ID: 968506518

View in Genome Browser
Species Human (GRCh38)
Location 4:973573-973595
Sequence CCGCGCCTGCGCAGTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 201}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968506518_968506529 -9 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506529 4:973587-973609 CAGGCGCGGGCCGCGGGGCGGGG 0: 1
1: 1
2: 18
3: 135
4: 918
968506518_968506542 25 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506542 4:973621-973643 TGGTGGGCGGATCTGGGGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 420
968506518_968506544 29 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506544 4:973625-973647 GGGCGGATCTGGGGGCTGGCGGG 0: 1
1: 0
2: 1
3: 28
4: 395
968506518_968506536 9 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506536 4:973605-973627 CGGGGCGGGGCGCTGCTGGTGGG 0: 1
1: 0
2: 3
3: 47
4: 515
968506518_968506531 -5 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506531 4:973591-973613 CGCGGGCCGCGGGGCGGGGCGGG 0: 1
1: 3
2: 43
3: 282
4: 1641
968506518_968506543 28 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506543 4:973624-973646 TGGGCGGATCTGGGGGCTGGCGG 0: 1
1: 0
2: 1
3: 33
4: 514
968506518_968506528 -10 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506528 4:973586-973608 GCAGGCGCGGGCCGCGGGGCGGG 0: 1
1: 3
2: 8
3: 138
4: 931
968506518_968506540 20 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506540 4:973616-973638 GCTGCTGGTGGGCGGATCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 227
968506518_968506538 18 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506538 4:973614-973636 GCGCTGCTGGTGGGCGGATCTGG 0: 1
1: 0
2: 0
3: 6
4: 98
968506518_968506534 5 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506534 4:973601-973623 GGGGCGGGGCGGGGCGCTGCTGG 0: 1
1: 9
2: 215
3: 599
4: 2367
968506518_968506537 12 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506537 4:973608-973630 GGCGGGGCGCTGCTGGTGGGCGG 0: 1
1: 0
2: 6
3: 64
4: 566
968506518_968506535 8 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506535 4:973604-973626 GCGGGGCGGGGCGCTGCTGGTGG 0: 1
1: 0
2: 11
3: 147
4: 927
968506518_968506539 19 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506539 4:973615-973637 CGCTGCTGGTGGGCGGATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 103
968506518_968506541 21 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506541 4:973617-973639 CTGCTGGTGGGCGGATCTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 262
968506518_968506532 -4 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506532 4:973592-973614 GCGGGCCGCGGGGCGGGGCGGGG 0: 1
1: 10
2: 71
3: 497
4: 2443
968506518_968506530 -6 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506530 4:973590-973612 GCGCGGGCCGCGGGGCGGGGCGG 0: 1
1: 5
2: 43
3: 274
4: 1678
968506518_968506545 30 Left 968506518 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG 0: 1
1: 0
2: 5
3: 22
4: 201
Right 968506545 4:973626-973648 GGCGGATCTGGGGGCTGGCGGGG 0: 1
1: 0
2: 3
3: 49
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968506518 Original CRISPR CCGCGCCTGCGCAGTGGGGC AGG (reversed) Intronic
