ID: 968512278

View in Genome Browser
Species Human (GRCh38)
Location 4:1001005-1001027
Sequence CCCTGGGGCCCTGGCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 0, 2: 6, 3: 86, 4: 735}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968512263_968512278 16 Left 968512263 4:1000966-1000988 CCAGCCTGGCCAGGAGATACATC 0: 1
1: 0
2: 3
3: 24
4: 232
Right 968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG 0: 1
1: 0
2: 6
3: 86
4: 735
968512268_968512278 7 Left 968512268 4:1000975-1000997 CCAGGAGATACATCGGTGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 44
Right 968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG 0: 1
1: 0
2: 6
3: 86
4: 735
968512265_968512278 12 Left 968512265 4:1000970-1000992 CCTGGCCAGGAGATACATCGGTG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG 0: 1
1: 0
2: 6
3: 86
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968512278 Original CRISPR CCCTGGGGCCCTGGCCGGGG CGG Intronic
900135714 1:1116142-1116164 GCCTGGCGCCGGGGCCGGGGCGG - Intronic
900192133 1:1356211-1356233 CCCGAGGGCCCTGGCAGGGGAGG + Intronic
900341599 1:2192043-2192065 GCCTGGAGCCCTGGCAGAGGCGG - Intronic
900372252 1:2337196-2337218 GACCGGGGCCCTGGCCGGAGAGG + Intronic
900395936 1:2453265-2453287 CCCTGGGGCCCTTCCCCGTGTGG + Intronic
900431930 1:2606665-2606687 CCCTGGGGCCAGGGCCTGGCCGG + Intronic
900542755 1:3212351-3212373 CCCTCTGGCCCTGGCCTGAGTGG + Intronic
900600643 1:3501384-3501406 CCCTGGAGCCACGGCCGAGGAGG + Intronic
900622399 1:3593433-3593455 GCCTGGGGTCCTGGGTGGGGCGG - Intronic
900643866 1:3699963-3699985 TCCTGGGGCCCTGGGCTTGGCGG - Intronic
901005385 1:6169380-6169402 CGAGGGGGCCCTGGCCGGGCAGG + Intronic
901030077 1:6302018-6302040 TTCTGGGGCCCAGGCCAGGGGGG + Intronic
901083289 1:6595748-6595770 CCCTGGAGCCCTGGCTGAGTGGG - Intronic
901160386 1:7172800-7172822 CCCCGGGGCCCTGGAGGGTGAGG + Intronic
901630657 1:10646690-10646712 CCGTGAGGCCCTGGCTGGCGTGG + Intronic
901810328 1:11763794-11763816 CCCTGGAGCACTGGGCGGAGTGG - Intronic
902803938 1:18849277-18849299 GCCTGGGGCCCTTGCTGGAGTGG - Exonic
902988623 1:20170972-20170994 TCCTGGGGTCCTGGGCTGGGAGG + Intronic
902988859 1:20172095-20172117 TCCTGGGGTCCTGGGCTGGGAGG - Intronic
903369971 1:22829229-22829251 CCCTGGAGCCTTGGCAGGGAAGG + Intronic
903678958 1:25084184-25084206 CCCTGGGGCCCTGGGCCTTGAGG - Intergenic
903767340 1:25743312-25743334 CCCTAGGGCTGTGGCTGGGGCGG - Intronic
903830133 1:26169726-26169748 CCCGCGGGCCCTCGCTGGGGAGG - Intergenic
903986643 1:27234118-27234140 CCCCGGGGCCCTAGCCTGAGAGG + Intergenic
904041937 1:27590280-27590302 CCCTGGGGAGCTGGGCGGGGAGG + Intronic
904471210 1:30737566-30737588 CCCTGCGGCTCTGGGAGGGGTGG - Intronic
904619062 1:31764498-31764520 GCCTGGGGCCCAAGGCGGGGAGG - Intronic
904786481 1:32986991-32987013 CCTTGGGGCCCTGGAATGGGAGG + Intergenic
905639213 1:39576892-39576914 CCCGGGGGCCCGAGGCGGGGCGG + Intergenic
906141050 1:43533631-43533653 CCCTGGGACCCAGTCCGGGTTGG - Intronic
906191756 1:43903529-43903551 CCCTGGGGCCTAGGCTGGGTGGG + Intronic
907283988 1:53368713-53368735 CTGTGGGGTCCTGGCAGGGGCGG + Intergenic
907284608 1:53371624-53371646 CCCTGGTGCCCAGGCTGTGGGGG - Intergenic
907372926 1:54014567-54014589 CTGTGGGCCCCTGGCCAGGGTGG - Intronic
