ID: 968506074

View in Genome Browser
Species Human (GRCh38)
Location 4:972078-972100
Sequence CCCACGCTTGGGTCTCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968506058_968506074 23 Left 968506058 4:972032-972054 CCAGGTCCCTCCTCTGCCATGGA 0: 1
1: 0
2: 4
3: 48
4: 568
Right 968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 193
968506064_968506074 7 Left 968506064 4:972048-972070 CCATGGAGACAGGGCCTGCTCAC No data
Right 968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 193
968506059_968506074 17 Left 968506059 4:972038-972060 CCCTCCTCTGCCATGGAGACAGG 0: 1
1: 0
2: 2
3: 34
4: 388
Right 968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 193
968506065_968506074 -7 Left 968506065 4:972062-972084 CCTGCTCACCCCACGCCCCACGC No data
Right 968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 193
968506056_968506074 24 Left 968506056 4:972031-972053 CCCAGGTCCCTCCTCTGCCATGG 0: 1
1: 0
2: 2
3: 46
4: 398
Right 968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 193
968506061_968506074 16 Left 968506061 4:972039-972061 CCTCCTCTGCCATGGAGACAGGG 0: 1
1: 0
2: 2
3: 28
4: 291
Right 968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 193
968506063_968506074 13 Left 968506063 4:972042-972064 CCTCTGCCATGGAGACAGGGCCT No data
Right 968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968506074 Original CRISPR CCCACGCTTGGGTCTCCTGG CGG Intronic