ID: 968509036

View in Genome Browser
Species Human (GRCh38)
Location 4:987343-987365
Sequence CTCTGGGGCCCTGGCTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 513}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968509023_968509036 23 Left 968509023 4:987297-987319 CCCCCTGACTGCGCACTGTGAGA 0: 1
1: 0
2: 1
3: 5
4: 98
Right 968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG 0: 1
1: 0
2: 1
3: 58
4: 513
968509024_968509036 22 Left 968509024 4:987298-987320 CCCCTGACTGCGCACTGTGAGAG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG 0: 1
1: 0
2: 1
3: 58
4: 513
968509031_968509036 -10 Left 968509031 4:987330-987352 CCGGAGCTCCCTCCTCTGGGGCC 0: 1
1: 0
2: 8
3: 49
4: 483
Right 968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG 0: 1
1: 0
2: 1
3: 58
4: 513
968509025_968509036 21 Left 968509025 4:987299-987321 CCCTGACTGCGCACTGTGAGAGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG 0: 1
1: 0
2: 1
3: 58
4: 513
968509026_968509036 20 Left 968509026 4:987300-987322 CCTGACTGCGCACTGTGAGAGCT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG 0: 1
1: 0
2: 1
3: 58
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968509036 Original CRISPR CTCTGGGGCCCTGGCTCTCC CGG Intronic
900144447 1:1151739-1151761 TTCTGTGGCCTCGGCTCTCCAGG + Intergenic
900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG + Exonic
900309191 1:2025179-2025201 CTGTGGGGGCCTGGCTCTGATGG - Intronic
900410619 1:2510939-2510961 CTCTGGGGCCCTGAAGCCCCTGG - Intronic
900471419 1:2856811-2856833 CTCTGTGCCCCTGCCTCCCCTGG - Intergenic
900929706 1:5728896-5728918 AGCAGGGGCCCTGGCTCACCAGG + Intergenic
901325697 1:8364026-8364048 CCCTGGGGCCATGGGGCTCCTGG - Intronic
901616021 1:10540461-10540483 GAGTGGGGCCCTGGCTTTCCAGG + Intronic
901627191 1:10631043-10631065 CTCTGGCTCCCTGTCTCCCCTGG + Intergenic
901701222 1:11045607-11045629 CTCTGAGGTCATGGATCTCCTGG - Intronic
902413410 1:16225413-16225435 TTCTGGGGCCATGGCCTTCCTGG - Intergenic
902546628 1:17194355-17194377 CTCTGGGGCCTCGGGGCTCCTGG + Intergenic
902618034 1:17634588-17634610 CTCTGGGGCTCTGGGGCTCTGGG + Intronic
902768281 1:18631150-18631172 CTCTGGCGCTCTGGCGCTCGGGG - Exonic
903033009 1:20476788-20476810 CTCTGGGGACCTGCCCGTCCTGG + Intergenic
903282765 1:22259410-22259432 CTCTTAGGCCCTGGCTCTTTTGG + Intergenic
903954740 1:27017536-27017558 CCCTGTTGCCCTGGCTGTCCAGG - Intergenic
903972624 1:27129042-27129064 CTCTGGGACCCTGCCGCTGCTGG - Intronic
904203693 1:28838582-28838604 GTCAGGGGCCCTGGGACTCCAGG + Intronic
904400996 1:30256637-30256659 CTCTGGCCCCATGGCTGTCCAGG - Intergenic
904401119 1:30257474-30257496 GTCTGCGGCCCTGGAGCTCCAGG + Intergenic
904604141 1:31689769-31689791 CCTTTGGGCCCTGGCTTTCCAGG + Exonic
904677559 1:32207638-32207660 CTCTGGGGGTCTGGTCCTCCAGG - Exonic
907987744 1:59549197-59549219 CTCTGGAGCCCTTCCTCTCCAGG + Intronic
910099109 1:83557637-83557659 CTCTGTCTCCCTGGCTCTCCTGG - Intergenic
910205728 1:84747294-84747316 CACTGGTGCCCTCGCTCTACAGG + Intergenic
911498910 1:98661988-98662010 CTCTGGCGCGCTTGCCCTCCCGG + Intronic
912379094 1:109237222-109237244 CTCTGGGACCCTGTCTTCCCAGG + Exonic
912511442 1:110192721-110192743 CTCTGGGTTCCTGCCTGTCCTGG - Intronic
913064126 1:115233896-115233918 CTCTTCAGCCCTGGCTCTGCCGG + Intergenic
914824528 1:151131955-151131977 ATCTGGGCCCTGGGCTCTCCCGG - Exonic
914992882 1:152514020-152514042 CTCTTGGTCCTTGGCTCCCCAGG - Intronic
915109420 1:153553584-153553606 CTCTGGGGCCCAGGCCCTTTTGG - Intergenic
915491330 1:156251554-156251576 CTCTGGGGGCCTGGTTTTGCAGG + Intronic
915604045 1:156939763-156939785 CCCTGGGACCCAGGCTCCCCAGG - Exonic
918613800 1:186521777-186521799 TTCTGGGTCCCTGGCTCACAGGG - Intergenic
919764741 1:201119518-201119540 CTGTGGGTCCCTAGGTCTCCTGG + Intronic
919786674 1:201262485-201262507 CTCTGGGTCCCTGGCCCTGGGGG - Intergenic
920020089 1:202949219-202949241 TTCTGAGGCCCTGGTACTCCTGG - Intronic
920211689 1:204333117-204333139 CTGGGGGCCTCTGGCTCTCCTGG - Intronic
920215954 1:204361712-204361734 CTCACCTGCCCTGGCTCTCCAGG + Intronic
922807673 1:228399032-228399054 CTCTGGGGCCCTGGCTGCTATGG - Intronic
923337077 1:232979758-232979780 CTCAGAGGCCGTGCCTCTCCTGG - Exonic
923540635 1:234885853-234885875 CTCTGAGGCCCGGGCTCTGGGGG + Intergenic
924436396 1:244047984-244048006 CCCGGGTGCCCTGCCTCTCCAGG + Intergenic
1062902083 10:1154114-1154136 CCCCAGGGCTCTGGCTCTCCAGG + Intergenic
1062918939 10:1265541-1265563 AGCGGGGGCCCAGGCTCTCCCGG + Intronic
1063301182 10:4850190-4850212 CTCTGTGGACCTTGGTCTCCAGG - Intergenic
1063362024 10:5466904-5466926 CTGGGAGGCCCTGGCCCTCCCGG - Intergenic
1064221076 10:13440507-13440529 CTCTGGGCCCCTGGTTTTACAGG - Intronic
1067946009 10:50688318-50688340 CACTGTGTCCCAGGCTCTCCTGG - Intergenic
1069862804 10:71481947-71481969 CTTTGCAGCCCAGGCTCTCCTGG - Intronic
1069923334 10:71831058-71831080 CTCTGGGCCACTGCCTCTCCTGG + Intronic
1070275254 10:74999780-74999802 CTCTGGGGCACTGAATCTCTGGG - Intronic
1070759917 10:79017675-79017697 CTGGGGGGCCCTGCATCTCCTGG - Intergenic
1070810951 10:79297935-79297957 ATCTGGGGCCCAGGTTCCCCAGG - Intronic
