ID: 968509299

View in Genome Browser
Species Human (GRCh38)
Location 4:988319-988341
Sequence CAGGTGGCCACCCTGTGAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968509291_968509299 -3 Left 968509291 4:988299-988321 CCTGGGCCCTGACGCTGGTGCAG 0: 1
1: 1
2: 2
3: 29
4: 293
Right 968509299 4:988319-988341 CAGGTGGCCACCCTGTGAGGGGG 0: 1
1: 0
2: 6
3: 22
4: 239
968509295_968509299 -10 Left 968509295 4:988306-988328 CCTGACGCTGGTGCAGGTGGCCA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 968509299 4:988319-988341 CAGGTGGCCACCCTGTGAGGGGG 0: 1
1: 0
2: 6
3: 22
4: 239
968509290_968509299 -2 Left 968509290 4:988298-988320 CCCTGGGCCCTGACGCTGGTGCA 0: 1
1: 0
2: 0
3: 28
4: 157
Right 968509299 4:988319-988341 CAGGTGGCCACCCTGTGAGGGGG 0: 1
1: 0
2: 6
3: 22
4: 239
968509294_968509299 -9 Left 968509294 4:988305-988327 CCCTGACGCTGGTGCAGGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 165
Right 968509299 4:988319-988341 CAGGTGGCCACCCTGTGAGGGGG 0: 1
1: 0
2: 6
3: 22
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968509299 Original CRISPR CAGGTGGCCACCCTGTGAGG GGG Exonic
900406259 1:2494363-2494385 CAGGTGGGCACTCCCTGAGGCGG - Intronic
900423277 1:2564820-2564842 CAGGTGGCCTCCCTGGGGGAAGG - Intronic
900563824 1:3322690-3322712 CAGATGGCCACCCTTTAACGAGG + Intronic
903442879 1:23401595-23401617 CAGGTGGGAACCCTGTGACCAGG - Intronic
903771978 1:25769900-25769922 CCCGTGGCCACCCTATGGGGAGG + Intronic
904288954 1:29471435-29471457 CTCATGACCACCCTGTGAGGAGG - Intergenic
904679877 1:32221976-32221998 CTGGTGGCCGCTCTGTGGGGTGG - Exonic
904752614 1:32750303-32750325 GAGATGGGCACCCTGTGAGTGGG - Intronic
905900916 1:41581501-41581523 CGGGGGTCCACCATGTGAGGTGG + Exonic
906608269 1:47185791-47185813 GAGGTGGGCACCCTGGGAGTTGG - Intronic
907334941 1:53693762-53693784 CAGGAGGCCACCCAGTGCGGTGG - Intronic
909481239 1:76130526-76130548 CAGGTGGCCACCCTGCCAGAGGG - Intronic
910010070 1:82450912-82450934 CATGTGAACACACTGTGAGGTGG - Intergenic
911226827 1:95316131-95316153 AAGGTGAACATCCTGTGAGGAGG + Intergenic
912401628 1:109398013-109398035 CAGGCGGCCAGCCTATGGGGCGG - Intergenic
914857903 1:151365543-151365565 CAGGTGGAGACCCTGGCAGGAGG - Exonic
915087756 1:153399627-153399649 CATGTCCCCACCCTGTGAGCTGG - Intergenic
915910467 1:159911925-159911947 CATGGGGCTCCCCTGTGAGGTGG - Intergenic
917254802 1:173103237-173103259 CTGTTGCACACCCTGTGAGGCGG - Intergenic
917972818 1:180219586-180219608 GAGGTAGCCTCCCTGTGGGGAGG - Intergenic
920454007 1:206083999-206084021 CATGTAGCAACCCTGTAAGGTGG - Intronic
920836107 1:209512683-209512705 TTGGTGGCCACCCTGTCAGCAGG - Intergenic
922606183 1:226891317-226891339 CTGGAGGGCACCCTGAGAGGAGG - Exonic
922767499 1:228163488-228163510 CAGGTGGGGATGCTGTGAGGAGG + Intergenic
1063167085 10:3473447-3473469 CATGTGGCCACCCTGGGCGTGGG + Intergenic
