ID: 968511536

View in Genome Browser
Species Human (GRCh38)
Location 4:997813-997835
Sequence CAGCGAGGGGAGCCCGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968511536_968511549 18 Left 968511536 4:997813-997835 CCTGTCCCGGGCTCCCCTCGCTG 0: 1
1: 0
2: 2
3: 24
4: 268
Right 968511549 4:997854-997876 ATGACACTCAGAGGCGCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 67
968511536_968511550 25 Left 968511536 4:997813-997835 CCTGTCCCGGGCTCCCCTCGCTG 0: 1
1: 0
2: 2
3: 24
4: 268
Right 968511550 4:997861-997883 TCAGAGGCGCCTTGGGTGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 98
968511536_968511551 30 Left 968511536 4:997813-997835 CCTGTCCCGGGCTCCCCTCGCTG 0: 1
1: 0
2: 2
3: 24
4: 268
Right 968511551 4:997866-997888 GGCGCCTTGGGTGTCAGGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 145
968511536_968511548 17 Left 968511536 4:997813-997835 CCTGTCCCGGGCTCCCCTCGCTG 0: 1
1: 0
2: 2
3: 24
4: 268
Right 968511548 4:997853-997875 GATGACACTCAGAGGCGCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 94
968511536_968511545 9 Left 968511536 4:997813-997835 CCTGTCCCGGGCTCCCCTCGCTG 0: 1
1: 0
2: 2
3: 24
4: 268
Right 968511545 4:997845-997867 CCCTGCCAGATGACACTCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968511536 Original CRISPR CAGCGAGGGGAGCCCGGGAC AGG (reversed) Intronic
900144353 1:1151424-1151446 CTGGGTGGGGGGCCCGGGACAGG - Intergenic
900210926 1:1455551-1455573 CAGGGAGGGGACCCCGGAGCTGG + Intronic
900216749 1:1485870-1485892 CAGGGAGGGGACCCCGGAGCTGG + Intronic
900579536 1:3402239-3402261 CAGGCAGGGGAGGCAGGGACGGG + Intronic
900622712 1:3594753-3594775 CAGAGATGGGGGCCCAGGACTGG - Intronic
900646053 1:3709185-3709207 CAGCTGGGGGAGCCCGTGGCTGG - Intronic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
901434709 1:9240072-9240094 CAGTGAAGGGTGCCCAGGACTGG + Intronic
901500989 1:9652447-9652469 CAACGCGGGAGGCCCGGGACTGG - Intronic
902271207 1:15306562-15306584 CAGCATGGGGACCCCGGGCCTGG - Intronic
902880702 1:19370149-19370171 CAGTGAGTGGAGGCCGGAACAGG - Intronic
903875809 1:26472455-26472477 TAGCGCTGGGAGCCCCGGACCGG - Intronic
904593654 1:31629273-31629295 CAGGGAGGAGAGCCCTGCACAGG + Intronic
905028577 1:34866918-34866940 CAGCAAGGGCAGCCTTGGACAGG - Intronic
905819023 1:40975312-40975334 GAGCGAGGGGAGCATGGGGCGGG + Intergenic
906609145 1:47190140-47190162 CAGCCAGGGGAGGCCAGGTCTGG - Intronic
906866828 1:49430275-49430297 CAGAGAAGGGAGCCTGGGACAGG - Intronic
907303816 1:53503081-53503103 CAGAGAGGGAAGGGCGGGACAGG + Intergenic
908501207 1:64745199-64745221 CGGCGAGGGGGGCGCGGGCCTGG + Exonic
913069352 1:115285221-115285243 CAGCCAGGGAAGCCAGAGACGGG - Intergenic
913186473 1:116373902-116373924 CAGGGAGGGGAGCCAGGCTCAGG - Exonic