907505900 1:54918110-54918132 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
907520357 1:55019719-55019741 CCCTGGGGCCCGGGCTGCTGGGG + Intergenic
910590665 1:88925592-88925614 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
911073027 1:93847181-93847203 CTCTGGGGTCCCGGCCGGGCTGG + Intergenic
912977861 1:114346267-114346289 CCCGGGGGCCCTGGGCCAGGAGG - Intergenic
914490007 1:148146136-148146158 CCCGGGGGCGCGGGCCGGGGTGG + Intronic
914503100 1:148264792-148264814 CGCTGGGTCCCTGGCGGGGGGGG + Intergenic
915345440 1:155194791-155194813 CCCGGGAGCGCGGGCCGGGGAGG + Intergenic
916058490 1:161083748-161083770 CCGTGGGGGCCTGGCCAGGGTGG - Intronic
916818879 1:168379035-168379057 CACTGTGGCCCTGGCTGTGGTGG + Intergenic
917055641 1:170978460-170978482 GCCAGGGGCCCTGGCTGGTGAGG + Intronic
917291600 1:173477228-173477250 CGCTGGGGGCCGGGCCGCGGGGG - Intergenic
917725877 1:177826608-177826630 CCCTGGGGCTCTGGTTGGAGTGG + Intergenic
918066114 1:181102995-181103017 CCCTAGGGCCCTGGCCAAAGGGG - Intergenic
919777952 1:201206337-201206359 GCCTGGGGCCCTGGACAGGAGGG + Exonic
919786674 1:201262485-201262507 CTCTGGGTCCCTGGCCCTGGGGG - Intergenic
919824636 1:201494577-201494599 CCCTGCTGCCCTGTGCGGGGTGG + Intronic
919937583 1:202264848-202264870 CCCTGGGGTGGTGGCGGGGGCGG - Intronic
920385636 1:205568908-205568930 CCCTTGGGCCCGGGCGGCGGCGG - Intronic
921390444 1:214608849-214608871 CGGTGGGGGCCTGGCCCGGGCGG - Intronic
921390531 1:214609078-214609100 CCCAGGGGCGCGGGCCGGGGTGG - Intronic
922338804 1:224639126-224639148 CCCTGGGGTCCTTGCTGGGAGGG - Intronic
922348900 1:224719963-224719985 CCCTGTGGCCCAGGCAGAGGGGG - Intronic
922421927 1:225466025-225466047 CTCTGAGCCCCTGGACGGGGGGG + Intergenic
922422095 1:225467044-225467066 CACTGGGTTCCTGGGCGGGGAGG - Intergenic
922467968 1:225857361-225857383 GCCTGGAGTCCTGGCCGGCGGGG + Intronic
922674488 1:227542320-227542342 CCCTGGAGCCCTGGGCGACGCGG + Intergenic
924380381 1:243458213-243458235 GCCAGGGTCCCTGGCCAGGGAGG - Intronic
924510017 1:244722496-244722518 CTCTAGGGCCCTGGCCAGTGAGG + Intergenic
1062966664 10:1612337-1612359 GCCTCGGGTCCTGGCTGGGGAGG - Intronic
1063395705 10:5685183-5685205 CCCGGGCGCCCAGGCCGAGGAGG - Intronic
1064086400 10:12349324-12349346 CCCTGGAGCCCCGGCGAGGGCGG - Intergenic
1064094971 10:12417527-12417549 CTCTGGGGCTCCGGCTGGGGTGG + Intronic
1065124887 10:22564826-22564848 CGCTGGGGACCTGGTCGGTGAGG - Intronic
1067225432 10:44373224-44373246 GCCTGGGGCCCTGCCCTGGCAGG + Intronic
1067668465 10:48299039-48299061 CTCTGGGGCCCAGGCTGGGAGGG - Intergenic
1067765161 10:49080382-49080404 CCCTGGGGCCTAGGCCAGGGAGG - Intronic
1067848256 10:49739573-49739595 CCCTGGGCCCCTTGTCGGGTTGG - Intronic
1068538634 10:58267917-58267939 CCCTGGGGCCCTGACGGCGACGG + Exonic
1069571730 10:69498345-69498367 CCCTGGACCCCTGGCCTGTGGGG + Exonic
1069636335 10:69927134-69927156 TCCTTGGGCACTGGACGGGGGGG + Intronic
1069729669 10:70602597-70602619 GCCTGGGGCCCTGGGTGGAGGGG - Intronic
1070302097 10:75210965-75210987 CCCAGGGGCCTAGGCCGCGGCGG + Intronic
1070796982 10:79222620-79222642 CCCTGGGCCCCTGGCCAGCCTGG + Intronic
1071784111 10:88880211-88880233 CCCAGGGGCCGGGGCAGGGGAGG + Exonic
