCGTAGG - Intergenic
1062858770 10:793897-793919 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858779 10:793945-793967 GGGTAGGACCGACATTGCGTAGG - Intergenic
1062858781 10:793961-793983 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858789 10:794009-794031 GGGTAGGACTGACATTGCGTAGG - Intergenic
1062858795 10:794041-794063 GGGTAGGACCGACATTGCGTAGG - Intergenic
1062858797 10:794057-794079 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858805 10:794105-794127 GGGTAGGACTGACATTGCGTAGG - Intergenic
1062858807 10:794121-794143 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858811 10:794137-794159 GGGTAGGACCGACATTGCGTAGG - Intergenic
1062858813 10:794153-794175 GGGTAGGACCGACATTGGGTAGG - Intergenic
1062858817 10:794169-794191 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858821 10:794185-794207 GGGTAGGACCGACATTGCGTAGG - Intergenic
1062858823 10:794201-794223 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858827 10:794217-794239 GCGTAGGACCGACATTGCGTAGG - Intergenic
1062858829 10:794233-794255 GGGTAGGACCGACATTGCGTAGG - Intergenic
1062858831 10:794249-794271 GCGTAGGACCGACATTGGGTAGG - Intergenic
1062858834 10:794265-794287 GGGTAGGACTGACATTGCGTAGG - Intergenic
1062858836 10:794281-794303 GGGTAGGACCGACATTGGGTAGG - Intergenic
1062858839 10:794297-794319 GGGTAGGACTGATATTGGGTAGG - Intergenic
1063451893 10:6155551-6155573 AGGAAGGACAGACATTTGGTTGG - Intronic
1069960760 10:72077805-72077827 GGGCAGGACAGTCTTTGGGTTGG - Intronic
1071283739 10:84125575-84125597 AGGTAAGAAAGCCATGGGGTGGG - Intergenic
1076578521 10:131490479-131490501 GGGTAGGAGAGAGATTGGGGTGG + Intergenic
1077501239 11:2910627-2910649 CGGTAGGACAGCCATTGTGCCGG + Intronic
1081570930 11:44290322-44290344 GGGTAGGACAGGCCTGGGCTTGG + Intronic
1082232872 11:49790415-49790437 CGGAAGTACAGCCAGTGGGTAGG + Intergenic
1082777511 11:57258735-57258757 GGGAATGACAGACACTGGGTGGG + Intergenic
1083759219 11:64806661-64806683 GGGGAGGAGGGCCATTGGGCTGG - Intronic
1084145154 11:67261389-67261411 GGGTAGGAAAGACTTGGGGTAGG - Intergenic
1086067089 11:82757098-82757120 GGGAAGGAAAGACAGTGGGTGGG - Intergenic
1086617756 11:88843502-88843524 CGGAAGTACAGCCAGTGGGTAGG - Intronic
1088575357 11:111266350-111266372 GGGTAGGGGTGCCAGTGGGTGGG - Intronic
1089749398 11:120639737-120639759 GTCTGGGACATCCATTGGGTGGG - Intronic
1091450456 12:569439-569461 GGGTGGCACAGCCATGGGGCAGG - Intronic
1091643037 12:2252059-2252081 TGGTAGGACAGACATGGAGTGGG - Intronic
1092719611 12:11428542-11428564 TGTGAGGACAGCCACTGGGTGGG + Intronic
1094496521 12:30992505-30992527 GGGTAGGGCAGCCACAGGCTGGG + Exonic
1099292560 12:80789660-80789682 GACTAGGAAAGACATTGGGTAGG + Intergenic
