ID: 968507981

View in Genome Browser
Species Human (GRCh38)
Location 4:980769-980791
Sequence CTGGCTGATAAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 374}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968507981_968507989 6 Left 968507981 4:980769-980791 CCTCCTTCCCTCTTATCAGCCAG 0: 1
1: 0
2: 4
3: 38
4: 374
Right 968507989 4:980798-980820 AAACTAAAAACCAGGGTTTAGGG 0: 1
1: 0
2: 8
3: 94
4: 397
968507981_968507987 -1 Left 968507981 4:980769-980791 CCTCCTTCCCTCTTATCAGCCAG 0: 1
1: 0
2: 4
3: 38
4: 374
Right 968507987 4:980791-980813 GAGACAGAAACTAAAAACCAGGG 0: 56
1: 73
2: 34
3: 60
4: 539
968507981_968507988 5 Left 968507981 4:980769-980791 CCTCCTTCCCTCTTATCAGCCAG 0: 1
1: 0
2: 4
3: 38
4: 374
Right 968507988 4:980797-980819 GAAACTAAAAACCAGGGTTTAGG 0: 1
1: 1
2: 8
3: 31
4: 296
968507981_968507986 -2 Left 968507981 4:980769-980791 CCTCCTTCCCTCTTATCAGCCAG 0: 1
1: 0
2: 4
3: 38
4: 374
Right 968507986 4:980790-980812 AGAGACAGAAACTAAAAACCAGG 0: 2
1: 2
2: 1
3: 66
4: 760

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968507981 Original CRISPR CTGGCTGATAAGAGGGAAGG AGG (reversed) Intronic
900839721 1:5038474-5038496 ATGTCTGATAAGTGGGGAGGAGG - Intergenic
901236198 1:7668966-7668988 CTGGCTGAGAAGAGTGCCGGCGG - Intronic
901254279 1:7807815-7807837 CTGGCAGGTAAGGGGGAAGCAGG - Intronic
901692379 1:10981890-10981912 CTTGCATCTAAGAGGGAAGGGGG - Intronic
902036622 1:13462749-13462771 CTGATTGGGAAGAGGGAAGGAGG + Intergenic
902310548 1:15578593-15578615 CTGGCTTAGAAGAGGGGAGGAGG - Intronic
903467040 1:23559016-23559038 CTGTCTGATTAGAGGAAAAGAGG + Exonic
904478074 1:30777354-30777376 CTGGCTGAAAACAGGCAAGGTGG - Intergenic
904596857 1:31652231-31652253 CTGGCTGACCACAGGCAAGGAGG + Exonic
904769279 1:32871855-32871877 CTGGCTGAGATGAGGGAAGGGGG - Intronic
904896693 1:33823161-33823183 CTGGCTGAGGAAAGGGGAGGCGG - Intronic
905119183 1:35668584-35668606 AGGACAGATAAGAGGGAAGGAGG - Intergenic
905188376 1:36213483-36213505 ATGGCAGATAAGATAGAAGGAGG + Intergenic
905291465 1:36924478-36924500 CTGGCTGTGGAGAGGGGAGGGGG + Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
908096249 1:60741991-60742013 TTGGGAGAGAAGAGGGAAGGTGG - Intergenic
909134494 1:71780860-71780882 TGGGCTCAGAAGAGGGAAGGTGG - Intronic
909338096 1:74499626-74499648 CTGGTAGATAAGAGGGGAGGGGG + Intronic
909662114 1:78095745-78095767 CTGGGTGGTAAGAGAGAAGCTGG - Intronic
909876012 1:80804459-80804481 CTGGAGGATGAGAGGAAAGGTGG - Intergenic
910201672 1:84706358-84706380 GTGGCTGCTTAAAGGGAAGGGGG + Intergenic
910464126 1:87478301-87478323 CTGGCTGCTGAGATGGAAAGAGG + Intergenic
911889441 1:103348533-103348555 CTGACTGAAATGAGGGAATGAGG + Intergenic
915168129 1:153959922-153959944 CTGACTAATGAGAGGGAAGTGGG - Exonic
915433406 1:155884547-155884569 CTAACTGATAAGAGTGGAGGAGG + Exonic
915696618 1:157749024-157749046 CTGGCTGAGGAGAGAGCAGGTGG + Intronic
915802004 1:158803584-158803606 CTGGCTCACAAGAGGAAAAGAGG - Intergenic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
917156352 1:172003811-172003833 AAGGATGATAAGAGAGAAGGGGG + Intronic
918333796 1:183487267-183487289 CTGGCTTTGAAGATGGAAGGGGG - Intronic
919144927 1:193621823-193621845 CTGTCTCAAAAGAGGGAAAGTGG - Intergenic
919751266 1:201039715-201039737 CTAGCTGCTGAGAGGGAGGGAGG + Exonic
919883380 1:201915554-201915576 CCGGCTGGGAAGAGGAAAGGAGG + Intronic
920068023 1:203282824-203282846 GTGGCTGAGAATAGGGAAGGTGG + Intergenic
920852030 1:209634525-209634547 CTGGCGGACCCGAGGGAAGGTGG + Exonic
921060873 1:211583507-211583529 CTGCCTACCAAGAGGGAAGGAGG - Intergenic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