1072082509 10:92045832-92045854 CCCAGGGGCCCTGGCCTGGGCGG - Intergenic
1072472204 10:95723359-95723381 ACTTGGGGCCCTGGCAAGGGTGG + Intronic
1072654309 10:97319672-97319694 CCCGGGGCCCCTGGCTGCGGCGG + Exonic
1072656577 10:97334332-97334354 CCCGGGGCCCCTGGCTGCGGCGG - Exonic
1072788095 10:98297896-98297918 CCCAGTGTCCCTGGCAGGGGAGG - Intergenic
1073041860 10:100613223-100613245 CCCAGGTGCCCTGGCCAGCGAGG - Intergenic
1073057947 10:100714053-100714075 CGCAGGGGCACTGGCGGGGGCGG + Intergenic
1073118661 10:101108122-101108144 GCCTGGGTCCCTGGCAGGGCTGG - Intronic
1073488547 10:103837527-103837549 CCCTGGGGCCATGGCCCAGGAGG + Intronic
1074065275 10:110007885-110007907 CCTTGGGGGCGTGACCGGGGGGG + Intronic
1074534013 10:114315778-114315800 CCATGGGGCCCTGACCGAGCTGG - Intronic
1074842972 10:117374214-117374236 ATCTGGGGCCCTGTCCAGGGTGG + Intronic
1075451125 10:122552683-122552705 CGCTGGGGCCCTGGGCTGAGTGG - Intergenic
1075639009 10:124050816-124050838 CCCTGGGGCACAGGCTGGTGGGG + Intronic
1075714749 10:124549731-124549753 CCCTGTGGGCATGGCCGGGGTGG + Intronic
1076175694 10:128366227-128366249 CCCTGCGGACCAGGCCGGGCAGG + Intergenic
1076346830 10:129785072-129785094 CCCTGTGGTCCTGGCCAAGGAGG + Intergenic
1076357304 10:129862546-129862568 CCCTGGGGACGTGGCTGGGTCGG - Intronic
1076529436 10:131134821-131134843 CCCTGGGGCAGTGGCCGCAGAGG - Intronic
1076696922 10:132251488-132251510 CCCTGTGGCCCTGGGAAGGGGGG + Intronic
1076706467 10:132304786-132304808 CCCTGGGCGCCGGGCCGGGCAGG - Intronic
1076743998 10:132503755-132503777 CCTTGGTACCCTGGCAGGGGAGG - Intergenic
1076785722 10:132748951-132748973 CCCTGGGGCGCAGGCTGGGGTGG - Intronic
1076880858 10:133238431-133238453 CCCTCGGCACCAGGCCGGGGTGG - Intronic
1076991709 11:279224-279246 CCCTGAGGCCCTGCCCGCGGTGG + Intronic
1077105827 11:842321-842343 CCCTGGGGTGCGCGCCGGGGCGG - Intronic
1077106298 11:843961-843983 GCCCAGGGCCCTGGCCAGGGTGG - Intronic
1077159818 11:1107590-1107612 CCCCGGGGGCTTGGCCTGGGAGG + Intergenic
1077167201 11:1149054-1149076 AGGTGGGGCCCTGGACGGGGTGG + Intergenic
1077308993 11:1880273-1880295 CCCTGGGGCCTGGGCAGAGGGGG + Intronic
1077383193 11:2257048-2257070 CCCTGGGGCTCTGGGAGTGGAGG + Intergenic
1077442611 11:2575634-2575656 CCCTGGCTGCCTGGCCGGCGAGG - Intronic
1077466300 11:2735289-2735311 GCCTGGGGCCCTGGGGTGGGAGG + Intronic
1078250720 11:9614298-9614320 CCCAGGGGCCCCGGCGTGGGTGG - Intergenic
1079034997 11:17013767-17013789 CGCTGGGGACCTGGGCCGGGGGG - Intronic
1079303061 11:19296626-19296648 CCCTGGAGGCATGGCCTGGGGGG + Intergenic
1079333786 11:19553780-19553802 CCCTGGAGCCCTGGCAGCTGTGG - Intronic
1079339714 11:19601981-19602003 CCATGGGGCCCTGGTGGGGCAGG - Intronic
1079601569 11:22316907-22316929 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
1079689458 11:23403696-23403718 CCCTGGGGCCCTGGAGCAGGTGG + Intergenic
1081969168 11:47186357-47186379 CCCTGGGCCCCTCGGCGGGTGGG + Intronic
1081988964 11:47327486-47327508 GCCTTGGGCCCTGCCCTGGGTGG + Intronic
1083659297 11:64244897-64244919 TCCTGGGGGGCTGGCGGGGGTGG - Intronic
1083777738 11:64902446-64902468 CCCGAGGGCCATGGCAGGGGAGG + Intronic
1083856777 11:65396871-65396893 CCGTGGGGCCAGGGCCGGGCCGG + Exonic
1084012951 11:66362867-66362889 CCCTGGGGCCCAGGCCCAGCTGG + Exonic