900396118 1:2453896-2453918 CTGCGCCTGCCGAGTGGGGTGGG + Intronic
900637918 1:3674898-3674920 CCCCGCCTGGGCAGAGGGGTCGG - Intronic
900671447 1:3857255-3857277 CCGCGCCTGCGCACAAGGGGAGG + Intronic
900953183 1:5870809-5870831 CAGGGCGTGCCCAGTGGGGCTGG - Intronic
901410395 1:9079017-9079039 CCGCGCGTGGGCACTGGGGTTGG - Intronic
901766214 1:11501700-11501722 CCGCGACTGCCGCGTGGGGCGGG - Exonic
901837619 1:11934620-11934642 CCGCGCCTGCCTAGTGGGGAAGG - Intronic
902616922 1:17628872-17628894 CCATGCCTGTGAAGTGGGGCAGG + Intronic
902717012 1:18279917-18279939 CAGCGCCTGCTAAGTGGGGTGGG + Intronic
903812041 1:26039956-26039978 CCACGCCTGCCCATTGGTGCAGG + Intronic
905027219 1:34859231-34859253 CCGGGCCCTCGCACTGGGGCAGG - Intronic
906044517 1:42817384-42817406 CCGCGCGTGCGCAGAGAGGATGG + Intronic
907423714 1:54365024-54365046 CCAGGCCTGCACAGAGGGGCAGG + Intronic
910892176 1:92029872-92029894 CCGGGCCTGCGGGGTGCGGCGGG - Intergenic
911219712 1:95234109-95234131 CCGCGCCTCCGCAACCGGGCGGG - Intronic
911498797 1:98661597-98661619 CCGCGTCTGCGCAGCGGGCGAGG + Intergenic
912955668 1:114153023-114153045 CCGCGTCTCCGCTGGGGGGCGGG - Intronic
917141633 1:171841457-171841479 GCGCGCCTGCGCGGGCGGGCAGG - Intergenic
922796324 1:228341478-228341500 CCGCGCCTTCGAGGTGTGGCAGG + Exonic
923008069 1:230067575-230067597 CCCGGCGTGCGCAGAGGGGCCGG - Intronic
923592181 1:235328558-235328580 CGACGCCTGCGCAGTGTGACCGG + Exonic
1065712608 10:28532670-28532692 CCGCCCCTGCGCTGTCGGGCGGG - Intronic
1066094141 10:32056446-32056468 CTGCGCAGGCGCAGTGGGCCAGG + Intergenic
1067793883 10:49307025-49307047 CCCCTCCTGGGCAGTGGAGCAGG + Intronic
1069902358 10:71713451-71713473 CTGGGCCTGCCCACTGGGGCAGG + Exonic
1071857984 10:89645095-89645117 CCAGGCCGGCGCCGTGGGGCCGG - Exonic
1072239520 10:93482396-93482418 CCGCGTCTACGCAGTGCCGCAGG + Intergenic
1072871306 10:99124094-99124116 CTGCGCCTGGGCACTGAGGCAGG + Intronic
1073208254 10:101779980-101780002 CCGGGCGGGCGCCGTGGGGCCGG - Intronic
1074116806 10:110462351-110462373 CTGCAGCTGTGCAGTGGGGCAGG - Intergenic
1074864179 10:117535386-117535408 CAGCGCCTGCGCGGGCGGGCGGG - Intergenic
1076117070 10:127907820-127907842 CCGCGCCTTCCCAGGGAGGCAGG + Intronic
1077116148 11:885501-885523 CCGTGCCTGAGCGGTGGGGCTGG - Intronic
1077491335 11:2862342-2862364 CCGCGACTGGGCAGGGGGCCGGG - Intergenic
1079459778 11:20669511-20669533 CCGCGCCAGCGGTGGGGGGCGGG + Intergenic
1083389456 11:62337421-62337443 CTGCGCCTGCGCACGAGGGCGGG - Intergenic
1083674519 11:64318087-64318109 TCGCGCCTGCGCAGTGGAGGCGG + Exonic
1083845954 11:65333782-65333804 CGGCGCCTGCGCAGAGGGCAAGG + Exonic
1083945073 11:65919109-65919131 CAGCGGCCGCGCTGTGGGGCGGG + Exonic
1083965792 11:66042948-66042970 CCGCGCCAGCGCCGCGGGGATGG + Exonic
1084183014 11:67455901-67455923 CTGAGCCTGGGCTGTGGGGCAGG + Intronic
1084418543 11:69048922-69048944 CCGCGCCTGCGCAGTGAAGCTGG + Exonic
1084958275 11:72703012-72703034 GCGCTCCTGGGCTGTGGGGCTGG - Exonic
1086496043 11:87405485-87405507 CAGTGGCTGAGCAGTGGGGCTGG + Intergenic
1091558819 12:1594852-1594874 CCGCGCCCGCGCAATGGTACGGG + Intronic
1092173290 12:6386272-6386294 CCCCGCCTGCCCAGTGGAGTCGG + Intronic