921618208 1:217296925-217296947 CCAGCTGATGAGGGGGAAGGAGG + Intergenic
921931347 1:220756820-220756842 CTGGATGGAAAGAGGGAAAGAGG + Intronic
923304338 1:232674399-232674421 CTGCCTGAGAAGAGGGACTGAGG - Intergenic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
1064699772 10:18007021-18007043 ATGGGTGTTAAGAGGAAAGGAGG - Intronic
1065414338 10:25468095-25468117 CATGCTGAGAAGAGGGAAAGAGG - Intronic
1065780463 10:29162058-29162080 CTGGCAGAGAAGGGGGAGGGTGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067515870 10:46942658-46942680 ATGTCTCATAAGAGGGAAGTGGG + Intronic
1067646380 10:48109152-48109174 ATGTCTCATAAGAGGGAAGTGGG - Intergenic
1069303021 10:66932106-66932128 CTGGCTGAAAAGGGGGAGGGAGG - Intronic
1070106086 10:73432723-73432745 CTGGCAGAAAAGAAAGAAGGTGG + Intronic
1070197994 10:74176685-74176707 CGTGCTGATTGGAGGGAAGGCGG - Intronic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073233787 10:101995709-101995731 CTGGCAGATGAGAGGGTGGGTGG - Intronic
1073452138 10:103616335-103616357 CTGGCAGAGAAGAGAGAAGGTGG + Intronic
1073626359 10:105101819-105101841 CTGGCTGGTAAGAAGGAAGCAGG + Intronic
1074372850 10:112914192-112914214 CTGTCTGAAAAGAAAGAAGGAGG - Intergenic
1074414277 10:113253550-113253572 CTGGCTTTGAAGATGGAAGGTGG - Intergenic
1075438044 10:122459776-122459798 CTGGCTGCTCAGGGGGATGGAGG + Intergenic
1076464120 10:130666679-130666701 CAGGCTGAAAAGAGGGAAAGAGG + Intergenic
1076718959 10:132384497-132384519 CTGTCTGATATGAGAGAAAGTGG - Intergenic
1076813698 10:132903259-132903281 CTGGCAGAAAACAGGGATGGAGG - Intronic
1077498391 11:2897644-2897666 CTGGCTGAGAAGGTGTAAGGTGG + Intronic
1077928103 11:6702546-6702568 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
1077960514 11:7072319-7072341 CCGGCTGATAACAGGAAAAGGGG - Intergenic
1078267901 11:9768664-9768686 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1083434479 11:62633268-62633290 CTGGCTGTTAAGAAGAAAAGAGG + Exonic
1083580414 11:63821235-63821257 CTGGCTTTGAAGATGGAAGGAGG - Intronic
1083627570 11:64079373-64079395 AGGGATGATAGGAGGGAAGGGGG + Intronic
1084369068 11:68726253-68726275 CTGGCTGGTGGGAGGGGAGGAGG + Intronic
1084490664 11:69476566-69476588 CGGGCTGGGGAGAGGGAAGGGGG - Intergenic
1084857671 11:71999308-71999330 CTGGCTGTGAAGAGGGGAGGCGG + Exonic
1085453538 11:76653343-76653365 CTGTCAGCTAAGACGGAAGGAGG - Intergenic
1085501729 11:77030637-77030659 CTGGATGAGAAGAATGAAGGGGG - Intergenic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1085874643 11:80391539-80391561 CTAGCTGATAGCAAGGAAGGGGG + Intergenic
1086407705 11:86512987-86513009 CTTCCTGGTAAGAGAGAAGGAGG - Intronic
1086880869 11:92152042-92152064 CTGGCTATGAAGAAGGAAGGAGG - Intergenic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1089185555 11:116612333-116612355 CTGGCTGAAAAGAGAGCAGATGG + Intergenic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1089715859 11:120358442-120358464 CTGACTGATAAGATGGAAGATGG + Intronic
1090075820 11:123579453-123579475 CTGGCTGTGGACAGGGAAGGAGG + Intronic
1090485152 11:127106404-127106426 GGGGCTGAGAAGAGGGAAAGTGG + Intergenic
1091463793 12:666118-666140 CTGGCTGAATAGAGGGAAACAGG + Intergenic
1091755868 12:3051157-3051179 GTGGCTGAAAGGAAGGAAGGAGG - Intergenic
1093323226 12:17739891-17739913 CTGGCTTTGAAGATGGAAGGAGG - Intergenic
1094097926 12:26728525-26728547 CTGGATAATAGGAGAGAAGGTGG + Intronic
1095641685 12:44493254-44493276 CTGGCTTCTAAGTAGGAAGGTGG - Intergenic
1097001701 12:55882490-55882512 CTGGCTGATCTGAGAGAAGCTGG - Intergenic
1098451178 12:70619617-70619639 CTGGCAGATAAGAGGCCATGTGG + Intronic