1084019881 11:66411080-66411102 CCCTGGAGACCTGGCCTGTGTGG - Intergenic
1084148608 11:67277837-67277859 CCCTGCGGACCTGGCCCGGAGGG + Intronic
1084274176 11:68043302-68043324 CCCGGGGGGCCTGGTGGGGGAGG + Intronic
1084372558 11:68753533-68753555 CCCTGCTGCACTGGCCGGGCTGG + Intergenic
1084604163 11:70162707-70162729 CCCTGGGACCCTGGGCCAGGAGG - Intronic
1084749423 11:71194347-71194369 ACCTGGGGACCTGGGCGTGGGGG + Intronic
1085010763 11:73140817-73140839 CCCTGGGGCCCCGGCCTGGCGGG - Intronic
1085054436 11:73395512-73395534 CACTGCGGCCCTGCCCTGGGAGG + Exonic
1085457006 11:76670912-76670934 CCCTGGGACCTCGGCCGGGAAGG + Intergenic
1088521971 11:110711326-110711348 CCCTGGGACTCTGGCCGGGCTGG - Intronic
1089366617 11:117924635-117924657 CCCTGGGGTTGTGGCAGGGGAGG + Intronic
1089533857 11:119149220-119149242 CCCGGCGGCCCGGGCCGGGGCGG - Exonic
1089557168 11:119320966-119320988 CCCAGGGGACCCGGCCGCGGCGG + Intronic
1089643241 11:119861289-119861311 TCCTGGGGCCCAGGATGGGGAGG - Intergenic
1089692777 11:120197295-120197317 CCCTGGGGAAATGGCTGGGGAGG - Intergenic
1089981464 11:122776424-122776446 CCCTGGGGCCAGGGCAGAGGAGG - Intronic
1090003995 11:122984325-122984347 TCCTGGGGCCCCGGCAGAGGCGG - Intergenic
1090799033 11:130159538-130159560 TCCAGGGGCCCTGCCCCGGGAGG - Intergenic
1091222154 11:133935987-133936009 CTCAGGGGCCCTGCCCGTGGGGG + Intronic
1091243261 11:134069276-134069298 CCCGGGGTCCCGGGCCGGAGGGG + Intronic
1091601870 12:1922624-1922646 CCCTGGGGGGCTGTCCTGGGGGG - Intergenic
1091705175 12:2688718-2688740 CCCTGGGGCCCCAGCCTGGCTGG - Exonic
1091962218 12:4705658-4705680 CCCTTAGGCTCTGGCCGGAGTGG + Intronic
1092054675 12:5499088-5499110 CCCTGGGGCCAGGGCTGTGGAGG - Intronic
1092469755 12:8767275-8767297 ACTTGGGGCCCTGGCAAGGGTGG + Intronic
1094512524 12:31104998-31105020 CCCTGCTGCCCTGGAAGGGGCGG - Intergenic
1095138747 12:38637691-38637713 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
1095283641 12:40385073-40385095 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
1096101756 12:48973962-48973984 CACTGGGGCCCTGGAGGGCGGGG + Intergenic
1096389627 12:51218185-51218207 CCCTCTGGCCCTGGCCGAGCGGG + Intergenic
1096515406 12:52152620-52152642 CCCTGGGTTCCTGCCCGCGGAGG - Intergenic
1096669478 12:53190079-53190101 CACTGGGTCCTTGGCAGGGGTGG - Exonic
1096981271 12:55729168-55729190 CCACGTGGCCCTGGCCGGGCGGG - Intronic
1097007203 12:55927896-55927918 CCCTAGGGCCCAGCCCGAGGAGG - Exonic
1101023148 12:100573673-100573695 CCCTGAGGCCCAGGCGGCGGCGG + Intronic
1101217184 12:102596146-102596168 CCCTGGAGCCCTGGTGGCGGCGG + Intergenic
1102977603 12:117217796-117217818 CCCTGAGGCCCTGTCCAGTGTGG - Intronic
1103091934 12:118103882-118103904 CCCGAGCGCCCTGGCCGGGGAGG + Exonic
1103309147 12:119990105-119990127 GCCTGGGTCTCTGGCCGAGGGGG + Exonic
1103321894 12:120097007-120097029 TCCAGGCGCCTTGGCCGGGGAGG + Exonic
1103433009 12:120904058-120904080 CCCTGGGCCCCGGGGCGGGGCGG + Exonic
1103604871 12:122078993-122079015 CGCGTGGGCCCGGGCCGGGGTGG - Exonic
1103961749 12:124613278-124613300 CCCTGGAGCCCTGAGCTGGGAGG - Intergenic
1104735084 12:131131607-131131629 CCCAGGAGCCCTGGCTGGGCAGG + Intronic
1104754151 12:131258443-131258465 ACCTGGGGAGCTGGGCGGGGGGG + Intergenic