1106844234 13:33720410-33720432 GGTTAGGACATCTTTTGGGTGGG + Intergenic
1111503846 13:89160613-89160635 GGGTTGGACAGGCAGTTGGTGGG + Intergenic
1113473540 13:110563344-110563366 AAGTAGGACAGCCAGTGGCTGGG + Intergenic
1119665596 14:76482819-76482841 CAGAAGCACAGCCATTGGGTAGG - Intronic
1119772233 14:77227402-77227424 GGGTAGTAATGCCATTAGGTGGG + Intronic
1121246130 14:92462085-92462107 GAGTCACACAGCCATTGGGTAGG + Intronic
1121580133 14:95023941-95023963 GGGGTTGACAGCCATTGAGTGGG + Intergenic
1122882634 14:104696959-104696981 GGGTAGGGCAGGCACTGGCTGGG - Intronic
1128087123 15:64894134-64894156 GGCTCGGCCAGCCATTGGGCTGG + Intronic
1128223168 15:65982758-65982780 GCTTAGGGCAGCCATTTGGTTGG - Intronic
1129384143 15:75186241-75186263 GGGTTGGACAGGCAATGGGGAGG + Intergenic
1139544522 16:67644057-67644079 GGGTCAGACAGTCATAGGGTGGG - Intergenic
1139912323 16:70405695-70405717 GGGAATGACTGCCAGTGGGTTGG + Intronic
1140560799 16:75978684-75978706 GGGAAGAACAGACACTGGGTGGG - Intergenic
1141594429 16:85088683-85088705 AGGCAGGACAGCCATGAGGTGGG + Exonic
1144705317 17:17364044-17364066 GGGTAGGGCAGCCGCTTGGTTGG + Intergenic
1145004152 17:19327834-19327856 GGGTAGGAATGTCATTGGGGAGG + Intronic
1146807931 17:35880147-35880169 GTGTGGGACAGTCATTGGGATGG + Intronic
1147316875 17:39625271-39625293 GGCCCGGACAGCCACTGGGTGGG - Intergenic
1147559029 17:41497706-41497728 GGGTAGGAGAGGCAGTGGGTGGG - Intergenic
1147591931 17:41689264-41689286 CGGTAGGTCAGCCCTTGGGCGGG + Intronic
1151174707 17:72277747-72277769 GGCCAGGACAGCCACTGGGAAGG + Intergenic
1151661013 17:75517986-75518008 GGATAGGACTGCCAATGGATTGG + Intronic
1163717188 19:18879435-18879457 GGATAGGACAGGGACTGGGTAGG - Intronic
1166599321 19:44080246-44080268 GTGTGGGACAGCCATGGAGTGGG - Intronic
1167439596 19:49500621-49500643 GGGGACGACAGGCATGGGGTGGG + Intergenic
1167444404 19:49528713-49528735 GGGTAAGAGAGACATTCGGTTGG + Exonic
1167805292 19:51779014-51779036 TGGTAACACAGCCATTGGGAGGG + Intronic
1168469858 19:56631041-56631063 GGTTAGGACATCAATTTGGTGGG - Intergenic
929592696 2:43157592-43157614 GGGAAGGACAGGCGTGGGGTGGG - Intergenic
934992385 2:98930580-98930602 GGGTGGGACAGAGATGGGGTAGG - Intronic
937151646 2:119690466-119690488 GGGTAGGAGAGGTATGGGGTAGG - Intergenic
937506218 2:122540285-122540307 GGGTATGAGAGGAATTGGGTGGG + Intergenic
937890853 2:126937427-126937449 AGGTAGCACAGCCTTTGGGAAGG - Intergenic
939737249 2:145862956-145862978 TGGTATTAAAGCCATTGGGTTGG - Intergenic
942786472 2:179707636-179707658 TGGTAGGACAGCCAGTGTCTTGG + Intronic
944034875 2:195282510-195282532 GGATTGGACAGCCATTTGCTGGG - Intergenic
948844569 2:240676929-240676951 GGGTATGCCAGCCATGGGGACGG + Intronic
948849291 2:240697950-240697972 GGGTATGCCAGCCATGGGGACGG - Intronic