1101292673 12:103387563-103387585 CTGGTTGACAAGAGGGATGTTGG - Intronic
1101620476 12:106382244-106382266 TTGTCTTATAAAAGGGAAGGGGG - Intronic
1101637844 12:106560986-106561008 CTGGCTGATGGGAGGTAAGCAGG + Intronic
1101828360 12:108238456-108238478 CTGGCTTTTAAGATGGATGGAGG - Intronic
1102436393 12:112927436-112927458 ATGGCTGAGAATAGGGAGGGAGG - Intronic
1102527021 12:113519697-113519719 TGGGGTGAAAAGAGGGAAGGGGG - Intergenic
1103228609 12:119309087-119309109 CAGGATGATAGAAGGGAAGGAGG - Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104613455 12:130249514-130249536 CTGGCTGAAAAACAGGAAGGAGG + Intergenic
1104737860 12:131149986-131150008 CTGGATGATAACAGGGCATGGGG - Intergenic
1104785783 12:131447242-131447264 CAGGCTGATAAGACTGAAGTTGG + Intergenic
1106301351 13:28469069-28469091 CTGCCTGGGAAGAGGGGAGGAGG - Intronic
1106457346 13:29938649-29938671 CTGGCTGTTATGAGGAAAGCAGG - Intergenic
1107147032 13:37070299-37070321 CAGGCTGTTAAGAGGGTAGAAGG + Intergenic
1107219673 13:37967498-37967520 CTGGCTGTGAAGATGTAAGGGGG - Intergenic
1107539145 13:41369732-41369754 CTGGCTTTGAAGATGGAAGGAGG + Intronic
1109445108 13:62427050-62427072 TTGGCTGATAACAGGACAGGAGG - Intergenic
1109494580 13:63151226-63151248 CTGGCTGAGAAGATGTAAGGGGG + Intergenic
1110593633 13:77293745-77293767 CTGGCTTTGAAGATGGAAGGGGG + Intronic
1110717338 13:78721233-78721255 CTGGCTGATCTGACAGAAGGCGG - Intergenic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1114695942 14:24627853-24627875 CTGGAGGAAAAGAGGGATGGTGG + Intergenic
1115162565 14:30412330-30412352 CTGGCTGTGAAGATGGAAGAAGG - Intergenic
1115507758 14:34109223-34109245 CTAGCAGAAGAGAGGGAAGGAGG + Intronic
1116851087 14:49910177-49910199 ATGGCTTATATGAGGAAAGGAGG - Intergenic
1117047566 14:51828445-51828467 CTGACTGATAAGGGGGCAGGAGG + Intronic
1117648918 14:57882101-57882123 TGGGCTGATGAGAGGGAGGGAGG - Intronic
1118320505 14:64749605-64749627 CTGGCTAAGAAGGGGGTAGGTGG - Exonic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1120928176 14:89819333-89819355 TTATCTGAGAAGAGGGAAGGGGG + Intronic
1121556158 14:94839368-94839390 TTAGCTGATGGGAGGGAAGGAGG - Intergenic
1122348975 14:101077049-101077071 TTGGCTGAAAAGGGGAAAGGTGG - Intergenic
1122800279 14:104225870-104225892 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1122800303 14:104225975-104225997 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1123039843 14:105486020-105486042 ATGGCTGACAGGAGGGATGGTGG + Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125681117 15:41530787-41530809 CTGCCTCTTAAAAGGGAAGGCGG + Intronic
1127105940 15:55615127-55615149 CTGGCTTTGAAGATGGAAGGAGG + Exonic
1127124884 15:55802277-55802299 CTGGCTGACAAGTGGGAGGAGGG - Intergenic
1127388437 15:58486190-58486212 CAGGCAGATAAGAGAGGAGGAGG - Intronic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128225925 15:66001307-66001329 CTGGCTGGTATGAGGAAGGGAGG + Intronic
1128248368 15:66148445-66148467 CTGGCTGAGATGAGGAAAGAGGG + Intronic
1128360752 15:66959971-66959993 TGGGCTGAGAAGAGGGAAGGAGG - Intergenic
1128383669 15:67131966-67131988 CTGCATGATAAGACAGAAGGGGG - Intronic
1129895907 15:79105656-79105678 ATGGCTGAAAAGTGGGAAAGAGG - Intergenic
1130100794 15:80892436-80892458 CTGGGTTTTAAGAGAGAAGGTGG - Intronic
1132793909 16:1708972-1708994 GTGTCTGATAAGAGGGGAGCGGG + Intronic
1133027783 16:2996238-2996260 CAGGCTTCTTAGAGGGAAGGGGG + Intergenic
1133650099 16:7804757-7804779 CAGGCTGATCAGAGGTAAAGTGG + Intergenic
1134275876 16:12775694-12775716 CTGGCTGGTCAGACAGAAGGTGG - Intronic