1104857596 12:131909341-131909363 CCCTCGGGTCCTGGCTGGCGGGG + Intronic
1104972313 12:132537438-132537460 CCCTGGGACACGGGCCAGGGAGG - Intronic
1105208981 13:18246860-18246882 TGCTGGGACCCTGGCCGGGCTGG - Intergenic
1106242012 13:27920288-27920310 CCCTGGCGCCCTGGGCGCGCTGG + Exonic
1106928123 13:34634120-34634142 CCCTGGAGCTCTGGCTGGGATGG + Intergenic
1108643561 13:52405869-52405891 CCCTGGGGCCGAGGCGGGTGTGG + Intronic
1108744478 13:53377696-53377718 CCCTGGGTCCCTGTTCAGGGAGG - Intergenic
1109465028 13:62719757-62719779 CCCTGGGGCTGTGGGCTGGGAGG + Intergenic
1109793417 13:67279065-67279087 CCCTGGGGTCCGGGCAGGGATGG - Intergenic
1110630083 13:77697807-77697829 CCCTGTCGCCCCGGCCTGGGGGG - Intergenic
1111021629 13:82458746-82458768 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
1112330816 13:98475740-98475762 CCCTCTGGCCATGGCAGGGGCGG + Intronic
1112509670 13:99997994-99998016 CACAGGGGCCCTGGGCTGGGTGG - Intergenic
1113505250 13:110812232-110812254 CACTGCGGGCCTGGCCGTGGAGG - Intergenic
1113695604 13:112343278-112343300 CCCGCGGGGCCAGGCCGGGGAGG + Intergenic
1113711365 13:112467366-112467388 CTCTCGGGCGCTGGCTGGGGAGG + Intergenic
1113802339 13:113093099-113093121 GACTGGGGGCCTGGACGGGGAGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114248215 14:20934383-20934405 CACTGAGGCTCTGGGCGGGGCGG + Intergenic
1115985863 14:39103170-39103192 CGCTGAGGCCCGGGGCGGGGTGG - Exonic
1116692726 14:48131199-48131221 CACTGGGGGCCTGTCGGGGGTGG - Intergenic
1118265989 14:64295079-64295101 CCCTGGGGCTCCTGCTGGGGTGG - Intronic
1118638076 14:67766438-67766460 CGCTGGGGGCCTGGCCGGGGTGG + Exonic
1118749538 14:68795872-68795894 CCCTCGGGCCCTCACCGCGGCGG - Intronic
1118905182 14:70018547-70018569 TCCTGGAGCCCTGGCCAGAGGGG - Intronic
1118905578 14:70020970-70020992 CCCAGAGGCCCTGCCAGGGGAGG - Intronic
1119712349 14:76831324-76831346 CCCTGGGGCCCAGGCCGTGGTGG - Exonic
1119726979 14:76927272-76927294 GCCAGGGGCCCAGGCCTGGGTGG - Intergenic
1119765769 14:77186733-77186755 CCCTGAGGACCTGGCAGAGGGGG + Intronic
1119806334 14:77484758-77484780 CTCTGGGGTCCTGGGAGGGGTGG + Exonic
1121001531 14:90454844-90454866 CCCGGGGACCCTGGCCGGCCAGG + Intergenic
1121368028 14:93332665-93332687 CGCTGGGGCGCCGGGCGGGGAGG - Intronic
1121585562 14:95060774-95060796 CCCTGGGGCCCTGGAGCAGGTGG - Intergenic
1122140625 14:99660847-99660869 CCCTGCAGTCCTGGCTGGGGTGG - Intronic
1122162267 14:99793235-99793257 CCGCGGGGCCCGGGCCGGGAGGG - Intronic
1122205195 14:100144829-100144851 CCCAAGGGCCATGGCAGGGGAGG + Exonic
1122211637 14:100177854-100177876 GCCTGGGGACCTGGCTGGCGGGG - Intergenic
1122214123 14:100192433-100192455 ACCTGGGGCCATGGCTGGGGAGG + Intergenic
1122255347 14:100472204-100472226 CCCTGGAGCCCCGGCTGGGCAGG + Intronic
1122297062 14:100711698-100711720 CCCTGGGGCCCCAGCCGGCCTGG - Intergenic
1122688669 14:103521623-103521645 CCCTGGGCCCCAGGCCGCTGTGG + Intronic
1122719868 14:103716022-103716044 CCCGCGGGGCCGGGCCGGGGCGG - Intronic
1122791198 14:104184894-104184916 CCCGGGGTCCCGGGCCGGGAGGG + Intergenic
1122798102 14:104216460-104216482 CCCTGGGGAGTTGGCAGGGGTGG + Intergenic
1122877709 14:104676603-104676625 CCCTGGGGCCCTGGGAAGAGGGG - Intergenic
1122976784 14:105174117-105174139 CCCAGTGGCCCAGGCTGGGGAGG + Intronic