1092247940 12:6873596-6873618 CCGGGCCTTCGCCGTGGGGGCGG - Intronic
1094841979 12:34346009-34346031 CCGCGCATGCGCGGTAGGGGCGG + Intergenic
1094847078 12:34366013-34366035 CCGTGCATGCGCGGTGGGGACGG + Intergenic
1100528908 12:95446615-95446637 CCGCGCCTTGGCAGTGGGAGGGG - Intergenic
1102339207 12:112108594-112108616 CCGGGCAGGCGCAGGGGGGCGGG - Intronic
1102498244 12:113334116-113334138 CCGCGGGTTAGCAGTGGGGCCGG + Intronic
1103330669 12:120151649-120151671 CTAGGCCTGGGCAGTGGGGCAGG + Intronic
1103595369 12:122021874-122021896 CGGCGCTTGCGCACTGGGCCAGG + Exonic
1105571204 13:21604245-21604267 CCGGGCCTGCGCCGTGGGTGCGG + Intergenic
1113706239 13:112434560-112434582 CCTCTCCTGCGCAGGGGGTCTGG - Exonic
1113775585 13:112943339-112943361 CCGCGCCTGGGCTCTGCGGCCGG - Intronic
1113861570 13:113490699-113490721 CCGCGCCTGCGCAGAAGGCCGGG - Exonic
1119640736 14:76312942-76312964 CTGGGCCTGCACAGTGGGCCAGG - Intronic
1122486804 14:102087295-102087317 CCGCGCAGGCGCATTGAGGCCGG - Intronic
1122889068 14:104724297-104724319 CGCCGCCTGCGCCGGGGGGCCGG - Intronic
1122891116 14:104732710-104732732 CCCCGCCTGGGCGGGGGGGCAGG - Intronic
1123719872 15:23050329-23050351 CCGCGCCTGGCCAGAGGTGCTGG + Intergenic
1124453835 15:29822482-29822504 CCGGGCATGCTCAGTGGGCCGGG - Exonic
1127353858 15:58179385-58179407 CTGCGCCTCACCAGTGGGGCGGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1131445272 15:92493703-92493725 CTCCGCCTGGGCTGTGGGGCAGG - Intronic
1132561250 16:595287-595309 CCTCGTCTGCACAGTGGGGGTGG - Intronic
1132658937 16:1053083-1053105 CCGAGCCTGGACAGTGGGGCAGG + Intergenic
1132749443 16:1450723-1450745 CCGAGACTGGGCAGCGGGGCAGG - Intronic
1132853257 16:2034147-2034169 CCGGGCCAGCACTGTGGGGCTGG + Intronic
1133102009 16:3485518-3485540 CGGTGCATGCGCAGGGGGGCAGG - Exonic
1133188483 16:4116472-4116494 CCGCGCGTGCGCGCTGCGGCTGG - Intergenic
1135321800 16:21502316-21502338 CCGTGCCTGCGGAGAGAGGCGGG + Intergenic
1136153755 16:28368481-28368503 CAGCACCTGCGCCGAGGGGCGGG + Intergenic
1136209337 16:28746789-28746811 CAGCACCTGCGCCGAGGGGCGGG - Intergenic
1136512611 16:30748526-30748548 CCGCGCAGGCGCATTCGGGCGGG - Intronic
1140121777 16:72089899-72089921 CAGCTCCTGAGCAGTAGGGCTGG + Intronic
1140504646 16:75463986-75464008 GAGCGCCTGCGCGGAGGGGCCGG + Intronic
1142338947 16:89508352-89508374 CGGCGCCTGCGCGGCGGGGTGGG - Intronic
1142738657 17:1917693-1917715 CAGGGCCTGCCCAGTGGGTCTGG - Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143155396 17:4833354-4833376 CCGCGCCTGCGCAGGAGAGGTGG + Intergenic
1144574167 17:16418463-16418485 CGGGGCCTGCCCAGTGAGGCTGG + Intronic
1144840639 17:18183804-18183826 CCGCGCACGCGCAGTGCTGCCGG - Intronic
1145992894 17:29089879-29089901 CCGCGCATGCTCAGCAGGGCTGG - Intronic
1146787332 17:35731740-35731762 CCCCGCCTGCCCAGTCGGGGCGG - Exonic
1147184251 17:38705190-38705212 CCGCGGCCGGGCAGGGGGGCCGG + Intergenic
1151670614 17:75569946-75569968 CAGCACCTGCGCAGGGTGGCAGG - Exonic
1152510798 17:80786108-80786130 CCGCTTCTGCACAGTGGGGTGGG + Intronic
1152518194 17:80838408-80838430 CAGCGCCCGTGCAGTGCGGCCGG - Intronic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1155153059 18:23136838-23136860 CCGCGCTTGTGCAGTGGGTCGGG + Intronic