1063313409 10:4978278-4978300 GAGGAGGCATCCCTGTGAGGGGG + Exonic
1063314543 10:4989439-4989461 GAGGAGGCATCCCTGTGAGGGGG - Exonic
1063616083 10:7601654-7601676 CATGTGAACACCCTGTGATGGGG + Intronic
1066013733 10:31217412-31217434 CAGGTGGTCAGGCTGAGAGGAGG + Intergenic
1066058993 10:31705988-31706010 CAGGTGGCCAACCAGAGAGCTGG - Intergenic
1070165553 10:73895121-73895143 CACATGGCCACCCCGTGTGGAGG + Intergenic
1070684574 10:78471413-78471435 CAAATGGCCACCCTGTGGGGTGG + Intergenic
1071028193 10:81140337-81140359 CTGCTGCACACCCTGTGAGGGGG + Intergenic
1076482770 10:130795721-130795743 CAGGTGACAAGCCTGTGATGAGG + Intergenic
1077113032 11:870251-870273 CAGGTGGCCACCTGGTGGGTGGG - Intronic
1078763164 11:14268319-14268341 AAGGTGGCCGCGCTGGGAGGTGG + Intergenic
1079003470 11:16776482-16776504 CAGATGGCCACCCTGTGGGGTGG + Intergenic
1080854587 11:36101211-36101233 CAAGTGGGCACCTTGTGGGGTGG - Intronic
1083272599 11:61579931-61579953 CAGGTGGGCACTGGGTGAGGAGG + Intronic
1084460368 11:69293644-69293666 CACGTGGCCTCGCTGTGAGGGGG - Intergenic
1085459090 11:76682432-76682454 CAGGTGGGCACACTTTGAGATGG - Intergenic
1089319418 11:117614869-117614891 GTGTTGGCCACACTGTGAGGGGG - Intronic
1090448859 11:126788509-126788531 CAGGTGGATACCCTGAGAAGTGG - Intronic
1091356386 11:134941024-134941046 AAAGAGGCCACCCTGTGGGGGGG + Intergenic
1091763767 12:3104983-3105005 CAGCTGGTCACCCTGGGAGAGGG + Intronic
1092731041 12:11534920-11534942 CAGGTGGCAACGATGTGACGTGG + Intergenic
1093261892 12:16949332-16949354 CAGCTAGCCACCCTGTCATGTGG + Intergenic
1096195674 12:49647473-49647495 CAGGTGGCCACCCTCTGGAGGGG + Intronic
1104389708 12:128381417-128381439 CACGTGGCAACCCTGGGAGCCGG + Intronic
1104613952 12:130253376-130253398 CAGAAGCCCATCCTGTGAGGAGG + Intergenic
1104981741 12:132576022-132576044 CAGGTGCCCACGCTGCCAGGCGG - Intronic
1107960237 13:45550822-45550844 CACGTGGCCATCCTCTTAGGAGG + Intronic
1112333178 13:98492609-98492631 CCTGTGGCCACCCTGTGTGAAGG - Intronic
1113669073 13:112163606-112163628 AACGTGTCCACCCTGAGAGGTGG - Intergenic
1113907969 13:113829088-113829110 CAGGTGGCCTCCCTGAGATCGGG - Intronic
1113908019 13:113829272-113829294 CAGGTGGCCTCCCTGAGATTGGG - Intronic
1113908147 13:113829776-113829798 CAGGTGGCCTCCCTGAGATTGGG - Intronic
1113910824 13:113840410-113840432 CAGGTGACCACCCTGAGAAAGGG - Intronic
1113931582 13:113971663-113971685 CCGGAGGCCTCCCTGTGAAGTGG + Intergenic
1120693752 14:87621461-87621483 CTGGTGGAGACCCTGTGTGGGGG + Intergenic
1121003227 14:90467185-90467207 CAGGTGGCCATAGTGTGAAGGGG - Intergenic
1121585821 14:95062184-95062206 CAGGTGGCCACCTTATGACCTGG - Intergenic
1121670268 14:95704360-95704382 CTGGTGGCCAACCTGTTGGGTGG - Intergenic
1122250848 14:100438630-100438652 CAGCTGGCAAACCTGGGAGGTGG + Intronic
1122410400 14:101522797-101522819 CTGGTGGCAGCCCTGTTAGGAGG - Intergenic