914847766 1:151292332-151292354 CAGCAAGGGGAGCTTGGGCCAGG + Exonic
915524479 1:156467557-156467579 GAGCGGGAGGAGCCCGGGGCAGG + Exonic
916237636 1:162606457-162606479 TAGCGGGGGGAGGCCGAGACAGG - Intergenic
916647182 1:166797512-166797534 CAGCGAGGGGAGCCGGCAGCAGG + Intergenic
918787031 1:188776009-188776031 CAGCATGGGGACCCTGGGACTGG - Intergenic
920178873 1:204120378-204120400 AAGCTGTGGGAGCCCGGGACTGG + Intronic
920282491 1:204854475-204854497 GAGGGAGGGGACCCTGGGACAGG + Intronic
920309951 1:205043140-205043162 CAGTGAGCGGAGCCTGGGAGAGG + Intergenic
920541990 1:206785626-206785648 CAGAGAGGGCAGCCAGGGAGAGG + Intergenic
920826298 1:209426862-209426884 CAGCCTGGGGTGCCGGGGACTGG - Intergenic
924948653 1:248863312-248863334 AAGCGAGTGGAGCCAGGAACAGG + Intergenic
1063010067 10:2012735-2012757 CAGCAAAGGCAGCCCAGGACAGG - Intergenic
1063097681 10:2922593-2922615 ACGCGAGGCGAGCCCGGGGCTGG + Intergenic
1064473514 10:15661729-15661751 CAGAGAGGGGAGCCTTGGACAGG + Intronic
1067107075 10:43373631-43373653 CAGCGAGAGGAGGCAGGGGCGGG - Exonic
1067481126 10:46598194-46598216 CCGCGAGGGGAGCCGCGGAAGGG + Intergenic
1067613626 10:47743628-47743650 CCGCGAGGGGAGCCGCGGAAGGG - Intergenic
1069571612 10:69497745-69497767 CAGGGAGGGGAGGCAGGGAGGGG + Intronic
1070167770 10:73911347-73911369 CCGCGGGGGACGCCCGGGACGGG - Exonic
1070823903 10:79379948-79379970 CAGAGAGGGGAGACCTGGCCTGG - Intergenic
1071629034 10:87203600-87203622 CCGCGAGGGGAGCCGCGGAAGGG - Intergenic
1071857833 10:89644536-89644558 CAGCGTGCGGGGCCCGGGACTGG - Intronic
1072445991 10:95499184-95499206 CAGCTAGGGGAGGCCGAGGCAGG - Intronic
1073147833 10:101292163-101292185 GAACGTGGGGAGCCCGGGAGGGG - Intergenic
1073387010 10:103134301-103134323 CAGCATGGGGAGCCTGGGCCTGG - Intronic
1074416690 10:113273183-113273205 CAGCGAGCAGAGGCCTGGACTGG - Intergenic
1074536135 10:114329709-114329731 AAGTGAGGGGAGCCTGGCACTGG + Intronic
1075961531 10:126571437-126571459 CAGCCAGGGCAGTCAGGGACAGG + Intronic
1076721944 10:132396781-132396803 GGGGGAGGGGGGCCCGGGACCGG + Intergenic
1076873867 10:133206516-133206538 CAGCGAGGCCAGCCCCGGCCTGG - Intronic
1077140136 11:1020623-1020645 AACCGAGGGGAGCCCAGGAAAGG + Intronic
1077144054 11:1036980-1037002 CAGCGGGGAGGGCCCGGGCCAGG - Intergenic
1077212144 11:1376005-1376027 CAGCGAGGAGAGCCCTGACCTGG + Intergenic
1077332480 11:1989586-1989608 CAGGGAGGGGAGGCCCGTACTGG + Intergenic
1080985129 11:37454297-37454319 CAGCGATGGGAGCACTGGAAGGG + Intergenic
1081794343 11:45809293-45809315 AAGGGAGGGGACCCGGGGACAGG + Intronic
1083173094 11:60934462-60934484 CAGGGCGGGGAGGCCGGGACTGG - Intronic
1083687643 11:64386308-64386330 CAGCAAAGAGAGCCCGGGGCTGG - Intergenic
1083724942 11:64623117-64623139 CAGTGAGGGGAGACCAGGAAGGG + Intronic