1135294764 16:21269749-21269771 GTGGGAGAGAAGAGGGAAGGGGG - Intronic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137977084 16:53041122-53041144 CTGGATGAAAGGAAGGAAGGAGG + Intergenic
1138620043 16:58203755-58203777 CTGGCTTTGAAGACGGAAGGGGG + Intergenic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140667234 16:77238853-77238875 CTGGAGGATAAGAGGCCAGGTGG - Intergenic
1141316233 16:82964967-82964989 CTGGGAGCTAAGAAGGAAGGTGG + Intronic
1142065639 16:88060863-88060885 CTGGATGGTGAGAGGGAGGGTGG - Intronic
1142729836 17:1846136-1846158 CAGGCTGATAATGGGGAAGACGG - Intronic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1143136989 17:4717595-4717617 CTGCCCGAGAGGAGGGAAGGGGG + Intronic
1143520980 17:7444246-7444268 CTGGCTCATAGTAGGGAAGCTGG + Exonic
1143542809 17:7579720-7579742 CTGGCAGGTAAGGAGGAAGGAGG + Exonic
1143564196 17:7711785-7711807 GTGGCTGATCAGAAGGAAGTAGG + Intergenic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1144760079 17:17702154-17702176 CTGGCTGACATGAGGGGAGAGGG + Intronic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1146424347 17:32722470-32722492 CTGGCTTTGAAGATGGAAGGGGG - Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147322156 17:39653025-39653047 CTGGCTGCTGGGAGGGAATGTGG + Intronic
1147782852 17:42956159-42956181 GTGGCTGAGAAGAGGGATTGGGG - Intronic
1147865199 17:43547221-43547243 CTCTCAGATAAGAGGGAAGATGG - Intronic
1148855796 17:50578685-50578707 CTGGCAGGTAGGAGGGGAGGTGG + Intronic
1150266861 17:63837694-63837716 CTGGCTGACGAGAGGGATGGAGG - Intronic
1150924154 17:69515060-69515082 CTGCCAGAAAAGAGGGAAAGAGG - Intronic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151958191 17:77391084-77391106 ATGGCTGATGAGAGGGCAGTGGG + Intronic
1152019126 17:77771350-77771372 CTGGCTGGGACGAGTGAAGGTGG + Intergenic
1152293488 17:79453863-79453885 CTGGCAGAGGAGAGGAAAGGGGG + Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152837683 17:82544863-82544885 CTGGCTCCCAAGAGGAAAGGGGG - Intronic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1154208297 18:12356496-12356518 CTAGCTGGTGCGAGGGAAGGTGG + Intronic
1155176900 18:23308561-23308583 CTGGCTGATAGCAGTGGAGGTGG - Intronic
1155226861 18:23736926-23736948 CTGGGTCTTAAGAGGGTAGGTGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1157105078 18:44766531-44766553 GTGGGTGATAGAAGGGAAGGAGG + Intronic
1157198685 18:45640951-45640973 CTGGGTGAGAAGAGGCAAGGAGG - Intronic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1159899913 18:74036425-74036447 CTGGCTGATGGCAGGGATGGAGG - Intergenic
1159921367 18:74230191-74230213 CTGGCCGGTCAGAAGGAAGGAGG + Intergenic
1160111296 18:76034324-76034346 CTGGCTGCTAAGAAGCAAGGAGG - Intergenic
1160357265 18:78238982-78239004 CGGCCTGAGAAGAAGGAAGGAGG + Intergenic
1161771738 19:6234430-6234452 CTGGCAGATAAAGGGGAACGAGG + Intronic
1162286167 19:9740704-9740726 CTGGTTGATAAGAGGAAATGAGG + Intergenic
1163119609 19:15209329-15209351 CTGGCTTCTCAGAGGGCAGGAGG + Intergenic
1165105041 19:33464271-33464293 CTGGCTGGTGTTAGGGAAGGTGG - Intronic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166104676 19:40591338-40591360 CTTCCAGAAAAGAGGGAAGGTGG - Exonic
1166398401 19:42459550-42459572 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
1166624511 19:44338269-44338291 CTGACTGCTAAATGGGAAGGAGG + Intronic
1167011873 19:46813818-46813840 CTCGCTGAAAGGAGGGAGGGTGG - Intergenic
1167172734 19:47843978-47844000 CTGGATGCTGAGAGGGAAGGCGG - Intergenic
1168223679 19:54979316-54979338 CAGGAAGATAAGAGGGAATGTGG - Intronic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925462681 2:4077313-4077335 GTGGGTGATAAGAGGGGAGGTGG - Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