1122564870 14:102646100-102646122 CAGTTGGCCACACTGTAAGAAGG + Intronic
1123050786 14:105541002-105541024 GTGGTGGCAACCCTGTGGGGAGG + Intergenic
1125214970 15:37261730-37261752 CATGTAGCCATCCTGTGAGGAGG + Intergenic
1125287127 15:38105742-38105764 CTGGTCTCCTCCCTGTGAGGTGG + Intergenic
1125531823 15:40418565-40418587 CAGGTGCCTACCCTGGGAGGTGG - Exonic
1125531837 15:40418603-40418625 CAGGTGCCTACCCTGGGAGGTGG - Exonic
1127223948 15:56911056-56911078 CAGGTGCAGACCCGGTGAGGTGG + Intronic
1127330393 15:57933150-57933172 CAGATGGGCACCCCGTGAAGGGG + Intergenic
1129228235 15:74182152-74182174 CAGCTGACCAACCGGTGAGGTGG - Exonic
1130199453 15:81811337-81811359 CAGGTGTCCACTCTGTGCTGGGG - Intergenic
1132576004 16:664498-664520 CTGGTGGCCTTCCTGTGATGTGG + Intronic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1132890063 16:2199405-2199427 CAGGTGGCCACTCTGGCTGGGGG + Intergenic
1132930616 16:2457253-2457275 CAGTTGGCCACACTGTGTGGAGG + Exonic
1135143068 16:19938128-19938150 CAGGTGGCCAGCCAGGCAGGTGG - Intergenic
1135565545 16:23508855-23508877 CAGATGCCTCCCCTGTGAGGAGG - Intronic
1137616711 16:49852798-49852820 TAGGTGTCCTCCCTGTGAGCTGG + Intronic
1138292129 16:55856676-55856698 CAAGTGGCCACCTTGTGGGAAGG + Intronic
1140829065 16:78734617-78734639 CATGTGGGCACCCTGTGACTGGG - Intronic
1141598052 16:85109287-85109309 CAGGTGGCCACCCCGTTACCAGG + Intronic
1141691611 16:85599967-85599989 CAGCTGTCCTCCCTGTGACGGGG + Intergenic
1142070910 16:88090917-88090939 CGGGTGTCCACCCTCTGAGGTGG - Intronic
1142561451 17:811732-811754 GAGGCCGCCACCCTGTGAGATGG + Intronic
1143200713 17:5111497-5111519 CAGGTGCCCGCCCGGGGAGGGGG + Intronic
1144737484 17:17563242-17563264 CAGGAAGCCTCCCTGGGAGGTGG - Intronic
1144854978 17:18262654-18262676 CAGGTGGCCAGGCTGGGAGAGGG - Intronic
1146672888 17:34754142-34754164 CAGGCTGCCACTCTGTGAAGTGG + Intergenic
1147164696 17:38586989-38587011 CGGGTGGGCACCCGGGGAGGGGG + Intronic
1148026967 17:44595200-44595222 CAAGGGGCCACCCTGGGAGAGGG - Intergenic
1148185123 17:45637444-45637466 CAGATGGGGACCCTGTGGGGAGG + Intergenic
1148213846 17:45824025-45824047 CAGGTGGGCTCTCTGTGTGGGGG - Intronic
1148332548 17:46820975-46820997 CAGGTGCCAACCCTGTGAGGTGG + Intronic
1148768584 17:50053944-50053966 CTCCTGGCCTCCCTGTGAGGTGG - Intergenic
1150008643 17:61485724-61485746 CAGGTGGCAAGGCTGTAAGGAGG - Intergenic
1151595949 17:75078069-75078091 CAGGTGGTCAGACTGAGAGGTGG + Intergenic
1151750126 17:76032438-76032460 CAAGTGGCCACCCTGTGGCCGGG - Intergenic
1152032745 17:77854140-77854162 CAGGTGGGCACCCTCTGCAGGGG + Intergenic
1153496463 18:5704705-5704727 CTGGTGCCCACACTGTGAGAAGG + Intergenic
1153946641 18:10023811-10023833 CAGGGCGGCACCCTGTGAGAGGG + Intergenic
1155153640 18:23141097-23141119 AGAGTGGCCACCCTTTGAGGAGG + Intronic
1155274183 18:24170307-24170329 CAGGTGAACATCCTGTAAGGTGG - Exonic