1070881319 10:79853318-79853340 CACTGTGTCCCAGGCTCTCCTGG - Intergenic
1071474652 10:86015656-86015678 CTCTGGGGCCCAGACTCCCTTGG + Intronic
1071566322 10:86673146-86673168 CTCATGGGCACTGGCTCTCAAGG - Intronic
1071634441 10:87237417-87237439 CACTGCGTCCCAGGCTCTCCTGG - Intergenic
1071647894 10:87369634-87369656 CACTGTGTCCCAGGCTCTCCTGG - Intronic
1073321851 10:102620429-102620451 TGCTGGGGCCCTGACTCTCCTGG - Intronic
1073363366 10:102917956-102917978 CCCTGGGGCCCGCGCTCCCCAGG - Intergenic
1074447521 10:113532879-113532901 CTCTGCGTCCCTGCCCCTCCAGG + Intergenic
1075266768 10:121007264-121007286 CTCTGCCACCCTGGCTCTGCAGG - Intergenic
1075284049 10:121167576-121167598 CTCTGGAGCCCTTGCTTGCCAGG - Intergenic
1075718941 10:124573968-124573990 CTCCAGGGACCTGGCTCCCCTGG + Intronic
1075727128 10:124616397-124616419 CACTGGTGCCCTGGCTCAGCCGG - Intronic
1076033038 10:127175595-127175617 CTCGGGGGCCCTGGCACTGAGGG + Exonic
1076103131 10:127798341-127798363 CTCCGTGCCCCTGGCTCACCAGG - Intergenic
1076203055 10:128573198-128573220 ATCTGGGGCCTTGGATCCCCTGG + Intergenic
1076220549 10:128729997-128730019 ATCTGGGGCTCTGGGCCTCCAGG + Intergenic
1076354292 10:129840882-129840904 CTAGGGGTCCCTGGCTCGCCTGG - Exonic
1077037016 11:500130-500152 CTCTGGGGTCTGGGGTCTCCAGG + Intronic
1077364850 11:2157509-2157531 CTCTGTGGGCCTGGCTCACATGG + Intronic
1077433556 11:2527599-2527621 TTCTGTGGCTCTGGCTGTCCAGG + Intronic
1077498249 11:2897061-2897083 CTCCGGGGCCCTGGCCCTAAAGG + Intronic
1077802940 11:5559614-5559636 CTCTGTCGCCCAGGCTCTCGTGG - Intronic
1078478735 11:11657642-11657664 CCCAGGGGCCCTGGCTTCCCTGG - Intergenic
1078541696 11:12218260-12218282 CCCTGGGCCCCTGCCTCTGCTGG + Intronic
1078771714 11:14358437-14358459 CTCGGTGGCCCAGCCTCTCCCGG + Intronic
1079121359 11:17687729-17687751 CTCTGGGGCCCTGGTTCAAAGGG - Intergenic
1079411029 11:20187749-20187771 CTCTGTGGCCCTTGCTGTCTTGG - Intergenic
1080387970 11:31820648-31820670 CTCTGGGGCCGGGGCTGGCCTGG - Intronic
1081607804 11:44538096-44538118 CCCTGGACCACTGGCTCTCCTGG + Intergenic
1081848001 11:46254290-46254312 CTCTGCGGCCTTTGCTCTCGGGG - Intergenic
1083223585 11:61269327-61269349 CCCTGGAACCCTGGCTCACCAGG + Intronic
1083292047 11:61695888-61695910 CTCTGGGTATCTGGCTTTCCAGG - Intronic
1083732135 11:64658167-64658189 ATCTGGGGCCTTGGATCTGCAGG - Intronic
1083900450 11:65640898-65640920 CTCTGTGGGCCTGACTCTCCGGG - Exonic
1084118716 11:67056721-67056743 GGCTGGGGCCCTTCCTCTCCAGG - Intergenic
1084542518 11:69796509-69796531 CTCTGGGGCTGTGGCTCTATGGG - Intergenic
1084709471 11:70835146-70835168 CACTGGGGCTGTGGCTCTGCAGG - Intronic
1084948764 11:72653264-72653286 CTCTGGGCCTCTGTCTCTCAGGG - Intronic
1085057145 11:73411685-73411707 CTCTGGGGCCAGGGCTTTCTGGG - Intronic
1085743435 11:79095574-79095596 CACCGGGTCCCTGGGTCTCCTGG - Intronic
1086108205 11:83169534-83169556 CTCTGAGGGCCTGGCTGACCAGG - Exonic
1087059333 11:93962727-93962749 CTCTGGGTCACTGGGTCTCTGGG + Intergenic
1087065499 11:94024171-94024193 TTCTGAGCACCTGGCTCTCCTGG - Intronic
1088645330 11:111912737-111912759 CTATCGAGCCCTGGCTCTCCGGG + Exonic
1089012583 11:115143090-115143112 CTCCAGGGCCCTGACTCCCCTGG + Intergenic
1089280914 11:117373729-117373751 CTCTGTGGGTCTGTCTCTCCAGG + Exonic
1089650883 11:119912055-119912077 CTCTGGTGCCCTGTGTCTCATGG + Intergenic
1089723883 11:120455704-120455726 ATCTGGAGCAGTGGCTCTCCTGG - Intronic
1090238326 11:125165285-125165307 CTCGGGTCCCCTGGCGCTCCTGG - Intronic
1091046558 11:132330735-132330757 CTCTGGGACCCTAACTGTCCTGG + Intronic
1091160706 11:133417033-133417055 CTCTGGGCACCTTACTCTCCAGG - Intronic
1091216118 11:133903186-133903208 CTCTGTGGCACTGGATTTCCTGG - Intergenic
1091221312 11:133931421-133931443 CCCTGGAGCCCTGGGTCTGCAGG - Intronic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1091840015 12:3614018-3614040 CTGTGGGGGCCTGGGTCTGCAGG + Intronic
1092262981 12:6962423-6962445 CCCTGGGGCTGTGGCCCTCCAGG + Intergenic
1094113315 12:26884011-26884033 CTCTTGGGCCTGGGATCTCCTGG + Intergenic
1096777830 12:53974663-53974685 TTCCGGGGCCCTGGCGCCCCGGG - Intronic
1096793575 12:54060347-54060369 CTCTGGAGCTCTGGCTTCCCGGG + Intergenic
1096865722 12:54561520-54561542 CTTGGGGGCCCTGGGGCTCCTGG + Intronic
1097053325 12:56236575-56236597 CCCTGAGCCCCTGGCTCTGCGGG - Exonic
1097147876 12:56954122-56954144 CTCTGGGGCTCTTCCTCTCTAGG - Intronic
1097264532 12:57737872-57737894 CTCCGGGACCCCCGCTCTCCGGG - Exonic
1097450627 12:59733547-59733569 CTTTGGGGCTCTGTGTCTCCTGG - Intronic
1098770762 12:74550325-74550347 CACTGGGGCACAGGCTCACCAGG - Intergenic
1101351183 12:103930827-103930849 CTCTGAGGCTCTGGCTCCCCCGG + Intronic
1102044845 12:109823256-109823278 CACTGGGGCTCTGTCTGTCCTGG - Intronic
1102297001 12:111744966-111744988 CTCTGCAGCTCTGGCTCTGCAGG - Exonic
1103197790 12:119060308-119060330 CTTTGGATCCATGGCTCTCCTGG - Intronic
1103370250 12:120414036-120414058 CTGGGGAGCGCTGGCTCTCCAGG - Intergenic
1103724463 12:122990851-122990873 CTCTGGGCCCCTTCCTCTCACGG - Intronic
1104113013 12:125721832-125721854 TTCTGGGGCCCTGGGTATTCTGG + Intergenic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1104418421 12:128614987-128615009 CACAGTGGCCCTGGTTCTCCTGG - Intronic