928115211 2:28541230-28541252 CTGTTTGCTAAGAGGGATGGTGG - Intronic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
930799780 2:55431256-55431278 CTGGCTGCTAAGAGGCAATAGGG + Intergenic
930946890 2:57085274-57085296 CTGGCTGCTAAGGGGGTGGGGGG - Intergenic
932992968 2:76811111-76811133 ATGGCTGGTAAAAGGTAAGGAGG - Intronic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
934887108 2:98034657-98034679 CTGACTGTTAAGAGGGCAGCCGG - Intergenic
936487324 2:112937370-112937392 ATGGCTGATAAGTGGGAGAGAGG + Intergenic
938844549 2:135195358-135195380 CAGGCTGATCAGAGAGAAAGGGG - Intronic
940272572 2:151907770-151907792 CTGGCTGAGACCAGGAAAGGAGG - Intronic
940572408 2:155455147-155455169 CTGGGTGATAAGATTGAGGGTGG + Intergenic
940882910 2:158964743-158964765 CTTGCTGAAAAGAGGGAAGGTGG + Intergenic
941068341 2:160928527-160928549 CTTGCTGGGAATAGGGAAGGAGG - Intergenic
941798694 2:169630417-169630439 CTTGATAATAAGAGGGAAAGTGG + Intronic
942059540 2:172215513-172215535 CTGGGTGATGAGAGAGTAGGAGG + Intergenic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
945932294 2:215867052-215867074 CTGGCTTAGAAGCTGGAAGGAGG - Intergenic
946197080 2:218040037-218040059 CTGTCTGATAAGAATAAAGGGGG - Intronic
946283970 2:218688674-218688696 CTGGGTGACATGAGGGAAAGAGG - Intronic
947094329 2:226548979-226549001 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947879069 2:233489294-233489316 CTGGCTGGTGTGAGGGATGGAGG - Intronic
948585165 2:239014801-239014823 CAGGCTGCTAAGGGGGATGGGGG - Intergenic
948677844 2:239609558-239609580 CTGCCTAAGAAGAGGGGAGGTGG - Intergenic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1171021096 20:21584785-21584807 CTGGCTGCTAACACGGGAGGCGG + Intergenic
1171303005 20:24080100-24080122 CTGGCTGGTCAGAGGGAAAGTGG + Intergenic
1172488220 20:35312889-35312911 CTAGGGGATATGAGGGAAGGAGG + Intronic
1172906277 20:38372169-38372191 CTTTCTGGAAAGAGGGAAGGAGG + Intronic
1173318207 20:41963834-41963856 CTACCTGATGAGAGAGAAGGAGG - Intergenic
1173494656 20:43509815-43509837 CTGGCAGTTAAGAGTGAATGTGG - Intronic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173812481 20:45964451-45964473 AGGGCTGATGGGAGGGAAGGAGG + Intronic
1174122080 20:48273428-48273450 CTGGCTGATAAGAGAAAAGGGGG - Intergenic
1175144596 20:56886097-56886119 GAGGGTGATAAGGGGGAAGGAGG + Intergenic
1175236882 20:57520099-57520121 ATGGCTCCAAAGAGGGAAGGTGG + Intronic
1175286467 20:57840130-57840152 CTGGCTGGAAATAGGGAAAGTGG - Intergenic
1175304861 20:57969021-57969043 CTGGAGGATAAAAGGGAGGGTGG + Intergenic
1175766085 20:61594043-61594065 CTGGCGGGGAAGAGGGTAGGGGG + Intronic
1175793999 20:61760092-61760114 GTGGCTGACAAGAGAGCAGGTGG - Intronic
1176370579 21:6059615-6059637 CTGGCTGAGAGGCGGTAAGGGGG - Intergenic
1179752940 21:43478926-43478948 CTGGCTGAGAGGCGGTAAGGGGG + Intergenic
1179964844 21:44796869-44796891 CTGGCTGTGAAGATGGAAGAAGG - Intronic
1180791254 22:18576927-18576949 CTTGCTGAGAGGAGGGAATGAGG - Intergenic
1181230484 22:21418387-21418409 CTTGCTGAGAGGAGGGAATGAGG + Intronic
1181248166 22:21516482-21516504 CTTGCTGAGAGGAGGGAATGAGG - Intergenic
1182909355 22:33968254-33968276 ATGGCTTGTAAGAGAGAAGGAGG + Intergenic
1183049584 22:35250076-35250098 CTGGGTGAAAGGAGGTAAGGAGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183685805 22:39360803-39360825 CAGGCAGAGAAGGGGGAAGGAGG + Intronic
1183878163 22:40802185-40802207 CTGGCAGAAAAGAGGGATGAAGG - Intronic
1184471020 22:44696428-44696450 CTGGCTGACAGGTGGGAAGGTGG + Intronic