1156171697 18:34493839-34493861 CAGGTGGGAACCCCGTGAGTGGG - Intronic
1157113584 18:44843174-44843196 CAGGCAGCCACACTGTGAGAGGG + Intronic
1157147985 18:45185370-45185392 CAGGTGGCCACAATCTGAGAGGG - Intergenic
1159029269 18:63214258-63214280 GAGGAGGACACCCAGTGAGGAGG + Intronic
1159417541 18:68172878-68172900 CTGTTGCACACCCTGTGAGGGGG - Intergenic
1159927635 18:74283050-74283072 CCAGTGGCCACCATGAGAGGTGG + Intronic
1160149103 18:76385822-76385844 CAGGTGGGCTGCCTGGGAGGAGG - Intronic
1160439691 18:78879750-78879772 CAGGTTGCCACACTGTGATGTGG - Intergenic
1160471125 18:79134569-79134591 CAGGGGGCTGCCCTGTGAGATGG + Intronic
1161201027 19:3014814-3014836 CAGGTGGGCACCTTGTGGAGAGG + Intronic
1162453196 19:10766922-10766944 CAGGAGGGCTCCCTGGGAGGAGG - Intronic
1162721595 19:12666077-12666099 CAGACGGCCACCGTGGGAGGTGG + Intronic
1163297270 19:16420527-16420549 CAGATGACCACACTGTGAGGTGG - Intronic
1165098275 19:33422238-33422260 CAGGATGCCTCCCTGTGAAGGGG - Intronic
1168015747 19:53571519-53571541 CAGGAGGCCACCCTCTGGGTAGG - Intronic
930019394 2:46992274-46992296 CAGGTGGCCACAGTGTGCGAGGG + Intronic
933721272 2:85398980-85399002 CAGAGGGGCACCCTGTGAGCTGG + Intronic
934745899 2:96759680-96759702 CAGCTGCCCGCCCTGTGAGGGGG - Intergenic
935881023 2:107565823-107565845 CTGGTGAGCACCCTGGGAGGAGG + Intergenic
935975125 2:108570681-108570703 AACGTGGCCATCCTGGGAGGCGG + Intronic
937247778 2:120504516-120504538 CTTGCAGCCACCCTGTGAGGTGG + Intergenic
940906291 2:159172910-159172932 CATGGGGACACCTTGTGAGGAGG + Intronic
942469091 2:176241376-176241398 CAGGTGGCAACCGGGTGCGGTGG - Intergenic
942601370 2:177644097-177644119 CAGGTGGGGACTCTGTGTGGGGG - Intronic
947750661 2:232530285-232530307 CAGGTGGCCACCCAGAGGGAGGG + Intronic
948051371 2:234981948-234981970 GAGGTGGCCACCCAGGAAGGAGG - Intronic
948255815 2:236567635-236567657 CAGGCTCCCACCCTGGGAGGAGG - Intergenic
948758345 2:240172591-240172613 TACGAGGCCACGCTGTGAGGAGG + Intergenic
948888883 2:240897299-240897321 CCGTGGGCTACCCTGTGAGGTGG - Intergenic
1169075661 20:2758643-2758665 AAGGAGGCCACCCTGGGAGAAGG + Intronic
1169354778 20:4897346-4897368 CAAATGGCCACACTGTGGGGAGG + Intronic
1170887540 20:20354650-20354672 AAGGTGGTCACACTGTGAGAAGG + Intronic
1170887580 20:20354915-20354937 GAGGTGGTCACACTGTGAGAGGG + Intronic
1170887607 20:20355041-20355063 GAGGTGGTCACACTGTGAGAGGG + Intronic
1170887611 20:20355064-20355086 AAGGTGGTCACACTGTGAGAGGG + Intronic
1170887718 20:20355575-20355597 GAGGGGGTCACACTGTGAGGGGG + Intronic
1170887722 20:20355598-20355620 AAGGTGGTCACACTGTGAGAGGG + Intronic
1170887797 20:20356002-20356024 GAGGTGGTCACACTGTGAGAGGG + Intronic
1170887932 20:20356616-20356638 GAGGTGGTCACACTGAGAGGAGG + Intronic
1170887959 20:20356732-20356754 GAGGTGGTCACACTGAGAGGAGG + Intronic