1157749575 18:50166106-50166128 CCCCGCCTGCTCAATGGTGCTGG - Intronic
1160283636 18:77518164-77518186 CCGAGGCTGTGCAGTGGTGCAGG + Intergenic
1160691140 19:461103-461125 CCGCGGCTGCGCGCTGGGCCGGG - Intergenic
1160739652 19:680040-680062 CTGCGCCTGCGCTGGGGGGCGGG - Intronic
1160824918 19:1074988-1075010 CCGCGCATGCGCAGGAGGCCGGG - Intronic
1160904697 19:1446638-1446660 CCGCGTCGGCGCAGTGAGGAGGG - Intronic
1160937808 19:1605452-1605474 CCGCGCCTGCGCAGTGTAGCCGG - Exonic
1161063801 19:2227938-2227960 CCCCGCCTGCGCACCTGGGCCGG + Intronic
1161344579 19:3761682-3761704 CCGCGCATGCTCAATGGGCCAGG - Exonic
1163390287 19:17026663-17026685 CCGCGCCTGGGGAGGGGGCCGGG + Exonic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1163821539 19:19499131-19499153 CTGCCCCTGGGCAGTGGGGTGGG - Intronic
1166140230 19:40801364-40801386 CCGCCACTGCGCAGGGCGGCTGG + Exonic
1167236709 19:48320110-48320132 CCAAGCCTGGGCAGTGGGGCAGG - Intronic
1167371498 19:49085392-49085414 CGGCGCGTGCGCAGTGAGGACGG + Intergenic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
1167577726 19:50325771-50325793 CTGCGGCTGCGCACTGCGGCGGG - Intronic
1167959527 19:53095048-53095070 CGGGGCCTGGGCAGTGGGGAAGG - Intronic
1167959575 19:53095169-53095191 CGGGGCCTGGGCAGTGGGGAGGG - Intronic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
925959783 2:9003820-9003842 CCGCGCCTGTGCAGGGCGGTCGG - Intergenic
926172141 2:10559142-10559164 CAGCTGCTGCGCGGTGGGGCTGG + Intergenic
928097204 2:28412086-28412108 CAGCCCATGCGCAGTGGGGGTGG + Exonic
929218181 2:39437350-39437372 TCGCGGCTGCGCAGTCGGGCGGG - Intergenic
932235425 2:70116990-70117012 CCACCCTTGCACAGTGGGGCTGG + Intergenic
932790163 2:74648197-74648219 CCCAGCCTGCGAAGTGGTGCCGG + Intronic
933666632 2:84970565-84970587 CCGCGGCCTCTCAGTGGGGCTGG + Intergenic
934949929 2:98569357-98569379 CAGCGCCTGCACAGAGAGGCCGG - Intronic
936156036 2:110048069-110048091 CCTCACCTGGGAAGTGGGGCTGG - Intergenic
936188652 2:110323359-110323381 CCTCACCTGGGAAGTGGGGCTGG + Intergenic
938796126 2:134719208-134719230 CCGCGCCCGGGCCTTGGGGCGGG - Intergenic
943736160 2:191357367-191357389 TGGCGGCAGCGCAGTGGGGCGGG + Intronic
946161024 2:217836154-217836176 GCCCGCCTCCGCAGAGGGGCTGG + Exonic
948056550 2:235012936-235012958 CTGCGCCTAGGCTGTGGGGCTGG + Intronic
948575581 2:238947373-238947395 CCCTGCCTGCTCAGTGGAGCGGG + Intergenic
948575603 2:238947455-238947477 CCCTGCCTGCTCAGTGGAGCGGG + Intergenic
1168972494 20:1940194-1940216 CCGCGTCGGCACAATGGGGCAGG + Intronic
1169914970 20:10674731-10674753 CCGCGCCGGGGCAGAGGCGCGGG + Intergenic
1170889899 20:20368173-20368195 CCGCGCCCGGGCAATGGGCCGGG + Exonic
1171288726 20:23967096-23967118 TCGGGGCTGCACAGTGGGGCAGG - Intergenic
1171484310 20:25476491-25476513 CGGCGCGAGCGCAGCGGGGCTGG - Exonic
1172841014 20:37902912-37902934 CCCCGCCTCCGCACTCGGGCGGG + Intergenic
1174043129 20:47714130-47714152 CCGTGCCTGCGAAATGGCGCGGG - Intronic
1174374002 20:50113186-50113208 GCGCGCCTGCGCATCAGGGCCGG - Intronic
1175295765 20:57907799-57907821 CCTCAGCTGCCCAGTGGGGCTGG + Intergenic