1173662451 20:44744074-44744096 GAGTCGGACAGGCACTGGGTTGG + Intergenic
1175545729 20:59776524-59776546 GGGGAGGACAGCCCCTGGGGAGG + Intronic
1176195670 20:63835529-63835551 GGGTGGGGCAGCCGTGGGGTTGG - Intergenic
1176388687 21:6152305-6152327 GGCCAGGACAGCCTGTGGGTGGG + Intergenic
1179586748 21:42378206-42378228 GGGCAGCACTGCCAGTGGGTGGG + Intronic
1179734785 21:43385943-43385965 GGCCAGGACAGCCTGTGGGTGGG - Intergenic
1180869610 22:19138788-19138810 GGGTGGGACAGGCCCTGGGTTGG - Intronic
1183089180 22:35509690-35509712 GGGTGGGACAGCCACTGCGAGGG - Intergenic
1183633347 22:39046477-39046499 GGGTGGGGAAGCCATGGGGTGGG - Intronic
1184885523 22:47342811-47342833 GGGTGGGACAGGGATTGGGTAGG - Intergenic
1184885536 22:47342843-47342865 GGGTAGGACAGGGATTGGGTAGG - Intergenic
1184885541 22:47342859-47342881 GGGTAGGACAGGGATTGGGTAGG - Intergenic
1184885546 22:47342875-47342897 GGGTAGGGCATAGATTGGGTAGG - Intergenic
1184885550 22:47342891-47342913 GAGTAGGGCAGGAATTGGGTAGG - Intergenic
1184885570 22:47342984-47343006 GGGTAGGACAGGGATTGGGTAGG - Intergenic
1184885575 22:47343000-47343022 GGGTAGGGCATAGATTGGGTAGG - Intergenic
1184885579 22:47343016-47343038 GGGTAGGGCATAGATTGGGTAGG - Intergenic
1184885583 22:47343032-47343054 GGGTAGGACAGGGATTGGGTAGG - Intergenic
1184885588 22:47343048-47343070 GGGTAGGACAGGGATTGGGTAGG - Intergenic
1184885603 22:47343111-47343133 GGGTAGGACAGGGATTGGGTAGG - Intergenic
1184885618 22:47343174-47343196 GGGTAGGACAGGGATTGGGTAGG - Intergenic
1184885623 22:47343190-47343212 GGGTAGGGCATAGATTGGGTAGG - Intergenic
1184885627 22:47343206-47343228 GGGTAGGATAGGGATTGGGTAGG - Intergenic
1184885641 22:47343253-47343275 GGGTAGGGCATAGATTGGGTAGG - Intergenic
1184885675 22:47343365-47343387 GGGTAGGGCAGGGATTGGGTAGG - Intergenic
1184885681 22:47343381-47343403 GGGTAGGGCAGGGATCGGGTAGG - Intergenic
1184885687 22:47343397-47343419 GAGTAGGGCAGGGATTGGGTAGG - Intergenic
1184885728 22:47343556-47343578 GAGTAGGGCAGAGATTGGGTAGG - Intergenic
1184885752 22:47343654-47343676 GGGTAGGGTAGGGATTGGGTAGG - Intergenic
1184885760 22:47343675-47343697 GGGTAGGGCAGGGACTGGGTTGG - Intergenic
951690236 3:25387398-25387420 GGGTAGGAAACACATTGGCTAGG + Intronic
951712996 3:25603975-25603997 GGGTAGGTCACCCAGTGTGTTGG + Intronic
952443490 3:33357406-33357428 GGGCAGGAGAGCCTTTGTGTTGG + Intronic
953750431 3:45604515-45604537 GGGAAGGACAGCCAGTGCGATGG + Intronic
955395734 3:58555877-58555899 AGGTGGGCCAGCCATTGGGGAGG + Intergenic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
962482731 3:135811554-135811576 GGGAAGGAGAGCCATTGAGATGG - Intergenic
966750188 3:183314492-183314514 GAATAGGAGAGCCATTGAGTTGG - Intronic