1170887991 20:20356867-20356889 GAGGTGGTCACACTGAGAGGAGG + Intronic
1170888028 20:20357023-20357045 GAGGTGGTCACACTGAGAGGAGG + Intronic
1171017849 20:21557870-21557892 CAGGCAGCTCCCCTGTGAGGGGG - Intergenic
1172039269 20:32032078-32032100 CCTGTGGCCACCCTGTTAGGTGG - Exonic
1172057645 20:32165483-32165505 CAGGAAGCCACCCTGCGTGGGGG + Exonic
1172189894 20:33055556-33055578 CAGGTGGGCAGTCTGTGAGGGGG + Intronic
1172774016 20:37396933-37396955 CAGGAGGCCAAGCTGAGAGGAGG - Intronic
1173046133 20:39514271-39514293 CAGGTGTCCACCCAGAGATGTGG - Intergenic
1174109719 20:48190189-48190211 CAGGTGCCCTGCCTGTGAGTTGG + Intergenic
1174395791 20:50246259-50246281 CAGGTGCCCACCCTGGCTGGAGG - Intergenic
1174582672 20:51583437-51583459 CAGGAGGCCTCCCTCTGAGGTGG + Intergenic
1175192979 20:57223934-57223956 CCGAGGGCCGCCCTGTGAGGGGG + Intronic
1175658343 20:60791464-60791486 CAGGTGTCCACCTTCTGAGCTGG - Intergenic
1175863248 20:62161318-62161340 CAGGTGGCCATGATGTGTGGCGG + Intronic
1178724310 21:35037463-35037485 CAGGAGGCGACGCTGTGGGGTGG - Intronic
1179881792 21:44296134-44296156 CAGGAGGCCACACAGTGTGGAGG + Intronic
1180855093 22:19040607-19040629 CAGGAGGCAGCTCTGTGAGGTGG - Intronic
1182425130 22:30267657-30267679 CTGGCAGCAACCCTGTGAGGTGG - Intergenic
1184046567 22:41976180-41976202 CAGGTGGGCACCCTGGGGAGAGG - Intergenic
1184389936 22:44197498-44197520 CACGTGGCCACCATGTGAGGTGG - Intronic
1184549122 22:45195112-45195134 CTCATGGTCACCCTGTGAGGGGG + Intronic
950028769 3:9838148-9838170 CAGCTGGGCAGCCTGGGAGGGGG + Exonic
950034742 3:9877271-9877293 GAGGTGGCTCCCCTGTGTGGTGG - Intronic
950559992 3:13715683-13715705 GAGGGGACCACCATGTGAGGGGG + Intergenic
953981497 3:47415405-47415427 CTCATGACCACCCTGTGAGGTGG - Intronic
954116332 3:48468803-48468825 GTGGGGGGCACCCTGTGAGGTGG - Exonic
956012548 3:64846859-64846881 CAGGTGCCCACACTCTGGGGTGG - Intergenic
960854840 3:122092306-122092328 CAGGTGACCACACTGCTAGGGGG - Intronic
961379603 3:126488311-126488333 CAGGTGCCCACCCAGTGCAGGGG - Intronic
961486432 3:127220524-127220546 CAAGAGGCCACGCTGTGTGGGGG + Intergenic
961640909 3:128364345-128364367 AAAGTGGCCATCCTGAGAGGAGG + Intronic
962813021 3:138975048-138975070 AAGGTGGCCACAGTTTGAGGAGG + Intergenic
963285699 3:143432598-143432620 CAGGTGGCCACCATTCTAGGGGG - Intronic
966840429 3:184083160-184083182 CTGATGGCCACCTGGTGAGGAGG - Intergenic
968509299 4:988319-988341 CAGGTGGCCACCCTGTGAGGGGG + Exonic
968632411 4:1658855-1658877 CAGAAGGCCACCCTGTGACAAGG + Intronic
969505492 4:7584485-7584507 CAGGTTTCTTCCCTGTGAGGTGG - Intronic
971329304 4:25669584-25669606 CAAGTGGGCACCATGTGAGGTGG - Intronic
972115240 4:35623595-35623617 CAACTCACCACCCTGTGAGGTGG + Intergenic
973631621 4:52825549-52825571 CACGTGGCCAGGCAGTGAGGTGG + Intergenic
973819940 4:54653881-54653903 CATGTGGCCTCCCAGAGAGGTGG - Intergenic