1104665238 12:130643070-130643092 CTCAGGGGTCCTGGCTCAGCTGG + Intronic
1105378287 13:19863974-19863996 CTCGGGGCCCGGGGCTCTCCGGG + Intergenic
1105388934 13:19958374-19958396 CTCGGGGCCCGGGGCTCTCCGGG - Intergenic
1105417378 13:20225008-20225030 CTCTGAGGCCAAGGCACTCCTGG - Intronic
1105599142 13:21870171-21870193 TTCTGGGACCCTGGCTCTACTGG + Intergenic
1106335424 13:28778632-28778654 CTCTGGGACCATCTCTCTCCGGG + Intergenic
1106509975 13:30404428-30404450 GTCTGAAACCCTGGCTCTCCAGG - Intergenic
1106666304 13:31854426-31854448 CTCTCAGGCCCTTGCTTTCCTGG + Intergenic
1107420347 13:40240179-40240201 ATCTGGGGCACTGGAGCTCCAGG - Intergenic
1107941404 13:45381329-45381351 CTCTTGCCCCCTGGCTCTCAGGG - Intergenic
1109538278 13:63742081-63742103 CTCTGAGTCCCTGCCTCTCGGGG + Intergenic
1109545560 13:63837691-63837713 CTCTGAGTCCCTGCCTCTCGGGG - Intergenic
1110810756 13:79808500-79808522 CTTTGGGGCCCTGCATTTCCTGG + Intergenic
1111919503 13:94395873-94395895 CACTGTGGCCCTGGCCCTCCAGG + Intronic
1113565510 13:111317422-111317444 CTCTGGTGCCCTGGTGCTCAGGG + Intronic
1113937621 13:114002755-114002777 GTCTGGGCGCCTGGCTCTCCAGG + Intronic
1113939600 13:114011542-114011564 CTCTGGGGCGCTGAGTCTCGGGG + Intronic
1113944842 13:114038348-114038370 CGCTGGGGCCCTTGTGCTCCGGG + Intronic
1114482104 14:23042339-23042361 GTCTGGGGCCATGGATCTGCAGG - Exonic
1115640772 14:35334399-35334421 CTCAGTGGCCCTGGCTCAGCTGG + Intergenic
1115879526 14:37899495-37899517 CTCTTGTGCCCTGGAGCTCCCGG + Intronic
1116164963 14:41323540-41323562 CCCTGGGGCGCTGACCCTCCAGG - Intergenic
1117742519 14:58833651-58833673 GTCTGGAGCCCTTGCTCTCTTGG - Intergenic
1118982010 14:70724764-70724786 CCCTGGGGCCCTCGCTCCCCAGG + Intronic
1119049721 14:71354937-71354959 CCCCCGGGCCCTGGGTCTCCAGG - Intronic
1119425355 14:74531501-74531523 CTCTGGGCCCCTCACTCTCTGGG + Intronic
1119526477 14:75326626-75326648 CTCTGTTGCCCAGGCACTCCAGG - Intergenic
1119640194 14:76309000-76309022 CTCTAGAGCCCTGTCTCTGCAGG + Intergenic
1119745823 14:77043265-77043287 TTCTGGGAAGCTGGCTCTCCGGG - Intergenic
1120730730 14:87998144-87998166 CTCTGGAGCCCCAGGTCTCCTGG + Intergenic
1121039268 14:90731614-90731636 CTCTGCACCCCTGACTCTCCGGG + Intronic
1121227408 14:92331216-92331238 CTCTGAGTCCCTGGCTGTCATGG + Intronic
1121716482 14:96079769-96079791 ATCTGTGGCCCAGGCTCTCTGGG - Intronic
1121757742 14:96417131-96417153 CTCTGTAGCCCTGGCTCACATGG - Intronic
1121825631 14:97007735-97007757 CGCTGTGGCCCGGGGTCTCCTGG + Intergenic
1121828616 14:97030908-97030930 CTCTGGGGGGCTGGCTGTCTAGG + Intergenic
1122371959 14:101233929-101233951 CTCTGGGGCTCTGGGGCTCTGGG - Intergenic
1122410207 14:101521849-101521871 CTCTGATGCCCCAGCTCTCCAGG + Intergenic
1122716163 14:103698257-103698279 CTCTGGGTCCTTGGCTCCCGGGG - Exonic
1122716887 14:103701258-103701280 CCCTGCCGCCCTGGCTGTCCCGG - Intronic
1123053498 14:105559034-105559056 CTCTGGGGCTCTGGAGCCCCTGG + Intergenic
1123078075 14:105679448-105679470 CTCTGGGGCTCTGGAGCCCCTGG + Intergenic
1124674693 15:31674252-31674274 CTCTTGGCCACCGGCTCTCCTGG - Intronic
1125519611 15:40340522-40340544 CCCAGGGGCCCAGCCTCTCCAGG + Intronic
1125592161 15:40861567-40861589 CTCTGGGGACCTAGCAATCCAGG + Intergenic
1125600226 15:40911497-40911519 CTCTGAGGCCCTGGCTGCCCTGG - Intergenic
1126412728 15:48388631-48388653 CTCTGGGCCCCTTGATGTCCCGG + Intergenic
1127835027 15:62783833-62783855 CTATGGGCACCTGGCTTTCCAGG + Exonic
1128531398 15:68450738-68450760 TTCTGGGGCCATGGCTGACCTGG - Intergenic
1128679450 15:69637301-69637323 CTCTAGGGCCCTGGTTCACAGGG + Intergenic
1128726451 15:69991702-69991724 CTCTGAGCACCTGGCTCCCCAGG + Intergenic
1129325827 15:74799890-74799912 CTCAGGGGCCCTGGCGATCAAGG - Intronic
1129329361 15:74819086-74819108 CTCTGACTCCCTGGCTCCCCTGG - Intronic
1129536357 15:76316341-76316363 TTCCGGGGCCCTGGCTAGCCAGG + Intergenic
1129660710 15:77551359-77551381 CTCTGAGGCCCTGGCTGGCCTGG + Intergenic
1130086379 15:80780816-80780838 GTCTGTGGCCCTGGGTCTCCGGG + Intronic
1130801348 15:87266840-87266862 CTCTGTGGCTCTGCCTCTGCTGG - Intergenic
1131094882 15:89648797-89648819 CTCAGGGGCCCCGACGCTCCAGG + Intronic
1131134710 15:89925026-89925048 CTCTGGGGGACTGGGGCTCCAGG + Intergenic
1131161315 15:90106737-90106759 CTCTGGAGTCCTGCCTCTCTTGG - Intergenic
1131873062 15:96780190-96780212 CTCTGGGGACATGCCTCTCTTGG - Intergenic
1132128457 15:99251512-99251534 CTCCGGAGCGCTGGCTCTGCTGG + Exonic
1132516102 16:366731-366753 CTCTGAGGGCCTGCCCCTCCTGG + Intergenic
1132675933 16:1121264-1121286 CTCTGGGGCCCGGGAACCCCCGG - Intergenic
1132700048 16:1218470-1218492 CCCTGGCGCCCGGACTCTCCTGG - Exonic
1132767762 16:1543115-1543137 CTCTGTGTCCCTGTCTCTGCGGG - Intronic
1132805505 16:1773367-1773389 CGCTGGGTCCCGGGCTCTCGCGG - Exonic
1132853007 16:2033235-2033257 CTCTGCGGCCCTGGCTCCCCGGG - Intronic
1133029039 16:3001023-3001045 CTCAGGGTCCCGGGCTCTTCTGG - Intergenic
1133267607 16:4594300-4594322 CTCTGGGGTACAGGGTCTCCAGG + Intronic
1133267737 16:4594836-4594858 GCCTGGGGCCCTGGTTCTGCTGG + Intronic
1133305302 16:4804548-4804570 AGATGGGGCCCTGGCTTTCCAGG - Exonic