1175344576 20:58263586-58263608 CCACCCCTGCTCAGTGGGGTTGG - Intergenic
1175856056 20:62121850-62121872 CGGCACCTGGGCACTGGGGCGGG + Intergenic
1176213689 20:63938612-63938634 CCGACCCTGAGCAGCGGGGCTGG - Intergenic
1176310232 21:5145448-5145470 CCGCGTCTGGGCTGTGGGGGAGG - Intronic
1178915101 21:36701545-36701567 CCGCGGCCGCGCGGTAGGGCCGG - Intronic
1179504007 21:41828105-41828127 CAGCTCCTGCGGGGTGGGGCAGG - Intronic
1181068901 22:20320454-20320476 CCGCGGCCGAGCAGTGGCGCTGG + Intergenic
1181574784 22:23786968-23786990 CAGCGCCTGCGCACTGAGGGCGG + Exonic
1183258186 22:36776519-36776541 CGGCGCCTGCGCAGTGGGCCAGG + Intergenic
1183445263 22:37849381-37849403 CCGCGCCTGCGTCCTGAGGCCGG - Exonic
1183912711 22:41091662-41091684 CCGGGCCTCCGGAGGGGGGCGGG - Intergenic
1184766938 22:46577057-46577079 CGGCGGCTGCGCAACGGGGCCGG + Intronic
954121980 3:48504770-48504792 CAGCGCTGGCGCAGTGGGCCAGG + Intronic
954256478 3:49411454-49411476 CCGCGACCGCGCAGTGTAGCCGG - Intronic
954437310 3:50503110-50503132 CCGCGCCAGGGCAGAGGCGCTGG - Intronic
961718942 3:128879422-128879444 CCGCGCAAGCGCAGTGGGGCCGG + Intergenic
961737312 3:129010363-129010385 CAGCCCCTGCCCAGTGGTGCTGG - Intronic
961827257 3:129605652-129605674 CGCCGCCGGCGCCGTGGGGCAGG + Exonic
962247207 3:133805785-133805807 CCGCGCCTGCGCAGAGTGCAGGG + Exonic
967141751 3:186567366-186567388 TCGCGCTTGCGCAGTGGGCACGG - Intronic
967171961 3:186828744-186828766 CCGCCCCTGCTCTGTGGTGCAGG - Intergenic
967870364 3:194224269-194224291 CAGAGCCGGGGCAGTGGGGCTGG - Intergenic
967924117 3:194633174-194633196 CCGCGCCCGCGCTCTGGGACTGG - Exonic
968427414 4:533047-533069 CGGGGCCTGCGCAGAGAGGCAGG + Intronic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968548789 4:1212195-1212217 CGGCGCCTGGGCAGAGGGCCCGG - Exonic
969357720 4:6640347-6640369 CCGCGCCTGGGAAGTGCGGGAGG + Exonic
970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG + Intergenic
975592262 4:76011744-76011766 CCCAGCCTGCTCAGAGGGGCGGG - Intronic
977231012 4:94451799-94451821 CCGCCCCTGCGCGGCGCGGCTGG + Intergenic
981300806 4:143184711-143184733 CCGCACCTGCGCGGCGGGGCGGG + Intergenic
982245262 4:153344683-153344705 CCGCGCTTGGGGAGAGGGGCGGG - Exonic
985345634 4:189001811-189001833 GAGTGCCTGCGGAGTGGGGCGGG - Intergenic
985659668 5:1150791-1150813 CAGAGCCTGCCCCGTGGGGCTGG + Intergenic
985849658 5:2379261-2379283 CCTCACCTGTGAAGTGGGGCAGG + Intergenic
987058441 5:14218608-14218630 GCGAGGCTGCGCAGTGGGGCTGG + Intronic
988577976 5:32444751-32444773 GCGCGCCTGCGCAGTGCGGTCGG - Exonic
996379045 5:122845523-122845545 CCCCGCGGGCGCAGCGGGGCGGG + Exonic
1002455575 5:179344248-179344270 CCTTCCCTTCGCAGTGGGGCGGG - Intronic
1003270081 6:4600820-4600842 CAGGGCTTGTGCAGTGGGGCAGG - Intergenic
1004253908 6:14045388-14045410 CCGCGCCTGGCCAGAGGTGCGGG + Intergenic
1007781506 6:44257321-44257343 CCGCGCCTCAGCACGGGGGCCGG - Intronic
1017073843 6:150600156-150600178 GCGCCCCTCCGCAGTGGGGACGG + Intronic
1017947531 6:159107848-159107870 GTGCACCTGCTCAGTGGGGCTGG + Intergenic
1017983450 6:159422389-159422411 CCGCGGCTGGGCAGTGGTGGAGG + Intergenic
1018702555 6:166438600-166438622 CCGCACAAGCTCAGTGGGGCTGG - Intronic