1123035972 14:105472104-105472126 GCCTGGGTGTCTGGCCGGGGAGG - Intergenic
1123057299 14:105577451-105577473 CCTTGGGGGCCAGGCCTGGGGGG + Intergenic
1123630790 15:22258305-22258327 CCCCGGGGCCCGCGCGGGGGAGG - Intergenic
1124723497 15:32133849-32133871 TCCTGTGGACCTGGCCGGAGGGG - Intronic
1126796023 15:52261184-52261206 CACGGGGGCCTTGGCCGGGTGGG - Intronic
1127582725 15:60352331-60352353 CCTTGGGGCCCTGGCTGGGGCGG - Intronic
1128381909 15:67119437-67119459 TGCTGGGGCCATGGCGGGGGTGG + Intronic
1128450497 15:67803492-67803514 CCCTGGGACCCTGGCAGGTGTGG - Intronic
1128582173 15:68818187-68818209 CCCTGCGCCCCGCGCCGGGGAGG + Intronic
1129162113 15:73752850-73752872 GCCGGGGGCCCCGGCCGGGCTGG + Intergenic
1129194529 15:73956063-73956085 CCCTGGGCCCTTGGCAGGGCGGG + Intergenic
1129221516 15:74134276-74134298 CGCTGGGGCCCTGGGCCCGGCGG + Exonic
1129278134 15:74461078-74461100 CGCTGGGGCCCTGGGCAGCGCGG - Exonic
1129321095 15:74775460-74775482 GCCTGGGGGCCTGGCAGAGGGGG - Intergenic
1130027988 15:80286277-80286299 GCCTGGGGCCTTGGCAGGGTAGG - Intergenic
1130137026 15:81190037-81190059 GCCAGGGGCCCTGGCCTGCGTGG - Intronic
1130330328 15:82917442-82917464 CCCTGGGGCCCTGGGAGAGGAGG - Intronic
1130540480 15:84817728-84817750 GCCTGGGGACATGGCCGGGCTGG + Intronic
1131085969 15:89575853-89575875 CCCTGGGCGCCGGGCCGGGCAGG - Exonic
1131144293 15:90001569-90001591 CGCTGGGGCCCTCGGCGGGCCGG - Exonic
1131257448 15:90871725-90871747 CCCGGGTGCTCGGGCCGGGGAGG + Intronic
1132469780 16:95952-95974 CCCTGGGGCCCAGCCCTGGTGGG - Intronic
1132552675 16:559928-559950 CCCAGGGGCCCTGGCTCGGGTGG + Intergenic
1132591403 16:727860-727882 CCCCGGGGCTCTGGCCGGCCTGG + Intronic
1132695634 16:1200636-1200658 CCCTGGGGTCTGGGCTGGGGGGG - Intronic
1132827358 16:1911970-1911992 CCACGGGGCCCAGGCCGTGGCGG + Exonic
1132897741 16:2236959-2236981 AGGTGGGGCCCGGGCCGGGGCGG + Exonic
1133020448 16:2964669-2964691 CCTTGGGGGCCTGGCCCTGGGGG - Intronic
1133033626 16:3023057-3023079 CCCTGGGGACCTGGACCTGGTGG - Intronic
1133045533 16:3086600-3086622 CCCTGGGCCCCCGGCCTGAGGGG + Intergenic
1133125453 16:3643073-3643095 CCCTGGGGCACTGGCTGGGCGGG + Intronic
1133219823 16:4315420-4315442 CCCTGCGGCCCCGGGCGGCGGGG - Exonic
1133220166 16:4316279-4316301 CCGTGGGGACCGGGCCGGGGCGG + Intronic
1133225691 16:4339233-4339255 GCCTGGGGCCCTCACAGGGGTGG - Exonic
1133906484 16:10027371-10027393 CCTTGGAGCACTGGCAGGGGGGG - Intronic
1134018795 16:10907451-10907473 CCCCGGGGCCCTGGCAGAGCTGG + Exonic
1134042978 16:11082296-11082318 CCCTAGGGCCCTGGCCCTGCAGG - Intronic
1134121283 16:11586698-11586720 GCGTGGGGGCCCGGCCGGGGCGG - Intronic
1134523819 16:14929986-14930008 TGCTGGGGGCCTGGCCGGAGAGG + Intronic
1134549084 16:15130949-15130971 TGCTGGGGGCCTGGCCGGAGAGG - Intronic
1134711410 16:16328471-16328493 TGCTGGGGGCCTGGCCGGAGAGG + Intergenic
1134955419 16:18380222-18380244 TGCTGGGGGCCTGGCCGGAGAGG - Intergenic
1135335799 16:21599904-21599926 GGCTGGGGCCGGGGCCGGGGCGG + Intronic
1135607252 16:23835732-23835754 CCCGGGGGCCGAGGACGGGGTGG + Intergenic
1135937243 16:26791821-26791843 CCCTGTGGCCCTTCCTGGGGAGG - Intergenic
1136414031 16:30092661-30092683 CCCTGGCGGCCAGGCCGGGCTGG + Exonic
1136477829 16:30524495-30524517 ACCTGGGGCCCCAGCAGGGGTGG - Exonic