974901339 4:68002106-68002128 CAGTGGGCCACCCTTTGTGGAGG - Intergenic
979092506 4:116503096-116503118 CCCGTGGCCACCATGTGAGTAGG - Intergenic
985206142 4:187539073-187539095 CATGTGGCCACCTTGTGTGCTGG - Intergenic
986013947 5:3741006-3741028 CTGGTGACAACCCTGTGGGGAGG + Intergenic
986390229 5:7278657-7278679 CAGGTGGCTCACCTGTGAAGTGG + Intergenic
996035093 5:118750140-118750162 CAGGGTGTCACCCTGAGAGGTGG - Intergenic
996471072 5:123861017-123861039 CACATGGGCAGCCTGTGAGGTGG - Intergenic
998135014 5:139669942-139669964 CAGGCAGCCACCCCATGAGGCGG - Intronic
998512027 5:142721692-142721714 CAGGGGACCACCCCGTGAGCTGG - Intergenic
998819233 5:146043082-146043104 CAGATGGCCAGCTTCTGAGGAGG - Intronic
999241956 5:150133001-150133023 AAGGAGGCCAGCCTGTGGGGTGG + Intronic
1001007453 5:168065965-168065987 CTGGTTGTCACACTGTGAGGAGG + Intronic
1001396723 5:171423208-171423230 CCGCTGGCCACCCTGGGAAGTGG + Intronic
1001663340 5:173412896-173412918 CCGGTGGCCACTCTGGGTGGTGG + Intergenic
1001680646 5:173554621-173554643 CAGGAGGCCAGCCTGTGAGGGGG + Intergenic
1002182569 5:177438563-177438585 CAGGGGCCAGCCCTGTGAGGTGG + Intronic
1002840991 6:907163-907185 AAGGTGGCCCCCTTGTGTGGCGG - Intergenic
1003175424 6:3750352-3750374 CAGGTGGTCACCCATGGAGGGGG + Intronic
1004916540 6:20338094-20338116 CAGGTGGCCAACCTGTGGACAGG + Intergenic
1005642399 6:27808514-27808536 CAGGACGCCACCCTGTGCGATGG - Exonic
1005642949 6:27814414-27814436 CAGGACGCCACCCTGTGCGATGG + Exonic
1006827896 6:36949500-36949522 CAGGTGGCAAAGCTGTGAGATGG - Intronic
1007508678 6:42358485-42358507 CAGGTGCCCACCTGGTGATGTGG - Intronic
1008506326 6:52234382-52234404 CAGTTCGCCACCTTGTGAGCAGG + Intergenic
1011648657 6:89485016-89485038 CAGGTTGCCACACTGTATGGGGG + Intronic
1017238138 6:152138689-152138711 TAGGTGGCCACATTTTGAGGAGG + Intronic
1018901670 6:168054747-168054769 CAGAAGGCCATCCTGGGAGGGGG - Intergenic
1018935456 6:168271201-168271223 GAGGTGGCCACCCTCTGGGAGGG + Intergenic
1019499068 7:1355410-1355432 CAGGTGGCCAGGCTGTTAGTGGG - Intergenic
1024881822 7:54095416-54095438 CAGGTGACCACCCTGGAAGGTGG + Intergenic
1024901706 7:54325178-54325200 CAGCAGGGCACCCAGTGAGGAGG + Intergenic
1027793479 7:82661466-82661488 CAGGCTGCCACCCTGTCTGGTGG - Intergenic
1028708416 7:93877666-93877688 GAGGTGGCAACCTTGTGAGAAGG + Intronic
1032017997 7:128392117-128392139 CAGGTGGGCCCCATGTCAGGAGG - Intergenic
1033532798 7:142282439-142282461 CAGGTAGCCATCCTGTGGGAGGG + Intergenic
1033605864 7:142928257-142928279 CAGGGGGCCAACGTGTGAGAAGG + Intronic
1034269446 7:149796585-149796607 CCGGTGGGGACCCTGTGTGGAGG - Intergenic
1035029259 7:155846794-155846816 GAGGTGGAGACCTTGTGAGGTGG + Intergenic
1035395953 7:158534698-158534720 CAGATGGCCACTGTGTGACGTGG - Intronic
1035984447 8:4411085-4411107 CAGGTGGCCACACGTGGAGGGGG - Intronic
1037108263 8:15136683-15136705 CATTTTGCCACCCTGTGAAGAGG + Intronic