950619026 3:14187799-14187821 CTGACTTATAAATGGGAAGGTGG + Intronic
952853557 3:37749213-37749235 CTGGCTTTGAAGATGGAAGGGGG - Intronic
954245154 3:49325644-49325666 GTGGCTGATGGGAGGGAAGAGGG - Intronic
955403837 3:58612848-58612870 ATGACTGATAACAGGCAAGGGGG - Intronic
956072265 3:65466381-65466403 ATGGCCGAAAAGAGGAAAGGGGG + Intronic
959123069 3:102255937-102255959 CTGGCTTTGAAGATGGAAGGAGG + Intronic
960305396 3:116054154-116054176 CTGGCTTTGAAGATGGAAGGTGG - Intronic
960366009 3:116773421-116773443 TTGGCTAATAAGAGGGTAGATGG - Intronic
960961340 3:123072571-123072593 CTGGCAGAGAGGAGGCAAGGAGG - Intronic
961603723 3:128078501-128078523 GTGGCTGAGGAGAGGGAGGGAGG - Intronic
963085368 3:141430849-141430871 CTGGCTGATTGAATGGAAGGTGG - Intronic
964265736 3:154893484-154893506 CTGTCTTATTAGAGGGCAGGTGG - Intergenic
965165574 3:165191784-165191806 GTGGCTGGTTAGAGGGGAGGTGG + Intronic
965701362 3:171461328-171461350 CTGGCGGATAAGAAGTAACGCGG + Intergenic
965823720 3:172710210-172710232 CTGGCTGAAAGGAGGTGAGGAGG - Intronic
966618215 3:181935044-181935066 CTGGATGAAGAGAGAGAAGGGGG + Intergenic
968430300 4:554549-554571 CTGGCTGAGCAGAGGCCAGGTGG - Intergenic
968507981 4:980769-980791 CTGGCTGATAAGAGGGAAGGAGG - Intronic
969433902 4:7172988-7173010 CGGGCTGGGAAGTGGGAAGGTGG + Intergenic
970488124 4:16544643-16544665 CTGGGAGATAAGAGGGAGTGAGG + Intronic
970872025 4:20827132-20827154 CTGGCTTCTAAGAGAGAAGAAGG - Intronic
971136616 4:23875642-23875664 CTGGGTGATAAAAGAGAAGAAGG - Intronic
971370515 4:26015280-26015302 CTGCATGATAAGAGGGGAAGTGG - Intergenic
971376034 4:26056443-26056465 CTGGCAGAAAAGAGGGGAGAGGG - Intergenic
972318636 4:37951468-37951490 CTGCATTATAAGAAGGAAGGAGG + Intronic
972434116 4:39015442-39015464 CTGGCTTTGAAGATGGAAGGAGG + Intronic
972914937 4:43865101-43865123 CTGGATGATAACAAGGATGGAGG - Intergenic
972956805 4:44402720-44402742 CCAGCTGATATGAGGGGAGGTGG - Intronic
973110451 4:46390555-46390577 GTGGCTGCTAAGAGGTAAAGAGG + Intronic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
976700883 4:87967268-87967290 CTGGCTCATACTAGGGAATGTGG - Intergenic
977054364 4:92171960-92171982 TTTGCTGACAAGAGGGAAAGAGG - Intergenic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
982765953 4:159348435-159348457 CTTGCTGATCAGATGGAATGAGG - Intronic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
983516034 4:168657735-168657757 CTGGCAAAGAAAAGGGAAGGTGG - Intronic
986122407 5:4853706-4853728 ATGGCTGATCAGACGGGAGGTGG + Intergenic
986269173 5:6216564-6216586 CTGGCAGCTAATAGGGAGGGAGG + Intergenic
986555778 5:9008689-9008711 CTTGCTGCTAAGGGTGAAGGAGG + Intergenic
988874101 5:35424796-35424818 CTGGCTGCGAGGATGGAAGGGGG + Intergenic
989996552 5:50839872-50839894 CTGACTGAAAAGAGTGATGGGGG + Intronic
990568901 5:57057688-57057710 CTGGCTTTGAAGAGGAAAGGAGG + Intergenic
991418001 5:66411369-66411391 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
991666651 5:69006144-69006166 CAGGCTGGGATGAGGGAAGGAGG + Intergenic
992072902 5:73164908-73164930 CAGGCTAATAACAGGAAAGGTGG - Intergenic
993217725 5:85047748-85047770 CTGGCTGATAAAAATGAATGAGG + Intergenic
994989337 5:106979357-106979379 CTTGCTGCTAAGAGTGAAGAAGG - Intergenic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
997531108 5:134581744-134581766 CTGGCTGCTGCGAGGGGAGGGGG + Exonic
997532719 5:134592144-134592166 CTGACTGACCAGAGGCAAGGAGG + Intergenic
998145384 5:139724901-139724923 CTGGCTGGTAAGAGGGGCAGTGG + Intergenic
998410050 5:141902994-141903016 CTGGCTACAAGGAGGGAAGGGGG - Intergenic
999786991 5:154899679-154899701 CTGGCATCTAAGAAGGAAGGCGG + Intronic