1083822553 11:65181470-65181492 GAGCGAGGGGAGCTGGGGACCGG + Exonic
1084786173 11:71442963-71442985 CAGCCAGGGGCGGCAGGGACAGG - Intronic
1085477496 11:76797366-76797388 CAGCAAGGGGAGCCCAGGCGGGG - Exonic
1085554985 11:77411740-77411762 CAGCTAGGGGAGCCCCAGGCAGG + Intronic
1085798583 11:79566355-79566377 CAGCGAGGGGAACAAGGGAGGGG + Intergenic
1088318395 11:108530530-108530552 CAGCAAGGGAGGCCGGGGACTGG + Intronic
1088771270 11:113038047-113038069 CAGAGGCAGGAGCCCGGGACTGG - Intronic
1088858527 11:113778534-113778556 CAGCAAGGGGAGCCTGGGGAGGG + Intergenic
1089129356 11:116199789-116199811 CAGAGAGGAGAGCCCAGGGCAGG + Intergenic
1089147534 11:116340775-116340797 CAGGGTGGGGAGCGCGGGGCGGG + Intergenic
1089377073 11:118002049-118002071 GGGCAAGGGGAGCCAGGGACAGG - Intergenic
1090277517 11:125430235-125430257 CAGCGATGGGAGCCCAGGTAAGG - Intronic
1090616830 11:128522456-128522478 CAGGGCGGGGAGCCGGGGGCGGG + Intronic
1202815461 11_KI270721v1_random:44762-44784 CAGGGAGGGGAGGCCCGTACTGG + Intergenic
1091857691 12:3752809-3752831 CAGGGAGGGGAGCAAGGGCCAGG + Intronic
1096337134 12:50764702-50764724 CGCCGAGCGGAGCCCGGGTCTGG + Intronic
1097981724 12:65742462-65742484 CGGCGGGGGGAGGCCGGGCCAGG + Intergenic
1101838003 12:108308540-108308562 CAGTGATGGGAGCCCTGGAGGGG - Intronic
1102652324 12:114450885-114450907 CAGCAAGGGGAGGGAGGGACAGG + Intergenic
1103350310 12:120278922-120278944 GAACCAGGGGAGCCCGGGGCAGG + Intergenic
1103500676 12:121399747-121399769 CGGGGAGGGGAGCGCGGGAAGGG - Intronic
1104962639 12:132495492-132495514 CAGTGAGGAGAGCCAGGGAGAGG + Intronic
1106776636 13:33016236-33016258 GGGCGAGGGGTGCCCGGGAGGGG - Intergenic
1113795025 13:113051818-113051840 CAGCGGGGGCAGCCCTGGGCTGG - Intronic
1113895134 13:113759356-113759378 GAGCGTGGGGACCCCGGGGCTGG + Intronic
1113900406 13:113793785-113793807 CAGCGTGGTGCGCCCTGGACCGG + Intronic
1114494274 14:23121722-23121744 CAGGAAGGGGAGCTCTGGACAGG + Intergenic
1115028027 14:28765949-28765971 CACCGCGGGGAAACCGGGACTGG - Intergenic
1115115863 14:29880221-29880243 CAGCAAGGGGACCCTGGGCCTGG - Intronic
1115591977 14:34874113-34874135 CCGGGAGGGGATCCCGGAACTGG + Intronic
1115976643 14:39004175-39004197 CAGAGAGGGGAGGCAGGAACTGG + Intergenic
1116195191 14:41716132-41716154 CAGCACGGGGACCCTGGGACTGG + Intronic
1119703244 14:76769046-76769068 CAGCCAGGGGAGCCCGGATCTGG - Intronic
1119898736 14:78242641-78242663 CAGCCAGGGAGGCCAGGGACAGG - Intronic
1122115102 14:99523600-99523622 CAGCCAGGGCAGCCGGGCACTGG + Intronic
1122666623 14:103334467-103334489 CAGCGAGGAGCGGCCGGGCCAGG - Exonic
1122891581 14:104734516-104734538 CAGAGAGGGGAGCCTGTGGCTGG + Intronic
1122922567 14:104886046-104886068 CCCCCAGGGGAGCCCGGCACCGG - Exonic