1133978829 16:10619008-10619030 CTATCGGGCCCTGGCTAGCCCGG + Intergenic
1134042978 16:11082296-11082318 CCCTAGGGCCCTGGCCCTGCAGG - Intronic
1134101081 16:11451966-11451988 GGGTGGGGACCTGGCTCTCCAGG - Intronic
1135179515 16:20260665-20260687 CTTTGGGGTCCTCGGTCTCCAGG + Intergenic
1136488006 16:30585553-30585575 CTCCGGGGCCCGGCCTCCCCGGG + Exonic
1136576399 16:31127798-31127820 CTCTGTGGGCCTGGCTCTGGAGG - Intronic
1137044333 16:35642012-35642034 CCACGGGGCCCTGGCTCTCCTGG - Intergenic
1138520915 16:57570413-57570435 CTCAGGGGCCCCAGCCCTCCTGG + Exonic
1139593075 16:67943887-67943909 GGCTGGGGCCCAGGCTCCCCAGG + Exonic
1139682995 16:68580279-68580301 CTTTGGGGGCCAGGCACTCCCGG - Intergenic
1139720348 16:68847349-68847371 CTATGGGGACCTGGCTTGCCGGG - Intronic
1139923693 16:70474444-70474466 CTTTGGGGACCTGACTGTCCCGG - Intronic
1140478751 16:75251495-75251517 GCCTGGGGCCCCGGCTCTCGCGG + Intronic
1140509886 16:75499245-75499267 CCCTTGGGCCCTGCCCCTCCAGG + Intergenic
1140515678 16:75539454-75539476 CCCTTGGGCCCTGCCCCTCCAGG + Exonic
1141403355 16:83770300-83770322 CTCTGTGGCTCTGGCTCTTATGG + Intronic
1141538655 16:84700489-84700511 CTCTGGGGCCCCTGCGCTCCAGG - Intronic
1141675562 16:85515569-85515591 GTCTGGGCCCCTGGCGCCCCAGG - Intergenic
1141897110 16:86965125-86965147 CTGTGGAGCCCTGCCTGTCCTGG - Intergenic
1142027546 16:87822692-87822714 CTCTGGGGCTCTTCGTCTCCAGG - Intergenic
1142107691 16:88315163-88315185 CCCTGGAGCCCTGGCCCTCGGGG - Intergenic
1142156072 16:88533390-88533412 GCCTGGGGCCCAGGCTCTCCGGG - Exonic
1142366250 16:89651531-89651553 CTGTGGGGTCATGACTCTCCTGG - Intronic
1143527776 17:7482428-7482450 CACTGAGACCCTGGCTCTCAAGG - Exonic
1143633022 17:8149531-8149553 CTCTGAGCTCCTGGCTCCCCAGG - Exonic
1144677039 17:17168348-17168370 CAACTGGGCCCTGGCTCTCCGGG - Intronic
1144774696 17:17779402-17779424 CTGTGGGGCCCACGCTGTCCTGG - Intronic
1144967847 17:19089223-19089245 CTCTGGCGCGCTGTCTCTGCGGG - Intergenic
1144980070 17:19162840-19162862 CTCTGGCGCGCTGTCTCTGCGGG + Intergenic
1144988152 17:19215392-19215414 CTCTGGCGCGCTGTCTCTGCGGG - Intergenic
1145943945 17:28759307-28759329 CCCTCAGGCCCTGGCTCACCAGG - Exonic
1146249417 17:31325374-31325396 CTCTTTGGCCCTGGTTGTCCTGG + Intronic
1146543661 17:33719310-33719332 CTCCTGGGTCCTGGCTCACCAGG - Intronic
1146730985 17:35193842-35193864 CACTGAGACCCTGGCTCTCAAGG + Exonic
1147597766 17:41727709-41727731 CTCTGGGCCAGCGGCTCTCCAGG + Intronic
1147740259 17:42667341-42667363 ATCTGGAACCTTGGCTCTCCTGG - Intergenic
1147884020 17:43672459-43672481 CCCTGGTGTCCTGCCTCTCCTGG - Intergenic
1148075509 17:44933224-44933246 CCAGGGAGCCCTGGCTCTCCTGG - Intronic
1148506445 17:48131187-48131209 ATTTGGGTCCCTGGGTCTCCAGG + Intergenic
1148792673 17:50182316-50182338 CTTTAGGACCCTGGCTGTCCAGG - Intergenic
1148999500 17:51742407-51742429 TAATGGGGCCCTGGCTCTCAAGG + Intronic
1149490065 17:57078124-57078146 CTCAGGTGCCCTGGCTTCCCAGG - Intergenic
1149517862 17:57294035-57294057 CTCTGTGGTACTGTCTCTCCAGG + Intronic
1149661814 17:58338126-58338148 CTCTGGGGCTCTGGGGCTCTGGG - Intergenic
1149867550 17:60159094-60159116 CTCTGAACCCCTGGCTCTCAAGG - Intronic
1150217281 17:63477601-63477623 CTCTGGGGCCCCCGCGCTCTCGG + Intergenic
1150283273 17:63941592-63941614 CACTGGTGCCCGGGTTCTCCAGG + Exonic
1150951067 17:69802490-69802512 CTCTGGGGCCCTGCAGTTCCTGG + Intergenic
1151197192 17:72440040-72440062 CTCTGGTGCCCTGTTTCCCCAGG + Intergenic
1151234202 17:72706823-72706845 GGCTGGGGCCCAGGCTCTTCAGG - Intronic
1151346570 17:73506293-73506315 CTCTGGGCCTCCGGTTCTCCAGG - Intronic
1151348273 17:73516493-73516515 CTCTGGGGCCCTGGCTGGTGAGG - Intronic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1151975686 17:77482544-77482566 CTCAGGGGCCCTGGATGTGCAGG - Intronic
1152112853 17:78366629-78366651 GTCAGGTGCCCTGACTCTCCTGG + Intergenic
1152227915 17:79101311-79101333 CTCTGGGGGCCAGGCACGCCTGG + Intronic
1152381934 17:79946671-79946693 CTCTGTGGCCCTGGCCTTCAAGG + Intronic
1152395668 17:80031335-80031357 CTTTGGGCCCCAGGCTTTCCGGG - Intronic
1152597772 17:81246303-81246325 CTCTGGGCCCCCGGCTTCCCTGG + Exonic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152691521 17:81720279-81720301 CTCTGGCTACCAGGCTCTCCCGG + Exonic
1152932784 17:83118699-83118721 TCCTGGAGCCCCGGCTCTCCCGG - Intergenic
1153682305 18:7512094-7512116 CTCTGGGGTCCTGCGGCTCCTGG + Intergenic
1154204972 18:12328535-12328557 CCCCTGGGCCCTGGCTCTCTGGG - Intronic
1154326376 18:13393763-13393785 CTCTGGGGGCCTTGAACTCCAGG - Intronic
1155214938 18:23634938-23634960 CTCTGGGGCCATTGCCCTCATGG + Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1157570406 18:48708631-48708653 CTCTGAGGTCCTCCCTCTCCAGG - Intronic
1157752817 18:50194311-50194333 CTCTGCGGCGCCGGCTCTCGAGG - Intronic
1160223845 18:76997370-76997392 CCCTGGGGCCCTGGGGCTTCTGG + Intronic
1160339021 18:78070546-78070568 CAGTGCAGCCCTGGCTCTCCTGG - Intergenic
1160488769 18:79319356-79319378 CTAGGGGTCCCTGCCTCTCCTGG + Intronic
1160598420 18:79993966-79993988 GCCTGGGGACCTGGCTCTTCAGG - Intronic
1160829713 19:1098090-1098112 CTCTGGGGCTGTGCCTCACCTGG + Intergenic
1160983236 19:1826324-1826346 CCCTGGACCCCTGGGTCTCCTGG - Intronic