1136483788 16:30558264-30558286 CCCTTGGGCCCGGGCCGGGGAGG - Exonic
1136519452 16:30786700-30786722 CCCGGGGGCCGGGGCAGGGGCGG - Intronic
1136519528 16:30786887-30786909 GCCCGGGGCTGTGGCCGGGGTGG - Intronic
1137249478 16:46731650-46731672 CCCTGGGTCACTAGCCCGGGTGG + Intronic
1137734882 16:50716408-50716430 CCCACGGTCCCTGGCCAGGGAGG - Intronic
1137926613 16:52547016-52547038 CGCTGGGGCCCGGGTCGGCGAGG + Intronic
1138489283 16:57366816-57366838 CCCAGGGGCCCTGGAGGTGGCGG + Intergenic
1138581001 16:57940320-57940342 CCCTGTGACCCGGGGCGGGGTGG + Exonic
1139320613 16:66111016-66111038 CCCTGGAGCCATGGATGGGGGGG - Intergenic
1139446245 16:67000456-67000478 CCCCGGGGCCCAGGACTGGGAGG - Intronic
1139472867 16:67187538-67187560 CCCGGGGGACCTGGCCCAGGGGG + Exonic
1140068164 16:71627027-71627049 CCATGCGGGCCGGGCCGGGGAGG - Intronic
1140124941 16:72111089-72111111 CCTTCGGGCTCTGGCTGGGGTGG + Intronic
1140135372 16:72200939-72200961 CCATAGGGACCTGGCCGTGGGGG + Intergenic
1140217632 16:73021273-73021295 CCCTGTGGCCTTGGCTGGGCTGG - Intronic
1141126252 16:81403178-81403200 CCCTGTCGCCCGGGCCGGAGTGG - Intergenic
1141317368 16:82975180-82975202 CCTTGGGGCCCTGGCTGCTGTGG + Intronic
1141431386 16:83971987-83972009 CCCTGGATCCCAGCCCGGGGAGG + Intronic
1141608819 16:85170108-85170130 CCCTGGGGCCCCGTCCTGGTGGG - Intergenic
1141615298 16:85206676-85206698 CGCTGGGGGCCCAGCCGGGGAGG - Intergenic
1141685068 16:85565530-85565552 CCATGGGCCCCTCGCCGGTGTGG - Intergenic
1141692128 16:85602439-85602461 CCCTTGGGCCCTGGCCGCCCTGG + Intergenic
1141999339 16:87655201-87655223 CCCAAGGGCCCTGGCGGGGGTGG - Intronic
1142107691 16:88315163-88315185 CCCTGGAGCCCTGGCCCTCGGGG - Intergenic
1142141368 16:88474222-88474244 CCCAGGGGCAGTGGCCCGGGCGG - Intronic
1142223527 16:88866513-88866535 CCCTGAGGCCCAGGGCTGGGGGG - Exonic
1142252288 16:88997544-88997566 CCCCGCAGCCCTGGCCGGGCTGG - Intergenic
1142262790 16:89050547-89050569 CCCTGGGGCCCTCGAGGGAGGGG + Intergenic
1142719492 17:1766811-1766833 CCCCTGGGTCCTGGCTGGGGTGG + Intronic
1142762380 17:2050115-2050137 CCCTAGGGACCCGGACGGGGCGG + Intergenic
1142812559 17:2402017-2402039 CTCTGGGGCCGGGGCCAGGGCGG + Intergenic
1142903139 17:3025936-3025958 GCCTGGGGCCGTGGATGGGGTGG + Intronic
1142903473 17:3027402-3027424 CCCTGGAGCGCTGGCAGGTGGGG - Intronic
1143018539 17:3904463-3904485 CCCTAGGGCCCTGGGGGGTGGGG - Intronic
1143166367 17:4899170-4899192 CACAGTGGCCCTGGCCCGGGGGG - Intronic
1143409948 17:6702829-6702851 GCCTGGGAGCCTGGCAGGGGTGG - Intronic
1143527075 17:7479183-7479205 GCCTGGGGCCGTGGAAGGGGAGG - Intronic
1143590975 17:7885587-7885609 CCCTCGGGCTCTGGCCCCGGTGG + Intronic
1143635554 17:8162323-8162345 CCCTGCTGCCCCGGCTGGGGAGG - Exonic
1143754937 17:9059928-9059950 CACTGGGGCCCAGGGAGGGGAGG + Intronic
1143858821 17:9872983-9873005 CCCTGGAGCCCAGGCCAGGCCGG - Intronic
1144753932 17:17668315-17668337 CCAGGGGGCCCTGGCCAGGGTGG - Intergenic
1144773109 17:17770558-17770580 CCCTAGGGGCCTGGCCTGCGAGG + Intronic
1144875444 17:18394842-18394864 TACTGGGGCCCTGGCATGGGGGG - Intergenic
1145156781 17:20549579-20549601 TACTGGGGCCCTGGCATGGGGGG + Intergenic
1145190613 17:20840787-20840809 CCCGGGGGCGCGGGCCGGGGTGG + Intronic