1123002068 14:105301022-105301044 CGGTGAGCGCAGCCCGGGACTGG + Exonic
1128344006 15:66842496-66842518 CTGCGAGCCGAGCACGGGACCGG + Intergenic
1128999374 15:72319917-72319939 CAGGGAGGGGACGGCGGGACAGG - Exonic
1129391252 15:75222050-75222072 CAGCGAGGTGAGACAGGCACAGG - Intergenic
1129620145 15:77136932-77136954 CAGCAAGGGGACCCTGGGCCTGG - Intronic
1129731308 15:77934224-77934246 CAGCGAGGTGAGACAGGCACAGG + Intergenic
1131092585 15:89633604-89633626 CAGCCAGGGGAGCCCAGGCAGGG - Intronic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1133038061 16:3045875-3045897 CAGTGCCGGGAGCCGGGGACCGG - Intergenic
1138584322 16:57960456-57960478 CAGGGAGGGGAGCTCGGGAGGGG - Intronic
1141513507 16:84527575-84527597 CAGCGAGGGGGGGCCGGGGCGGG + Intronic
1141989509 16:87602302-87602324 CAGGGCGGGGAGCGCGGGGCTGG + Intronic
1142156236 16:88533944-88533966 CAGCGAGGGCAGCCAGAGCCCGG + Exonic
1142202903 16:88769666-88769688 CAGGGAGAGGACCCCGGGCCTGG + Intronic
1142376635 16:89710052-89710074 CAGGGCAGGGAGTCCGGGACTGG + Intronic
1143174506 17:4948507-4948529 CAGCGAGCGGAGCCGCGGTCCGG - Exonic
1143319607 17:6059605-6059627 CAGCTAGCGCAGCCCTGGACAGG - Intronic
1143584596 17:7844861-7844883 GAGCGAGGTGAGCCCGGCAGCGG - Intronic
1143723981 17:8832958-8832980 CAGCGAGGCCAGCCCGAGCCGGG - Exonic
1144638563 17:16925623-16925645 CAGCTAGGGGAGGCCGGGCAGGG + Intergenic
1146016935 17:29241333-29241355 CAGGCAGGGGAGCCAGGGCCTGG - Intergenic
1146339622 17:32007703-32007725 CGGCGAGGGGAGCCCCCGATGGG - Intergenic
1146943754 17:36860602-36860624 CAGTGAGGGGAGCCCGGGCAGGG + Intergenic
1147420788 17:40321324-40321346 GAGCGAGGGGAGGGCGGGACTGG - Intronic
1147726147 17:42567190-42567212 CGGCGAGGGGAGGGCGGGTCGGG + Exonic
1147970901 17:44218869-44218891 CGGCGAAGGGAGCCCGGGAGGGG - Intronic
1148139315 17:45317068-45317090 GAGGGGGCGGAGCCCGGGACCGG - Intergenic
1148652423 17:49259810-49259832 AAGCCAGGGGAGCCCAGAACAGG + Intergenic
1150134793 17:62689794-62689816 CAGGGAGGGGAACCCGGGCAAGG - Intronic
1151215325 17:72573113-72573135 CATCGAGGGCAGCAGGGGACAGG - Intergenic
1151479344 17:74361241-74361263 CAGCGAGGGGAGCCTCGCAGAGG + Intronic
1151552867 17:74832046-74832068 CAGCCAGGGGAGGCAGGGAGGGG + Intronic
1151650802 17:75468292-75468314 CAGAGAGGGCAGCCAGGAACAGG - Intronic
1152278652 17:79372518-79372540 CAGGGGTGGGAGCCCGGGCCAGG - Intronic
1152586741 17:81192691-81192713 CAGCGAGGGGTCCCTGGGAGAGG + Intronic
1152777599 17:82212604-82212626 CCGCGAGGGGATCCCCGGTCCGG + Intronic
1152864186 17:82712515-82712537 CAGAGAGGGGAGCCTGGAGCAGG + Intergenic
1152938108 17:83152345-83152367 GAGCAAGGGGAGCCCGGGACGGG + Intergenic
1153489279 18:5630588-5630610 CTGCGGGAGGAGCCCGGGTCTGG - Intronic