1161038442 19:2097809-2097831 CACTGGGGCCCAGGCTCACCTGG - Intronic
1161201802 19:3019343-3019365 GTCTGGAGCCCTGGCTGCCCAGG - Exonic
1161315324 19:3614827-3614849 CGCTGGGGGCCTGGGCCTCCAGG - Intronic
1161481695 19:4513893-4513915 GTGTGGCACCCTGGCTCTCCGGG + Intronic
1161509330 19:4661918-4661940 CTCTGGGGAGCTGGCACTCAGGG + Intronic
1161625624 19:5324914-5324936 TTCTGGGGATGTGGCTCTCCTGG - Intronic
1161770885 19:6230141-6230163 CTCTGGGACCAGGGCTCTCCAGG - Intronic
1161778740 19:6278216-6278238 CTCTGCTGCCCTGGCTTTCAGGG - Intronic
1161812599 19:6479219-6479241 CTCTGGGTCCCTGGATCTCTGGG + Intronic
1161812609 19:6479251-6479273 CCCTGGGTCCCTGGATCTCTGGG + Intronic
1162986217 19:14271879-14271901 CTCTTGAGCACTGGCTCTCTTGG + Intergenic
1163476070 19:17526912-17526934 CTCTGGGGTCCAGCCTCACCGGG + Intronic
1163666468 19:18606189-18606211 CTCTGGGCCCCTGGGACTGCAGG - Intronic
1163688966 19:18728190-18728212 CCCTGGTGTCCTGGCCCTCCCGG + Intronic
1163810485 19:19428619-19428641 CTCTCGCTCCCTGGCACTCCAGG - Intronic
1163884523 19:19954106-19954128 CTGTGGGGCCCCAGCTTTCCAGG + Intergenic
1163915035 19:20233777-20233799 CTGTGGGGCCCCAGCTTTCCAGG + Intergenic
1163939857 19:20481546-20481568 CTGTGGGGCCCCAGCTTTCCAGG - Intergenic
1163948539 19:20563201-20563223 CTGTGGGGCCCCAGCTTTCCAGG + Intronic
1164095519 19:22006540-22006562 CTGTGGGGCCCCAGCTTTCCAGG + Intronic
1164114988 19:22211225-22211247 CTGTGGGGCCCCAGCTTTCCAGG + Intergenic
1164874711 19:31675779-31675801 CTCTGGGGCCCTGGATGGTCTGG - Intergenic
1165393980 19:35553974-35553996 CAGTGGGGCCCAGGCTGTCCAGG - Intronic
1165813658 19:38627782-38627804 CTCTGGGTCCCTTGCTCTCTTGG + Intronic
1166304156 19:41928173-41928195 CTCTGGGTCTCTGCCTCCCCGGG - Intronic
1166313651 19:41976665-41976687 CCCTGGTCCTCTGGCTCTCCTGG - Intronic
1166442097 19:42823896-42823918 CTCCCGGGCCCTGCCTCTCCTGG - Intronic
1166461521 19:42992179-42992201 CTCCCGGGCCCTGCCTCTCCTGG - Intronic
1166478814 19:43152164-43152186 CTCCCGGGCCCTGCCTCTCCTGG - Intronic
1166501487 19:43344495-43344517 CTCCCGGGCCCTGCCTCTCCTGG - Intergenic
1166508629 19:43388963-43388985 CTCCCGGGCCCTGCCTCTCCTGG + Intergenic
1166725541 19:45025221-45025243 CTGTGGGGCTCAGGCTCTCAGGG - Intronic
1166936256 19:46334998-46335020 CTCTGGGGCTCTGGATACCCAGG - Intronic
1166941298 19:46367736-46367758 CACTTGGTCCCTGCCTCTCCAGG - Intronic
1167295229 19:48645702-48645724 TTCTGGGACCCTGTCCCTCCAGG + Exonic
1167348405 19:48960997-48961019 CTCTGGGACCCTGGGCCTTCTGG + Exonic
1167426436 19:49432148-49432170 CCCTAGGACCCTGTCTCTCCAGG + Intronic
1167446862 19:49543001-49543023 CTCTGGGACCCTTGTTCTCTGGG - Intronic
1168346876 19:55654257-55654279 TTCTCGGCACCTGGCTCTCCGGG - Intronic
1168494900 19:56840120-56840142 CTCGGGAGCCCTGGGCCTCCTGG - Intronic
1168719746 19:58548545-58548567 CTCAGGGGCCCTGGGGCTCTTGG - Exonic
925371479 2:3348802-3348824 CTCTGGAGCTCCAGCTCTCCTGG - Intronic
926043069 2:9690321-9690343 CTCTGTGGCCCTGACACCCCAGG + Intergenic
926450646 2:12999956-12999978 CTTTGGGGCCCTGCCTGTCATGG + Intergenic
927193323 2:20531813-20531835 TTCTGGGGCTCTGGCTCTTTTGG - Intergenic
927481482 2:23457441-23457463 TTCTGGGGCCCTTCCCCTCCAGG + Intronic
927658492 2:24971899-24971921 CTCCATGGCCCTGGCTCTCTCGG + Exonic
927717905 2:25364361-25364383 GTCTGGGGCCCTGCTTCTCAGGG - Intergenic
928042187 2:27890161-27890183 CTTTTGGGCGCTGGGTCTCCAGG - Intronic
928071836 2:28224874-28224896 ATCTGGGGCCCTGTTTCTCAAGG + Intronic
928376495 2:30778807-30778829 CTCTCAGGCCCAGGCCCTCCCGG + Intronic
929557886 2:42936836-42936858 CTCTGGGCCCATCCCTCTCCAGG + Intergenic
929576449 2:43055685-43055707 CTCTAGGGCCCTGTGGCTCCAGG - Intergenic
930062015 2:47297871-47297893 TTCTGGTGCCCTGGCTTTACTGG - Intergenic
932416998 2:71579528-71579550 CTATGGGGTCCTGGATCCCCTGG - Intronic
932440422 2:71731285-71731307 CGCTGGGCCCCAGGCTCCCCTGG - Intergenic
932819693 2:74889130-74889152 CTGTGGGGGTCTAGCTCTCCAGG - Intronic
933587595 2:84196147-84196169 TTATGGGGCCCTGGCTCTTTAGG + Intergenic
933710515 2:85322332-85322354 CCCTGGGGCCCGGGCTCTGTAGG - Exonic
933858642 2:86442163-86442185 CCGAGTGGCCCTGGCTCTCCGGG + Exonic
935746780 2:106195731-106195753 CTCTGGGGGCCTGGCCCCTCTGG - Intergenic
938370014 2:130762906-130762928 CCCTGGGAACCTTGCTCTCCAGG - Exonic
939178740 2:138780690-138780712 CTCTGGGGCACCGGCTGGCCAGG - Intergenic
940816802 2:158305791-158305813 CTCTGAGGCACAGGCTCACCAGG + Intronic
941217593 2:162733084-162733106 CTCTGGGGCCAGGACTTTCCAGG + Intronic
943699294 2:190972414-190972436 CACTGGTGCTCTGGCTCTCTTGG + Intronic
943877416 2:193088884-193088906 CATTGGGGCCCTGGTTCTGCAGG + Intergenic
945059471 2:205896255-205896277 CTGTGGGGACCTGGCTTGCCTGG - Intergenic
946339519 2:219058813-219058835 CTGTGAGGCCCGGGCTCTGCAGG - Intronic
948516158 2:238505086-238505108 CGCAGGGGCCTTGGCCCTCCTGG - Intergenic
948551774 2:238777821-238777843 CTCTGGGCCTCTGGGTCTCTGGG - Intergenic
948802014 2:240437285-240437307 CTCTGGACCCCTGCCCCTCCAGG + Intronic
948870362 2:240794815-240794837 ACCTGGGGCCCTGGCTTTCTTGG + Intronic
949000354 2:241609873-241609895 CCACGGGGCTCTGGCTCTCCTGG + Intronic