1000857153 5:166412788-166412810 TTTTCTGAGAAGAGGGAAGGTGG + Intergenic
1002894021 6:1364533-1364555 CTGGCTAATAAGATAGAAAGAGG - Intergenic
1004905622 6:20234715-20234737 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
1005875097 6:30005300-30005322 CTGAGTGATAAGAGGGACGGAGG + Intergenic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1005909049 6:30292172-30292194 CTGCCTGAAAAGAGGTGAGGAGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006100232 6:31681801-31681823 CAGGATGATAAGGGGGAAGATGG + Intronic
1006314849 6:33284492-33284514 CTGGCTGATGTGAGGGGTGGAGG - Intronic
1006960962 6:37929578-37929600 CTGTATGAAAAGAGGGAATGTGG + Intronic
1007478014 6:42132030-42132052 CTGGCTTTGAAGATGGAAGGAGG + Intronic
1009733820 6:67648126-67648148 CTGACTGATCAGAGAGATGGTGG - Intergenic
1009947304 6:70354713-70354735 ATGGCTAAGAACAGGGAAGGAGG - Intergenic
1011149862 6:84259093-84259115 CTGGCTGACAAGAGGGATCTGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1014089241 6:117384812-117384834 CTGGCAGATTAGAGGGCAGGAGG + Intronic
1015924625 6:138296544-138296566 CTTGATGATAAGAGGGAATGAGG - Intronic
1016008560 6:139114519-139114541 TTGGCAGGTAAGAGGTAAGGAGG - Intergenic
1018712491 6:166506764-166506786 CCTGCTGAAAAGGGGGAAGGTGG + Intronic
1019398948 7:840112-840134 GTGGCTGTTAAGAGCGATGGCGG + Intronic
1019844159 7:3480237-3480259 CTGGCTGTGAAGATGGAAGGGGG + Intronic
1022322856 7:29303475-29303497 CTGGGAAATAAGAGGGAAGGGGG - Intronic
1023700727 7:42889342-42889364 CTGGTTGATAAGAGGAAAAGAGG - Intergenic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1024723258 7:52162564-52162586 CTGGCTGATCAGCCGGAAGATGG - Intergenic
1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG + Intergenic
1028584444 7:92439097-92439119 GAGGCTGATAAGAAAGAAGGAGG - Intergenic
1028799158 7:94942132-94942154 CTGACTGAGAAGAGAGAAGTGGG - Intronic
1029292862 7:99515960-99515982 ATGGCTCAGAAGAGGGGAGGAGG - Intronic
1029421052 7:100472157-100472179 CTCTCTCTTAAGAGGGAAGGTGG - Intronic
1029498559 7:100912526-100912548 CTGGCTGACAAGAGGGAAAGTGG - Intergenic
1029745163 7:102512445-102512467 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029763155 7:102611606-102611628 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029995921 7:105007976-105007998 CTGGCTGATTATAGGCATGGTGG - Intergenic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032834267 7:135659041-135659063 GTGGCTGCCAAGAGGGAAGAGGG - Intergenic
1035582195 8:747441-747463 CTGGCTGATGAAAAGCAAGGCGG + Intergenic
1036095352 8:5718168-5718190 CTGGCTGAGAGAAGTGAAGGAGG + Intergenic
1036279937 8:7392154-7392176 CTGGCTTAGAAGAGGGAGTGAGG + Intergenic
1036341584 8:7919729-7919751 CTGGCTTAGAAGAGGGAGTGAGG - Intergenic
1037014287 8:13883243-13883265 CTGGCAGATGAGAGGGTAGGAGG - Intergenic
1037591132 8:20313080-20313102 CCGGCTGCTGAGAGGGGAGGCGG + Intergenic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037715312 8:21392497-21392519 CTGGCTGATGGGAGGGGAGGTGG - Intergenic
1038015196 8:23508937-23508959 CTGGTTGATTAGAGAGAGGGCGG - Intergenic
1038041124 8:23725284-23725306 TTTGCTGAGAATAGGGAAGGAGG - Intergenic
1040469769 8:47727532-47727554 CTGGCTGATAATAAAGGAGGTGG - Intronic
1040846053 8:51841733-51841755 CTGGCTTTTGAGAGGAAAGGAGG - Intronic
1041692608 8:60703750-60703772 CTGGCTCAATAGAGGGAAGGTGG - Intronic
1041775622 8:61519739-61519761 CTGGCTCTGAAGATGGAAGGGGG + Intronic
1041816832 8:61982599-61982621 CTCGATGAGAAGAGGGAATGTGG + Intergenic
1042480638 8:69298236-69298258 CTGGCTTTTAAGAGGGAGGAAGG - Intergenic
1043001923 8:74770024-74770046 CTGGTAGATGGGAGGGAAGGAGG + Intronic