1153636499 18:7117644-7117666 CAGAGAGGTGAGCCCGGCCCGGG - Exonic
1153926376 18:9838737-9838759 CAGCGAGGTGAGCCCTGAGCTGG - Intronic
1155130931 18:22933703-22933725 CACCGAGTGTAGCCCGGGCCCGG - Intronic
1155164815 18:23223656-23223678 CAGAGAGGGGCTCCAGGGACAGG - Intronic
1157529585 18:48409676-48409698 CGGCGGGGGGCGCCCGGGACTGG + Intronic
1160242087 18:77131936-77131958 CGGCCAGGAGAGCCCGGGTCCGG - Intronic
1160557663 18:79736486-79736508 CAGCGAGAGGAGCGCGGCAGGGG + Exonic
1160906764 19:1455336-1455358 CGGTGAGGGGCGCCCGGGCCAGG - Intronic
1161107502 19:2451913-2451935 CAGCCAGGGGACACCGGGGCAGG + Intronic
1161779128 19:6279678-6279700 CGGAGCGGGGAGGCCGGGACCGG + Intronic
1162079363 19:8209310-8209332 GAGTGGGGGGAGCCCGGGGCGGG - Intronic
1162675328 19:12294446-12294468 CAGAGAGGGGCGCCGGGGCCGGG + Intronic
1162954434 19:14090477-14090499 GAGGGAGGGGAGCCGGGGAGGGG - Exonic
1163034979 19:14564914-14564936 CAGGGAGGGGAGCCCATGAGGGG - Intronic
1163103282 19:15109897-15109919 CAGCGTGGGGGGCCCCGGGCCGG + Exonic
1163329618 19:16628087-16628109 CGGAGAGGGGAGCCGGGGCCGGG + Exonic
1163651745 19:18521849-18521871 CAGTGAGGGGAGCGCGAGGCCGG + Intronic
1164594821 19:29526022-29526044 CAGCGCGGGGAGAGCGGGTCCGG - Intergenic
1165236878 19:34428659-34428681 CAGGGCCCGGAGCCCGGGACCGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165388303 19:35524551-35524573 GAGAGAGGGAAGCCCAGGACTGG + Intronic
1166106456 19:40600337-40600359 GTGCGAGGTGAGCCCGGGACAGG + Intronic
1166445817 19:42856605-42856627 CAGGAGGGGGAGCCTGGGACAGG + Intronic
1166679519 19:44758304-44758326 CAGCGGGAGGAGCCCGCGGCCGG - Exonic
1166869769 19:45864252-45864274 GCGGGAGGGGAGCCCGGGGCGGG + Exonic
1167369668 19:49072873-49072895 GAGAAAGGGGACCCCGGGACGGG - Exonic
1167806965 19:51793867-51793889 CAGGAAGGGGAGGCAGGGACTGG + Intronic
1168082901 19:54023359-54023381 CAGTGAGGGAAGCCCAGGAGGGG + Intergenic
1168152402 19:54456082-54456104 CAGCGAGGGACGCCCGGGGCTGG + Exonic
1168240656 19:55087278-55087300 GAGCGAGGGCAGCCCGGGCGCGG - Intronic
1168689485 19:58368270-58368292 CAGCGAGCGGAGTCCCCGACGGG - Exonic
926112685 2:10193010-10193032 CAGAGAAGGGAGCCCAGGGCAGG - Intronic
926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG + Intronic
926870194 2:17407801-17407823 CAGCATGGGGAGCCTGGGCCAGG - Intergenic
930558523 2:52930037-52930059 CAGCAAGGGGACCCTGGGCCTGG + Intergenic
931287292 2:60843154-60843176 CTGCGGGTGGGGCCCGGGACAGG - Intergenic
933808199 2:86015283-86015305 CAGGGAGGGGAAGCCGGTACTGG + Intergenic
934574638 2:95392202-95392224 CAGCCAGGAGAGCTCGGGAGAGG - Intergenic
935146219 2:100397454-100397476 CTGGGAGGGGAGCCCTGGCCCGG - Intronic
935645621 2:105330988-105331010 CAGCTAGTGGAGCCAGGGATTGG + Intergenic