949073168 2:242039015-242039037 CTGTGGGTCACTGGGTCTCCTGG - Intergenic
1168768429 20:397879-397901 CACAGGGACCCCGGCTCTCCAGG + Intergenic
1169146953 20:3259004-3259026 CTCTGGAGCCCTTGCTGTCCTGG - Intronic
1170216805 20:13900394-13900416 CTCAGGGGCCCTGGGTTTTCTGG + Intronic
1171239164 20:23551218-23551240 CTCTGGGGCCCTGGGGCTGAGGG + Intergenic
1171330294 20:24331470-24331492 CTCTTGGCCCCTGGCACCCCAGG + Intergenic
1171395284 20:24829184-24829206 CTCTGGGGCCCTGCATCACCTGG - Intergenic
1172022761 20:31925880-31925902 CGCTGCGGGCCTGGCTCTACCGG + Intronic
1172111095 20:32545498-32545520 ATGTGTCGCCCTGGCTCTCCAGG - Intronic
1172347118 20:34210311-34210333 CTTTGGGGCCCTGTGACTCCTGG + Intronic
1172645076 20:36463911-36463933 CTGTGGGTCCCTGGCCCTTCTGG - Intronic
1172848603 20:37944769-37944791 TTCTGGGGCAGTGGCTCTGCAGG + Exonic
1174353591 20:49984167-49984189 CTCTGAGGCCAAGGATCTCCAGG + Exonic
1174609852 20:51790235-51790257 CTCTGCTGCCCTGGCGCTGCAGG + Exonic
1175426255 20:58869156-58869178 CCCTGGTGCCCCGGTTCTCCTGG + Intronic
1175996048 20:62812801-62812823 CTCTGAGGGCCTGGCTCTGTGGG - Exonic
1176054094 20:63135123-63135145 CTCTAAGGCCCTGCCTCCCCTGG - Intergenic
1176230063 20:64028024-64028046 CTCTGTGGAGCTGGCTCTCCGGG - Intronic
1176239135 20:64067888-64067910 CTCCTGGCCCCTGGCTCCCCTGG + Intronic
1177947950 21:27496084-27496106 CTCTAAGGCCCTGGATCTCTGGG + Intergenic
1178741661 21:35207157-35207179 CCCTGGGGCCCGGGCTCTCTGGG + Intronic
1179730560 21:43365103-43365125 CAGTGTGGCCCTGCCTCTCCAGG - Intergenic
1179809343 21:43860551-43860573 CCGAGGGCCCCTGGCTCTCCCGG + Intergenic
1179880072 21:44289868-44289890 CTCTGGGGGAGTGGCTCTGCTGG + Intronic
1179902911 21:44403046-44403068 TGCTGTGGCCCTGGCTCTGCTGG + Intronic
1179921653 21:44510690-44510712 CCCTGCAGCCCAGGCTCTCCGGG - Intronic
1180078073 21:45473224-45473246 CTCTCGGGCCCTGGCGCGGCCGG - Intronic
1180159347 21:45992170-45992192 CCGGGGGGCCCAGGCTCTCCCGG - Exonic
1180160684 21:45997580-45997602 CTCTATGGCCCTGGGTGTCCTGG + Intronic
1180227569 21:46404584-46404606 GACTGGGGCCTTGGCTTTCCAGG + Intronic
1180612324 22:17105960-17105982 CGCTGGGGCTCTGGCTGTCCTGG + Intronic
1180985135 22:19899552-19899574 CTCTGGGGAGCTGGCCCTCCTGG - Intronic
1181000163 22:19984348-19984370 CTGCGGGGGCGTGGCTCTCCTGG - Intronic
1181008257 22:20024843-20024865 CTCTGGCCCCCAGGGTCTCCAGG + Intronic
1181050188 22:20234660-20234682 GGCTGGGGCCCTGGCTCCCAAGG + Intergenic
1181546758 22:23606676-23606698 CTGTGGGGCCCAGGCACACCAGG - Intergenic
1182031163 22:27160455-27160477 CTCTGGGGTCTTTGCTCTCTGGG + Intergenic
1182117981 22:27768323-27768345 CCCTGGGGGCCTGGTTCTCCAGG - Intronic
1182255072 22:29032019-29032041 CTCTGGCGCCTTGGCTCTCTGGG - Intronic
1182549176 22:31091757-31091779 CCCTGGGACCCTGGCTCGGCTGG + Exonic
1183094884 22:35546055-35546077 CTCCGGGCCTCTGGGTCTCCTGG + Intronic
1183263675 22:36812664-36812686 CTCTGGGCCCCAGGCTATCTGGG - Intronic
1183310037 22:37104591-37104613 GTCTGGAGCCTTTGCTCTCCCGG - Intronic
1183536049 22:38402004-38402026 CTGAGGGGCTCGGGCTCTCCGGG + Intergenic
1184004286 22:41697260-41697282 CCCTGGTGGCCTGACTCTCCTGG - Exonic
1184273445 22:43397621-43397643 AACAGGGGCCCTCGCTCTCCAGG + Intergenic
1184384854 22:44168207-44168229 CTCTGGGGCCCTGGAAGTCTTGG - Intronic
1184506911 22:44909371-44909393 CTGTGAGGCCCTGGCTCGGCTGG - Intronic
1184522138 22:45001065-45001087 CTATGGGGCCCTTGCTCTTCCGG + Intronic
1184993202 22:48184345-48184367 CTGTGGGGCCCTGGGTCCACTGG - Intergenic
949937117 3:9124589-9124611 CTTCAGGGCCCTGGCTCTGCAGG - Intronic
950128910 3:10528318-10528340 CTGTTTGGCCCAGGCTCTCCTGG - Intronic
950451268 3:13067132-13067154 CTCTGAGGCCCTGGCCCACCTGG - Intronic
951194045 3:19804189-19804211 ATCTGGAGCTCTGACTCTCCTGG + Intergenic
952925783 3:38318362-38318384 GTCTGGGGGCCTGGCCCTCAGGG - Exonic
952942177 3:38453773-38453795 CTCTGGGGCCCCGCCCCTCAGGG + Intergenic
954294509 3:49666726-49666748 CACTGTGGCCCTGGCTATACTGG - Intronic
954610730 3:51943345-51943367 CTTTGGAGCCATGGCTGTCCTGG - Exonic
954710616 3:52503537-52503559 GCCTGGGACCCTGGCTCACCTGG - Exonic
954952828 3:54490343-54490365 CTCCCACGCCCTGGCTCTCCGGG + Intronic
954982830 3:54761689-54761711 CTTTGGGGCCCTGTTTCCCCTGG + Intronic
955224593 3:57050395-57050417 CTCTGTGGCCTTGGCCTTCCAGG - Intronic
957053804 3:75429457-75429479 CTCTGTTGCCCAGGCTGTCCTGG - Intergenic
957154620 3:76532054-76532076 CTCTTACGCCCTGCCTCTCCTGG + Intronic
957329530 3:78743710-78743732 CTCAGGGGCTCAGGCTCTCAGGG + Intronic
961007966 3:123417415-123417437 CTCTGGGGACCTGTCTGTCCAGG - Intronic
961484393 3:127206986-127207008 CTCTTGGGCTCTGGCTCCCCTGG + Intergenic
961772011 3:129256944-129256966 CTCTGGGCTTCTGGCCCTCCAGG + Intronic
962141246 3:132792864-132792886 TTATGGGGCCCTGACTCTGCAGG + Intergenic
962854280 3:139329993-139330015 CTGTGGGTCTCTGGCTCCCCTGG + Intronic
962866144 3:139449384-139449406 CTCAGAAGCTCTGGCTCTCCTGG + Intergenic
963925164 3:150943788-150943810 CTCTGGGGCCCTGGGGTTGCAGG + Intronic
964590876 3:158361017-158361039 CCCTGTGGCCCTGGCTCTCAGGG + Intronic
964706549 3:159624755-159624777 CCTTGGGGCCCTGGATCTCTGGG - Intronic