1037643446 8:20769532-20769554 CTGGTGTCCACCCAGTGAGTTGG - Intergenic
1037816662 8:22116176-22116198 CAGGCAGCCACCCTGTGCAGGGG - Intronic
1037839135 8:22231699-22231721 CAGGTGGGCACCCTGGGTGGTGG + Intronic
1039752697 8:40492849-40492871 CTGGTGACCCCCCTGAGAGGAGG + Intergenic
1044725951 8:95194420-95194442 CAGGTGGTAAACATGTGAGGAGG + Intergenic
1045111690 8:98942673-98942695 CAGGTCACCACCCCGTGAGTGGG + Intronic
1045277282 8:100720142-100720164 CAAGTGGCCAGCCTGTAGGGGGG + Intronic
1047586585 8:126280068-126280090 CTGTTGCACACCCTGTGAGGGGG + Intergenic
1047932989 8:129749318-129749340 CCAGTGGCCACCCTGTGATCTGG + Intronic
1048094310 8:131274802-131274824 CAGGTGTCCACCGTGTTAGCTGG - Intergenic
1048300717 8:133249099-133249121 GAGGTGGCCCCTCTGTCAGGTGG - Intronic
1049470854 8:142774446-142774468 CTGGTGCCCTCCCCGTGAGGGGG + Intronic
1049658601 8:143809756-143809778 CAGGTGGCCAGCCTGTGAGTCGG - Intronic
1049825831 8:144667227-144667249 CTGGAGGGCAGCCTGTGAGGTGG - Intergenic
1051669204 9:19493518-19493540 CAGGTGGCCAGGCTGTGGGGTGG - Intergenic
1052146065 9:25051079-25051101 CAGGTGGCCAACATTTTAGGAGG - Intergenic
1053201033 9:36151719-36151741 CGGGTGGCCACCCTGTGCCCCGG + Intronic
1056591864 9:87970767-87970789 CAGGTGGCCACCAGGTAGGGAGG - Exonic
1056824284 9:89865887-89865909 CACTCGGCCACCCTGGGAGGAGG - Intergenic
1057576347 9:96245630-96245652 CAGGTGGCATCACTGTGCGGCGG - Intronic
1057847861 9:98539236-98539258 CAGACAGCCACCCTGTAAGGAGG - Intronic
1058800852 9:108543310-108543332 CAGGTGCCACCCCTGGGAGGTGG - Intergenic
1060219106 9:121755061-121755083 CTGGAGTCCACCCTGGGAGGTGG + Intronic
1060758921 9:126232685-126232707 CCAGTGGCCATGCTGTGAGGAGG - Intergenic
1061057600 9:128232709-128232731 CAGGTGGCCACCGCGTGGAGAGG + Intronic
1061079400 9:128361067-128361089 CAGGCAGCCACCCAGGGAGGAGG - Exonic
1061204582 9:129155599-129155621 CCGCAGGCCACCCTGCGAGGTGG + Intergenic
1061978800 9:134087938-134087960 CAGTTGGCCACCCTGTCCTGTGG + Intergenic
1062139545 9:134948278-134948300 CAGGTGAGCACCCTGGGAGTGGG - Intergenic
1062461057 9:136662753-136662775 GTGGGGGCCACCGTGTGAGGGGG - Intronic
1062620065 9:137416654-137416676 CAGGCGGCCACCCTCTGAGGAGG + Intronic
1186640124 X:11446682-11446704 AAGGTTGCCACCCTCTGAGGTGG - Intronic
1191253815 X:58271309-58271331 CAGGTGGCCAGGCTTTCAGGGGG - Intergenic
1191255152 X:58276496-58276518 CAGGTGGCCAGGCTTTCAGGGGG - Intergenic
1191255652 X:58278486-58278508 CAGGTGGCCAGTCTTTCAGGGGG - Intergenic
1191256193 X:58280670-58280692 CAGGTGGCCAGGCTTTCAGGGGG - Intergenic
1195104503 X:101591231-101591253 CAGCTCGCCACTCTGTGAAGTGG + Intergenic
1195218155 X:102721044-102721066 CAGATGGCATCCCTGAGAGGTGG + Intronic
1195370367 X:104166861-104166883 CAGGTGCCCACCCCGCGAGGAGG - Exonic
1195522323 X:105845631-105845653 CAGGTGGCAAATCTGTGATGGGG - Intronic