ID: 968507391

View in Genome Browser
Species Human (GRCh38)
Location 4:977170-977192
Sequence CCTCGCAGCCTCGGAGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968507382_968507391 13 Left 968507382 4:977134-977156 CCACAGGGAGCTGGGGAGAGGAT 0: 1
1: 1
2: 6
3: 63
4: 493
Right 968507391 4:977170-977192 CCTCGCAGCCTCGGAGGAGCCGG No data
968507374_968507391 30 Left 968507374 4:977117-977139 CCGAGGGCTGCTGGCCGCCACAG 0: 1
1: 1
2: 0
3: 37
4: 272
Right 968507391 4:977170-977192 CCTCGCAGCCTCGGAGGAGCCGG No data
968507380_968507391 16 Left 968507380 4:977131-977153 CCGCCACAGGGAGCTGGGGAGAG 0: 1
1: 1
2: 3
3: 59
4: 439
Right 968507391 4:977170-977192 CCTCGCAGCCTCGGAGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968507391 Original CRISPR CCTCGCAGCCTCGGAGGAGC CGG Intronic
No off target data available for this crispr