965145693 3:164899462-164899484 CTCTGTGGCCTTGGTACTCCAGG - Intergenic
966914614 3:184577899-184577921 CTCTGGGGCCCAGCAGCTCCAGG + Exonic
967983360 3:195078472-195078494 CTCTCGTGCCCTGGCCCTCTGGG + Intronic
967991474 3:195134680-195134702 AGCTGGGGCCCTGGCTTCCCCGG + Intronic
968074277 3:195808001-195808023 CTCTAGGGCCATGGCCCTCGGGG + Intronic
968091520 3:195901103-195901125 CTCTGGCTCCCAGGCTCTCCTGG - Intronic
968457422 4:706512-706534 GTCTGGGGTCTTGGCCCTCCCGG - Intronic
968457462 4:706614-706636 GTCTGGGGTCTTGGCCCTCCCGG - Intronic
968463475 4:737567-737589 CTCTGCAGCCCCTGCTCTCCTGG + Intronic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
968699601 4:2048265-2048287 CTCCAGCCCCCTGGCTCTCCAGG + Intergenic
968757873 4:2426197-2426219 CTCAGGGGCCCAGGCTGGCCTGG - Intronic
968797356 4:2716389-2716411 TTCTGAGGCGGTGGCTCTCCAGG + Intronic
969307789 4:6335667-6335689 CTCTGCAGCCCTGGCCCACCGGG - Intronic
969323379 4:6426467-6426489 GTCTGGGGCTCTGTCTCTCCTGG - Intronic
969431471 4:7157342-7157364 GCCTGGGGCACTGGCTATCCAGG - Intergenic
969554177 4:7894922-7894944 CTCTCTGCCCCTGGCTCCCCAGG + Intronic
969574788 4:8030509-8030531 GTCTGGGCCCATGGCTCCCCTGG + Intronic
974291777 4:59942105-59942127 CTCTGGAACCATGGCTCACCAGG - Intergenic
980450052 4:132958858-132958880 CTCAGGGGCCCAGGAACTCCCGG + Intergenic
981391381 4:144195643-144195665 CTCTGTGGCCCTGGTTCCCCAGG - Intergenic
982918817 4:161249264-161249286 CTCTGGGGCTCTGTGGCTCCTGG - Intergenic
985007903 4:185552620-185552642 CTTTAGGGCCCTTGTTCTCCTGG + Intergenic
985550520 5:531287-531309 CTTTGAGGCCCTGGCCCCCCAGG + Intergenic
985718299 5:1475369-1475391 CTCCTGGTCCCTGGCTCACCTGG - Intronic
985757918 5:1730263-1730285 CTCTGTGACCATGGCTGTCCTGG + Intergenic
986132451 5:4943564-4943586 CTCTGTGGCCCTCACACTCCGGG - Intergenic
986386347 5:7237822-7237844 TTCTTGAGCCCTGGTTCTCCAGG + Intergenic
990987980 5:61658854-61658876 CTCTGGGGCCCCCCTTCTCCTGG - Intronic
990988483 5:61662294-61662316 CGCAGGGACCGTGGCTCTCCCGG - Intronic
992382893 5:76256057-76256079 CTCTGCAGCCCTTGCTCTCAAGG + Intronic
992883542 5:81134451-81134473 AGCTGGTGCACTGGCTCTCCAGG + Intronic
995462546 5:112419230-112419252 CTCCCGGGCGCTGACTCTCCCGG - Exonic
996838108 5:127816499-127816521 ATCTGGTTCTCTGGCTCTCCTGG - Intergenic
997389627 5:133503563-133503585 GTCAGTGGCTCTGGCTCTCCAGG + Intronic
998487146 5:142512741-142512763 CTCTGAGGCCCTGCCTGACCTGG + Intergenic
999730324 5:154472757-154472779 CGCTGCCACCCTGGCTCTCCAGG - Intergenic
999948281 5:156621145-156621167 CTCTGGGTCCCTGCCTTTCTAGG + Intronic
1002080058 5:176732460-176732482 CTCTGGGACCCTGCTTGTCCTGG - Intergenic
1002782786 6:379951-379973 CTCTGGGGTCCTGCCTCCCGGGG + Intergenic
1005253425 6:23972985-23973007 CTCTGCTGCCCTGTTTCTCCTGG - Intergenic
1005873619 6:29995237-29995259 CTCCTGGTCCCTAGCTCTCCAGG - Intergenic
1006295781 6:33169426-33169448 CCTGGTGGCCCTGGCTCTCCTGG + Exonic
1006364339 6:33606546-33606568 GTTTGGGGCCTAGGCTCTCCAGG - Intergenic
1006474157 6:34244366-34244388 CTGTGGTGCCCTGGCCCTCCGGG - Intronic
1006934738 6:37709663-37709685 CTCAGGGGCCCTGGCCCTTTTGG - Intergenic
1007292169 6:40796267-40796289 CTCTGGAGCCCAGGCTGTCTGGG - Intergenic
1007663223 6:43499128-43499150 CTCAGGGGCCTTGCCTCTGCCGG - Intronic
1008464647 6:51817074-51817096 TTCTGGGGCCAAGGCTATCCTGG - Intronic
1011422153 6:87184831-87184853 CTCAGGGGCCTTTGTTCTCCAGG - Intronic
1011753384 6:90475496-90475518 TTATGACGCCCTGGCTCTCCTGG - Intergenic
1013235870 6:108197583-108197605 CACCTGGGCACTGGCTCTCCTGG + Intergenic
1014286417 6:119503705-119503727 CTCTGCTGCCCTAACTCTCCTGG - Intergenic
1014814283 6:125918323-125918345 CTCTGGGCCCCTGGGACTCCAGG - Intronic
1016109577 6:140206033-140206055 CTCAGAGGCGCGGGCTCTCCCGG - Intergenic
1017134966 6:151140051-151140073 ATCTGGGCCTCTGGTTCTCCTGG - Intergenic
1017758712 6:157551557-157551579 CTCTTGGGCCCTGACTCACCTGG + Intronic
1018731350 6:166653424-166653446 CTGTGTGGGCCTGGCTCTGCTGG - Intronic
1019088428 6:169502702-169502724 CACTGGGGCCCTGGGTCACCCGG + Intronic
1019129636 6:169864336-169864358 CTCTGTGGACCTGTCTCTCCCGG - Intergenic
1019167572 6:170108741-170108763 CTCTGGGGCCTGAGCTTTCCAGG + Intergenic
1019409654 7:900935-900957 CTCTGTGGCCCTGGTGCTGCTGG + Intronic
1019434069 7:1012754-1012776 CCCAAGGCCCCTGGCTCTCCGGG - Intronic
1019457503 7:1138122-1138144 CCCCGGGGCTCTGGGTCTCCTGG + Exonic
1019500209 7:1360839-1360861 TTCTGGGGCCCTGCCTCTGAGGG + Intergenic
1019642660 7:2112694-2112716 CCCTGGGGCCCTGACACACCCGG + Intronic
1019928037 7:4206099-4206121 CGCTTGGGCCCCAGCTCTCCAGG - Intronic
1022814926 7:33904948-33904970 CCCTGGGGCCCTGGCCTCCCTGG + Exonic
1025728713 7:64091071-64091093 CTCTGTTGCCCAGGCTGTCCTGG + Intronic
1025852055 7:65251891-65251913 CTCTGGGCCCCTGCCACGCCAGG + Intergenic
1026960310 7:74403772-74403794 CTCTGGCCGCCTGGCCCTCCAGG + Intronic
1028424474 7:90671078-90671100 GTTTGGTGCCCCGGCTCTCCTGG + Intronic
1029236000 7:99119648-99119670 CTCAGGACCCATGGCTCTCCAGG + Intronic
1029439182 7:100577843-100577865 CTCTGGGTCCCCGGGGCTCCCGG + Exonic
1029496106 7:100896032-100896054 GTCTGGGCCCCGGGGTCTCCGGG - Intronic