1043067093 8:75587656-75587678 GTGTCTGATAAGACTGAAGGAGG - Intergenic
1043615600 8:82121077-82121099 CTGGCTTTTAAGATGGAATGCGG - Intergenic
1043890061 8:85644356-85644378 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043891602 8:85656270-85656292 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892674 8:85663107-85663129 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892883 8:85714228-85714250 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043895570 8:85735682-85735704 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043897109 8:85746126-85746148 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043899435 8:85764494-85764516 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043901043 8:85776687-85776709 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043903007 8:85791962-85791984 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043904617 8:85804155-85804177 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043906229 8:85816346-85816368 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043907837 8:85828536-85828558 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1044887012 8:96790297-96790319 GTGGATGATAAGAAGGGAGGAGG + Intronic
1045926354 8:107581816-107581838 GTGGCTCATAAAAAGGAAGGAGG - Intergenic
1047212782 8:122853565-122853587 GTGGCTGAGACGAGGGAAGGTGG - Intronic
1047215652 8:122873850-122873872 CTGGCTTTGAAGATGGAAGGGGG - Intronic
1047346264 8:124031700-124031722 CTGAGAGATAAGAGGGCAGGAGG + Intronic
1047721795 8:127647437-127647459 CTCACTGATAAGAGGGTGGGGGG - Intergenic
1047779366 8:128098868-128098890 CTTGCTGGTAACAGAGAAGGAGG - Intergenic
1048305949 8:133284890-133284912 CTGCCTGCTAAAAGGGAAGAGGG + Intronic
1048445470 8:134489665-134489687 CTGGCGGAGATGATGGAAGGAGG - Intronic
1048904776 8:139076891-139076913 CTTGATGAAAAGAGGGAATGGGG - Intergenic
1049294816 8:141826850-141826872 CTCGGAGATGAGAGGGAAGGGGG + Intergenic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1051244260 9:15093233-15093255 CTGGCTTTGAAGAGGGAAGGAGG - Intergenic
1051681403 9:19611413-19611435 AGGGCAGAGAAGAGGGAAGGAGG + Intronic
1052538326 9:29776308-29776330 CTGAATGCTAAGATGGAAGGAGG - Intergenic
1056042058 9:82678274-82678296 CTGGCTGACAAAAGAGAAGTAGG + Intergenic
1057674546 9:97128619-97128641 GTGGCTGATGAGAGTGAGGGAGG - Intergenic
1058425408 9:104871368-104871390 CTTACTGAGAAGAGGGAAGGTGG + Intronic
1058476049 9:105334096-105334118 ATGGCTGATAACAAGGAAGCAGG - Intronic
1060808899 9:126598275-126598297 CTGCCTGATAAGGGGTGAGGAGG + Intergenic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1061222357 9:129259548-129259570 CTGGCTTTGAAGACGGAAGGGGG - Intergenic
1186169813 X:6864724-6864746 CTGGCTTCAAAGATGGAAGGAGG - Intergenic
1189161552 X:38814214-38814236 CTGGCTGTGAAGATGGAAGAAGG + Intergenic
1189330838 X:40144072-40144094 CTGGAGGGGAAGAGGGAAGGTGG + Intronic
1194106014 X:89768045-89768067 GTGGATGATAAGCTGGAAGGGGG - Intergenic
1194691646 X:96993509-96993531 CTGGCAGGAAAGAGTGAAGGGGG + Intronic
1194919904 X:99751950-99751972 CTGACAGAGAACAGGGAAGGAGG - Intergenic
1198088903 X:133308215-133308237 CTGGCTGATACGAGCCACGGAGG + Intronic
1198871595 X:141181394-141181416 CTGGCTAAGAAGGGGGATGGGGG - Intergenic
1199981007 X:152920478-152920500 CTGGCTGATGAAAGGGTGGGTGG + Intronic
1200457970 Y:3415904-3415926 GTGGATGATAAGCTGGAAGGGGG - Intergenic
1201298578 Y:12486766-12486788 TTGGCTGTTAAAAAGGAAGGGGG - Intergenic
1201850624 Y:18476000-18476022 CTGGCTGATGAGAGGGAGCCAGG - Intergenic
1201882694 Y:18844377-18844399 CTGGCTGATGAGAGGGAGCCAGG + Intergenic