936155331 2:110043146-110043168 CACGGAGGGGAGCCCAGCACAGG - Intergenic
936189349 2:110328267-110328289 CACGGAGGGGAGCCCAGCACAGG + Intergenic
936977785 2:118236694-118236716 CAGAGAGGTGAGCACTGGACAGG + Intergenic
936985774 2:118310486-118310508 CGGGGAGGGGAGCCCGGGAGGGG - Intergenic
937230941 2:120397780-120397802 CAGCGACAGGAGCCCGGGGTGGG + Intergenic
939612926 2:144332280-144332302 CGGCGCGGGGAGCCGGGGGCGGG - Intronic
940517151 2:154697471-154697493 CAGCGGGGGAAGGCAGGGACAGG + Intergenic
941911712 2:170770867-170770889 CGGCGAGGAGGGCCCGGGGCGGG - Intergenic
941916435 2:170816820-170816842 CAGAGTGGGGAGGCGGGGACCGG - Exonic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
946716501 2:222559177-222559199 CAGCGAGAGGAGCAGGGGCCGGG - Exonic
946921276 2:224584725-224584747 CCGCGCCGGGAGCCCGGGCCTGG - Intronic
948415390 2:237799030-237799052 CAGCGAGGCGGGCGGGGGACTGG + Intronic
948465867 2:238151348-238151370 CAGAGAGGGGAGCCGGGGGCCGG + Exonic
1169420012 20:5452386-5452408 GAACCACGGGAGCCCGGGACAGG - Intergenic
1170958572 20:21003991-21004013 CAGGGAGGGGAGGCAGGGAAGGG + Intergenic
1172118320 20:32584193-32584215 GAGCGCGAGGCGCCCGGGACAGG + Intronic
1172284742 20:33732409-33732431 CGGCGCGCGGGGCCCGGGACGGG + Intronic
1172380187 20:34483092-34483114 CAGCGTGGGGACCCTGGGCCCGG + Intronic
1172695499 20:36819981-36820003 CAGCCAGTGGGGCCCTGGACGGG + Intronic
1175174460 20:57102591-57102613 CAACCAGGTGAGCCCGGGAATGG + Intergenic
1175290348 20:57871104-57871126 CAGCGAGGGGAACCCGGAGCTGG - Intergenic
1175367825 20:58467636-58467658 CTGCGAGGTGCGCCCAGGACCGG - Exonic
1175722155 20:61294004-61294026 CAGTGTGGAGACCCCGGGACAGG + Intronic
1179545695 21:42111181-42111203 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545702 21:42111196-42111218 CAGCCAGGGGAGCCTCAGACAGG + Exonic
1179545717 21:42111256-42111278 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545734 21:42111316-42111338 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545741 21:42111331-42111353 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1180098647 21:45574147-45574169 CAGCGAGGAGAGCCCGGCAGAGG - Intergenic
1181476029 22:23168352-23168374 CAACCAAGGGAGCCCAGGACAGG + Intergenic
1182825518 22:33261377-33261399 AAGAGAGGGGAGCCTGAGACAGG - Intronic
1184278899 22:43426193-43426215 CAGCAAGGAGAGCCCCGGGCTGG - Intronic
1184352684 22:43955056-43955078 CAGCGGGGAGACCCCGGGTCCGG - Intronic
1185109676 22:48894026-48894048 CAGGGAGCTGAGCCCGGGGCAGG + Intergenic
1185391051 22:50562093-50562115 CAGTGAGGGGAGCGGGGGAGGGG + Intronic
950182595 3:10926146-10926168 GAGGGAGGGGAGCCTGGGCCAGG + Intronic
950506300 3:13396975-13396997 CAGCGATGGGAGGCAGGGAGAGG - Intronic
950796729 3:15516318-15516340 CAGGCAGGGGAGCACGGGGCTGG + Intronic