1031455986 7:121980153-121980175 TTCCGGGCCCCTGGCTCTCCTGG + Intronic
1031743914 7:125468942-125468964 CTCTGTGGCCCTGGCGTTCAGGG + Intergenic
1031940960 7:127788733-127788755 CACTGGTGCCCTGATTCTCCTGG + Intronic
1033554375 7:142475794-142475816 CTCAGGTGCCCTGTGTCTCCTGG + Intergenic
1033556646 7:142493896-142493918 CTCAGGTGCCCTGTGTCTCCTGG + Intergenic
1034338604 7:150338705-150338727 CCCTGAGGCACTGGGTCTCCTGG + Exonic
1034994713 7:155570606-155570628 CTCCGGGTCCCGGGCACTCCGGG + Intergenic
1035169225 7:157008814-157008836 CTCCGGGGCTCTGGCTCTCTGGG - Intronic
1035742989 8:1943289-1943311 GAATGGGGCCCTGTCTCTCCTGG - Intronic
1036663244 8:10721858-10721880 CTCTGGGCCCCTAGCTGTGCAGG - Intergenic
1036794028 8:11742712-11742734 CTCTTGAGCCCTGGGTCTTCTGG - Intronic
1036797134 8:11764471-11764493 CTCTGGGTCCTTGGGCCTCCAGG + Intergenic
1037804364 8:22050763-22050785 CTCTGGGTCCCTGGGTCCCTGGG + Intronic
1037805551 8:22056363-22056385 CTCTGGGGCCCAGCCTCTTGAGG - Intronic
1039543076 8:38387103-38387125 CGCTCGGGCCCGGGCGCTCCCGG - Intronic
1041098530 8:54373473-54373495 CCCTGGGGTGCTGGCTCCCCGGG - Intergenic
1041616729 8:59916019-59916041 CTCTGGAGCTCTGGCTATGCTGG + Intergenic
1042484658 8:69336872-69336894 CTGTGGGTCACTGGGTCTCCTGG - Intergenic
1044058454 8:87601719-87601741 CTCTGGGGTCCCAGCTCCCCAGG - Intronic
1044248849 8:89983787-89983809 CCCTGGAGACCTGGCTCTTCTGG - Intronic
1044955600 8:97476413-97476435 ATCTGAAGCCCTGACTCTCCTGG + Intergenic
1045159386 8:99520942-99520964 CTCTGTTGCCATGGCTCCCCAGG + Exonic
1045295269 8:100867177-100867199 CTCTGGGGACCTGGTGCTGCTGG - Intergenic
1047327516 8:123853947-123853969 TTCTGTGGGCCTGGCTCTCAGGG + Intronic
1048247416 8:132822418-132822440 CTCTGGAGCACTGGATCTCTAGG - Intronic
1049181967 8:141227600-141227622 CCCTGGGGGCCCGGCTCCCCCGG - Intronic
1049241563 8:141540062-141540084 CTCCGTGGCCCTGGCTCACAGGG + Intergenic
1049396317 8:142402880-142402902 CTCAGGGTCCCTGGCGCCCCTGG + Intronic
1049410845 8:142473379-142473401 GTCTGGGGCCCAGGTGCTCCGGG - Intronic
1049446226 8:142632761-142632783 CTCTGGGGCCATGGCCCTGCAGG + Intergenic
1049483951 8:142841734-142841756 CTCTGGTGCCCTCTCTCCCCAGG + Intronic
1049870739 8:144973473-144973495 TTATGAGGCCCTGACTCTCCAGG - Intergenic
1053428975 9:38029261-38029283 CTATGGGGCCATTTCTCTCCAGG + Intronic
1054808224 9:69412866-69412888 TTCTCCGGCCCTGGCTCTCCTGG - Intergenic
1056957701 9:91095826-91095848 CTGTGGGGCCTGGGCTCTGCAGG - Intergenic
1057046353 9:91889283-91889305 GCCTGGGGCCCTGGGACTCCTGG - Intronic
1057301924 9:93891503-93891525 CTCTGGGGCCCTTGCACTCTGGG - Intergenic
1057302744 9:93896143-93896165 CTCTGGGCACCTAGCTCTCACGG - Intergenic
1057410275 9:94811605-94811627 CTCTGGGACCCAGCATCTCCTGG - Intronic
1058523845 9:105837911-105837933 CTCTGGGGTCCTGGCACCCTGGG + Intergenic
1059376153 9:113883219-113883241 CTCTGAAGCCATGGCTCCCCTGG + Intronic
1059384039 9:113950305-113950327 CTCTGGGTTCCTGGCTCTGCTGG + Intronic
1059431469 9:114252912-114252934 ACCTGGGGTCCAGGCTCTCCAGG - Exonic
1059446372 9:114340738-114340760 CTCGGCTGCCCTGCCTCTCCTGG + Intronic
1060358305 9:122931354-122931376 CCCTGGGGCCCTGGATCAACCGG - Intronic
1060736521 9:126069788-126069810 CACTGGAGCCCTGGCTTCCCTGG - Intergenic
1060742227 9:126106885-126106907 CACTGGGGCCATAGCTCTCCAGG - Intergenic
1060810692 9:126610210-126610232 CTCTGCAGCCCTGGTTCTCCGGG + Intergenic
1060977012 9:127770819-127770841 CTCAGCGGCCCTGGCCCTGCTGG + Intronic
1061051403 9:128198105-128198127 CTTTGGGGCTCTGGCAGTCCAGG - Intronic
1061449518 9:130660767-130660789 CTGTCGGGACCTGGCTCTCCCGG + Intergenic
1061551302 9:131336342-131336364 CTTGGGAGCCCTGGCTGTCCAGG + Intergenic
1061575188 9:131501944-131501966 CTGTGTTGCCCAGGCTCTCCTGG + Intergenic
1061806049 9:133138264-133138286 CTCTAGGGCCCTGGGTCTGAGGG + Intronic
1062069772 9:134549421-134549443 TTCTGGCACCCTGGATCTCCCGG - Intergenic
1062149711 9:135011365-135011387 CTCTGGGCCACTGGAGCTCCAGG - Intergenic
1062268028 9:135696247-135696269 CCCTGGGTCCCTGGGTCTGCTGG - Intronic
1062274328 9:135723654-135723676 GAAGGGGGCCCTGGCTCTCCTGG + Intronic
1062424087 9:136498090-136498112 CTCTGGGGCCCAGTCTCTGTGGG + Intronic
1062457563 9:136646706-136646728 CCCTGGGGTCCTGGCTGCCCTGG + Intergenic
1062502041 9:136855814-136855836 CACTGGACCCCTGGCTCTCCTGG - Exonic
1062601260 9:137319598-137319620 GCTTGGGGCCCTGGCCCTCCAGG + Intronic
1062665773 9:137670691-137670713 CACTGAGGCCCTGCCCCTCCTGG + Intronic
1186485639 X:9932498-9932520 GTCTGTGGCCCTGTATCTCCTGG - Exonic
1189052367 X:37659638-37659660 CACTGGTGCCATGGCGCTCCAGG + Exonic
1191174739 X:57486596-57486618 CTCAGGTGCCCTAGCTCTGCTGG + Intronic
1192510478 X:71718045-71718067 CTGTGGGCCCCTGGGGCTCCGGG + Exonic
1192516219 X:71763508-71763530 CTGTGGGCCCCTGGGGCTCCGGG - Exonic
1194268257 X:91780252-91780274 CTGTGCGCTCCTGGCTCTCCTGG - Intronic
1195709326 X:107761351-107761373 CTCTAGGATCCTGGCTCCCCAGG + Intronic
1200001700 X:153065468-153065490 CTCCGGGGTCCTGGCTTCCCAGG - Intergenic
1200746909 Y:6911102-6911124 AGCTGGGGCCCTGCGTCTCCAGG - Intronic
1200954039 Y:8927614-8927636 CTCTGCATGCCTGGCTCTCCTGG + Intergenic