1019212950 6:170421400-170421422 CCGCGCGTGCGCTGTGAGCCGGG + Intergenic
1019212958 6:170421433-170421455 CCGCGCGTGCGCTGTGAGCCGGG + Intergenic
1019330515 7:458450-458472 CCGAGCCTGGACAGTGGGGACGG + Intergenic
1019330527 7:458485-458507 CCGAGCCTGGACAGTGGGGATGG + Intergenic
1019461329 7:1160422-1160444 CCGCGCAGGCGCAGCCGGGCGGG + Intronic
1020192309 7:6009515-6009537 CCGCGCGTGCGCACTGGGCGGGG - Intronic
1020560562 7:9726198-9726220 CCGCGCCTGGGGAGGGGGCCGGG - Intergenic
1024198406 7:47082456-47082478 CAGAGCTTGGGCAGTGGGGCCGG + Intergenic
1024965531 7:55019674-55019696 CCGATCCTGCGCAGCTGGGCGGG - Intronic
1024990986 7:55234422-55234444 ATGAGCCTGCGCAGTGGGTCAGG + Intronic
1026017414 7:66682197-66682219 CCGCGTCTGCGCCGTGGTCCAGG - Intronic
1026360451 7:69598088-69598110 CCGGGCCTGCGCACTGGGGGCGG - Intergenic
1026745098 7:73005537-73005559 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027031210 7:74890232-74890254 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027098642 7:75359543-75359565 CCGCGCGTGCGCAGTGGGCGGGG - Intergenic
1029399741 7:100336355-100336377 CCGCGCGTGCGCAGTGGGCGGGG - Intronic
1034421273 7:150992369-150992391 CCTCGCCTTCCCAGTGAGGCAGG - Intronic
1034551341 7:151822607-151822629 CCAAGCCTGGGCAGCGGGGCCGG - Intronic
1035169933 7:157011463-157011485 ACGTGCCTGCTCAGTGGAGCGGG + Intergenic
1035699122 8:1624734-1624756 CTGCACCTGGGCAGTGGGACGGG - Intronic
1035945267 8:3954816-3954838 GCGAGCATGCGCAGTGTGGCAGG + Intronic
1045535182 8:103021004-103021026 CTGCGGCTGCGCAGTGGCGCGGG + Intergenic
1048980981 8:139703354-139703376 ATGGCCCTGCGCAGTGGGGCGGG - Intergenic
1049220113 8:141425205-141425227 CCGGGCCTGCGCAGAGGGTTTGG + Intronic
1049370396 8:142261537-142261559 CAGCGCCTGTGCAGTGGGAGCGG - Intronic
1049376085 8:142289857-142289879 CCGGGCAGGCGCAGTGGGGCTGG + Intronic
1049605924 8:143529152-143529174 CCGGGCCTTCGAGGTGGGGCAGG + Intronic
1049991963 9:999182-999204 CCGGTCCTGCGCCGTGGGGTGGG - Intergenic
1055623540 9:78150093-78150115 CCTGCCCTGTGCAGTGGGGCGGG - Intergenic
1056643180 9:88388303-88388325 CTGCGCAGGCGCAGTGGGGCGGG - Intergenic
1057869751 9:98708820-98708842 CGGCGCCCGCGCAATGGCGCCGG + Exonic
1060931134 9:127490125-127490147 CACCGCCTGTGGAGTGGGGCTGG + Intronic
1061052129 9:128203270-128203292 CGGCGCCTGCGCACGGCGGCCGG + Intronic
1062306061 9:135907636-135907658 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062306078 9:135907687-135907709 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062306093 9:135907738-135907760 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062357941 9:136173876-136173898 CCGGGCCTGGGCTGTGGGGCCGG - Intergenic
1062461854 9:136665681-136665703 CCCCGTCTGCGCAATGGGGGCGG + Intronic
1185610526 X:1391688-1391710 CCACGCGTGCGCACTGGGCCCGG - Intronic
1185652950 X:1661867-1661889 CAGCGCCTGCACAGTGGGAAGGG + Intergenic
1185894307 X:3844022-3844044 CCGCGCCTGCCCACGGTGGCGGG - Intergenic
1185899426 X:3882446-3882468 CCGCGCCTGCCCACGGTGGCGGG - Intergenic
1185904543 X:3920875-3920897 CCGCGCCTGCCCACGGTGGCGGG - Intergenic
1196859509 X:120014565-120014587 CCGCTCTTGAGCTGTGGGGCGGG - Intergenic