954799915 3:53181150-53181172 CAGTGAGGGCAGCCTGGGCCAGG - Intronic
955054266 3:55442119-55442141 CAGGGAGAGAAGCCAGGGACCGG + Intergenic
955410796 3:58654155-58654177 CTGGGAGGGGAGCCCTGGAAAGG + Intronic
955884446 3:63583013-63583035 CAGCGAGGGGAGACAGGAAAGGG + Intronic
956179302 3:66501947-66501969 CAGCTACGGGAGGCTGGGACAGG + Intergenic
960962870 3:123084364-123084386 CAGAGTGGGGAGGCTGGGACAGG - Intronic
961057863 3:123804250-123804272 CAGGGAGGGAAGCCAGGGAGAGG + Intronic
961067038 3:123884331-123884353 CCGCGAGGCGCGTCCGGGACTGG + Intronic
961067104 3:123884625-123884647 GTGCGAGGGGGGCCCGGGTCTGG - Intergenic
961440071 3:126947534-126947556 CAGTGAGAGGGGCCCGGGATAGG - Intronic
962324785 3:134423901-134423923 CAGAGAGGGGAGCAGGGGCCAGG - Intergenic
963102419 3:141620210-141620232 CAGCGAGGGGTGGCGGGGAGGGG + Intergenic
963511060 3:146250499-146250521 CAGCGAGTGGAGGCGGTGACAGG - Intronic
965198814 3:165631142-165631164 CAGCAAGGGGCCCCCGGGCCTGG - Intergenic
966883343 3:184361821-184361843 CGGAGAGGGGCGCCCGGGAGGGG + Intronic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
968701218 4:2059118-2059140 CAGCGCGAGGGGCCCGGCACGGG - Intergenic
968804587 4:2764014-2764036 CAGCGGGGAGAGCCAGGGCCTGG + Intergenic
968900321 4:3428192-3428214 CAGCGAGAGGAGCAGGGCACAGG - Intronic
968901999 4:3436289-3436311 GAGCGAGGGGAGCCAGAGGCGGG - Intronic
968948323 4:3677140-3677162 CAGCGGGAGGAGCCCGGGGCTGG + Intergenic
968976381 4:3824340-3824362 CAGGGAGGTGTGCCTGGGACAGG - Intergenic
969638221 4:8381789-8381811 CAGCCAGGGGGGCCCTGGGCAGG - Intronic
976595648 4:86892484-86892506 CAGGGAGGGGACGCCGGGCCCGG + Intronic
984852978 4:184169541-184169563 CAGAGAGAGGAGCCAGGGACAGG - Intronic
991645348 5:68795566-68795588 CAGAGAGGGGAGCTCGAAACGGG + Intergenic
992269905 5:75053468-75053490 GAGCGAGGGTCGCCCGGGGCTGG - Intergenic
992492133 5:77255577-77255599 CAGCCAGGGGAGTTCGGGGCTGG - Intronic
996857665 5:128028198-128028220 CAGGGATGGGAGCACGGGATAGG - Intergenic
998205983 5:140157256-140157278 CAGGGAGGGAGGCCCGGGGCTGG - Intergenic
999267673 5:150277416-150277438 CAGCGAGGGGGGCTCTGCACAGG + Intronic
999804925 5:155072310-155072332 CAGCATGGGGACCCTGGGACTGG + Intergenic
1000226492 5:159266691-159266713 CAGCGCGGGGACCCTGGGCCGGG - Intronic
1001492793 5:172167528-172167550 CAGCGAGGGCAGACTGGGACTGG + Intronic
1006079899 6:31559135-31559157 CAGCTTGGGGAGCCAGGGAGGGG - Intergenic
1007412581 6:41673573-41673595 GGGTGAGGGGAGCCCAGGACAGG + Intergenic
1009501568 6:64420285-64420307 CAGCCGGGGGAGCCTGGGCCTGG + Intronic
1010905756 6:81486111-81486133 CAGCATGGGGAGCTGGGGACCGG - Intergenic
1011517229 6:88166897-88166919 CAGCGAGCTGGGCCCGGGGCCGG + Intergenic