968505822 4:971108-971130 GGGTAGGACAGCCATTGGGTAGG - Intronic
971801397 4:31296803-31296825 GGGAATGGCAGCCAATGGGTAGG - Intergenic
976208053 4:82640547-82640569 GGGTAGGATAGCCAGTGAGATGG + Intronic
980508432 4:133754544-133754566 TGGTGGGACAGGCATAGGGTGGG + Intergenic
982693131 4:158570682-158570704 GGGATGGAGTGCCATTGGGTAGG - Intronic
985057929 4:186051291-186051313 GGGGAGGACACCCGGTGGGTGGG - Intergenic
985668319 5:1193209-1193231 GGGAAGGACAGGCTTTGAGTCGG + Intergenic
994534650 5:101013513-101013535 GAATAGGAGATCCATTGGGTTGG + Intergenic
997197582 5:131990104-131990126 TGGTAGGACAGCCACTGGTAAGG + Exonic
997642230 5:135456736-135456758 GGCTAGGACAGCCTCTGGTTGGG + Intergenic
998171646 5:139875643-139875665 GGGTGAGCCAGCCATTGGCTTGG - Intronic
998859122 5:146425694-146425716 GGGTGAGAAAGCCATTTGGTAGG + Intergenic
999546389 5:152633144-152633166 GGGTAGCACAGCCATTAGGAGGG + Intergenic
1000072692 5:157755423-157755445 GGGGAGGACAGGCCTTGGGAGGG + Exonic
1001117421 5:168951410-168951432 GGCAAGGACAGCCACTGGGTGGG + Intronic
1002521272 5:179794339-179794361 TGGTAGGATAGCCATGGGCTTGG + Intronic
1005718953 6:28581879-28581901 GGGTAGAATAGACACTGGGTTGG + Intronic
1005753433 6:28904328-28904350 GGGTAGGGCAGTCATTGGGGAGG + Exonic
1008159508 6:48060198-48060220 GGGTAAGACAGACATCGTGTGGG - Intronic
1009383280 6:63058706-63058728 GGGGAGGATGGCAATTGGGTAGG - Intergenic
1010180707 6:73084029-73084051 GGGGATGACAGGGATTGGGTGGG - Intronic
1014569851 6:122996107-122996129 GGGTAGGACGGCAATTTGGGTGG - Exonic
1019620059 7:1987550-1987572 GGGAAGGAAAGCCATCGGGGAGG + Intronic
1024117204 7:46205729-46205751 GGGAAGGCCTGCCCTTGGGTGGG - Intergenic
1033664389 7:143426857-143426879 TGGTAAGACAGCCCTTTGGTGGG + Intergenic
1039500733 8:38014756-38014778 GGGTAAGACATACATTGGTTTGG + Intergenic
1041993965 8:64030023-64030045 GGCTAGGACACCCACTGGGTTGG - Intergenic
1045522233 8:102913551-102913573 GGGGAGGAAAGCCTTTGTGTGGG + Intronic
1045760304 8:105598227-105598249 GGGAAGGACCGCCTTTGGGAAGG + Intronic
1046089154 8:109478479-109478501 GGCAGGGACAGCCTTTGGGTGGG + Intronic
1051367848 9:16333884-16333906 GGGGAAGACAGTCATTGAGTGGG - Intergenic
1051507542 9:17843050-17843072 GGCTAGGACAGCCACTGGGAAGG - Intergenic
1058100678 9:100915212-100915234 TGGTAGGACAGCCAGTGTCTTGG + Intergenic
1060046873 9:120348482-120348504 GGTTAGGAGAGCCATTTGGGGGG + Intergenic
1060603904 9:124897207-124897229 GGCAAGGACAGCCAATGGGGAGG - Intronic
1187427710 X:19193371-19193393 TGATAGGAGAGTCATTGGGTAGG - Intergenic
1190106320 X:47563350-47563372 AGGTGGGACACCCAGTGGGTGGG - Intronic
1190790445 X:53695096-53695118 GTGAAGGATGGCCATTGGGTAGG + Intergenic
1197706182 X:129636254-129636276 GGGGAGGACAGCAGTTGGGAAGG + Intergenic