1016864159 6:148748571-148748593 GAGCCAGGGGTGCCAGGGACAGG + Intronic
1017231328 6:152077120-152077142 CAGCATGGGGACCCTGGGACTGG - Intronic
1018754547 6:166837695-166837717 AAGGGTGGGGAGCCCGGGAGGGG - Intronic
1019260794 7:80830-80852 CAGCGACAGGAGCCTGGGCCAGG + Intergenic
1020007317 7:4789639-4789661 CAGGGAGGGAAGCCCTGGGCTGG - Intronic
1020405695 7:7831615-7831637 CAGCGTTGAGAGCCCGGAACTGG + Intronic
1021036871 7:15810117-15810139 CAGCATGGGGAGCCTGGGCCTGG + Intergenic
1024249836 7:47497821-47497843 CAGGGTGGGGAGCCCGGTCCTGG - Intronic
1024424237 7:49207283-49207305 CAGAGATGGGAGCCAGGGAGGGG + Intergenic
1026735998 7:72949066-72949088 CAGCTGGAGGAGCCCGGGGCAGG - Exonic
1026786348 7:73304000-73304022 CAGCTGGAGGAGCCCGGGGCAGG - Exonic
1029269066 7:99365702-99365724 CAGCAGGGGGAGCCCCGGCCTGG + Intronic
1029681974 7:102117631-102117653 CAGCCAGGGGAGCTGGGGAAGGG + Intronic
1030270008 7:107660885-107660907 CCGGGAGTGGAGCCCGGGCCGGG - Intronic
1030967032 7:116005839-116005861 CAGCATGGGGACCCTGGGACTGG - Intronic
1031887000 7:127253413-127253435 CTGCCTGGCGAGCCCGGGACCGG + Intergenic
1032016377 7:128382797-128382819 CAGAGAAGGGAGCCCAGGAAAGG + Intergenic
1036003321 8:4633092-4633114 CCGAGAGGGGAGCCTGGGGCAGG + Intronic
1036665541 8:10734768-10734790 CAGAGAGGGGAGACCCGGCCAGG + Intronic
1037948805 8:23005631-23005653 CAGTGAAGGGAGCCTGGGTCCGG + Intronic
1039870358 8:41540508-41540530 GAGGGAGGGGAGCCGGGGAAGGG + Intronic
1043687553 8:83106873-83106895 CAGAGAGGGGAGCTGGGGAGGGG - Intergenic
1044631025 8:94278704-94278726 CAGAGAGGGGAGCTGGAGACGGG + Intergenic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1051270926 9:15354185-15354207 CAGGTAGGGGAGCCAGGGAGTGG - Intergenic
1051860859 9:21623348-21623370 CAGCAAGGGGACCCTGGGCCTGG + Intergenic
1052351808 9:27465879-27465901 CAGCACGGGGATCCTGGGACCGG + Intronic
1055037114 9:71829512-71829534 CAGAGAGGGAAGCCCAAGACTGG + Intergenic
1055758803 9:79584131-79584153 CAGCGAAGGGAGCCCTGGAAGGG - Intronic
1062022420 9:134325929-134325951 CCGCGAGGGGACCCCGGCCCGGG - Intronic
1062332926 9:136052464-136052486 CAGCTAGGGGAGCCAGGGAAGGG + Intronic
1062618079 9:137407110-137407132 CGGCGTGGGGTGCCCGGGACTGG - Intronic
1062696036 9:137877122-137877144 CAGAGCTGGGAGCCCAGGACAGG + Intergenic
1186772198 X:12829173-12829195 CAGAGAGGGAAGCCCAAGACAGG - Intergenic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1193554189 X:82932887-82932909 CAGAGAGGAGACCCTGGGACAGG - Intergenic
1195285236 X:103376912-103376934 CAGCGAGGGGAGCCCGGGCTCGG + Intronic
1197385772 X:125799106-125799128 CAGAGAGGGGAGGTAGGGACAGG + Intergenic
1200827134 Y:7657473-7657495 CAGCGAGGGGAGCAGAGGCCAGG + Intergenic
1200884097 Y:8252016-8252038 CAACGAGGGGAGCCGAGGCCAGG + Intergenic