1146646673 17:34581066-34581088 CCCCGGGGCCATGGCCGAGGCGG - Exonic
1147327098 17:39674844-39674866 CCCAGGGACCCTGGCTGGGTGGG - Intronic
1147331227 17:39700463-39700485 CCCTGGGGCCCTCGGGCGGGAGG + Intronic
1147598941 17:41734132-41734154 CCCCGGGGTCCTGGACCGGGTGG - Intronic
1147673472 17:42190051-42190073 CCCTGGGGCTCTGGGAGGGGAGG - Intronic
1147882868 17:43665313-43665335 CCCTTTGCCCCTGGACGGGGTGG + Intergenic
1148035582 17:44656901-44656923 CGCTGAGGCGGTGGCCGGGGAGG + Intronic
1149496433 17:57121120-57121142 CACAGGGGCCCTGGCCAGAGGGG - Exonic
1149526083 17:57356999-57357021 CCCTGGGCAGCTGGCCTGGGAGG - Intronic
1149568097 17:57653481-57653503 CCCCGGGGCCCGGGGCTGGGGGG - Intronic
1149595326 17:57861810-57861832 GCCTGGGGCCCTGGAGGGAGGGG - Exonic
1149781131 17:59397481-59397503 CCCTGGGGCCCTTACCAAGGTGG - Exonic
1150150862 17:62808093-62808115 CCCTGTAGCCCCGGCAGGGGAGG - Exonic
1150251241 17:63705885-63705907 CCCTGGGCCCCTGCTCTGGGGGG + Intronic
1150490986 17:65574148-65574170 CCCTGCTCCCCTGGCTGGGGAGG + Intronic
1150802276 17:68291596-68291618 CCCGGCGGCGCTGGCGGGGGCGG - Intronic
1151188617 17:72381790-72381812 CCCTGGAGCCCAGGCTGAGGTGG - Intergenic
1151312825 17:73304699-73304721 CCCTGGGGCTCAGGCCTGGGAGG + Intronic
1151320322 17:73348863-73348885 TCCAGGGGCCCGGGCCTGGGAGG + Intronic
1151348273 17:73516493-73516515 CTCTGGGGCCCTGGCTGGTGAGG - Intronic
1151569655 17:74919890-74919912 CCATGGTGCCCAGGCCGGGGCGG + Exonic
1151582997 17:74990737-74990759 CCCTGGGGCACAGGGCGGGCAGG - Intronic
1151583293 17:74992313-74992335 CCCTGGGGTCCAGGCAGGGGAGG + Intronic
1151668172 17:75557508-75557530 CCCTTGGGCCCTGCCCTGAGGGG - Intronic
1151758750 17:76089054-76089076 CCCTGGGGACCGGTCCTGGGTGG - Intronic
1151930449 17:77228655-77228677 CACTGGAGGCCTGGCCTGGGCGG - Intergenic
1152008099 17:77695019-77695041 CCCAGGGGCCCTGCCAGGGTGGG + Intergenic
1152020732 17:77779057-77779079 CTTTGTGGCCCTGGCCGGGATGG + Intergenic
1152089608 17:78239367-78239389 CGCTGGGGTCCTGGCCAGGAAGG + Intronic
1152242058 17:79165965-79165987 CCCGCGTGCACTGGCCGGGGAGG + Intronic
1152245431 17:79182716-79182738 CCCAGGAGCTCTGGCCGGGGAGG - Intronic
1152333512 17:79686727-79686749 GCCAAGGGTCCTGGCCGGGGAGG + Intergenic
1152375902 17:79918956-79918978 CCCTGCAGGCCTGGCCTGGGGGG - Intergenic
1152523038 17:80871490-80871512 GCCTGGGTCCCTGGCTGAGGTGG + Intronic
1152535366 17:80947722-80947744 CCAGGAGACCCTGGCCGGGGAGG - Intronic
1152586144 17:81190341-81190363 TCCCGGGGCCCTGGGCTGGGTGG - Intronic
1152643386 17:81458237-81458259 CCCTGGGGCCCGCTCCAGGGTGG - Exonic
1152723877 17:81935857-81935879 CTCTGGGGGCCTGGCAGGTGGGG - Intronic
1152888681 17:82867436-82867458 CCCTGGGGATCTGGCCTGGCAGG + Intronic
1152890865 17:82880980-82881002 CCCTGAGGCCCTGCCCTGTGTGG - Intronic
1152927775 17:83095490-83095512 CCCTGGAGCCCTGGAGGGAGAGG - Intergenic
1153400943 18:4683094-4683116 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
1155203399 18:23536821-23536843 CCCTGGTGCCATGGCCAAGGAGG + Exonic
1155653908 18:28175397-28175419 CGCTGGGACCCTGGCCTGGGAGG + Intronic
1156506579 18:37599640-37599662 CCTTGGAGCCCTGGCTGGGGCGG + Intergenic
1157222182 18:45836401-45836423 CCCTGGGGCACCGGCTGGGCAGG + Intronic
1157609683 18:48948799-48948821 GCCTGGGGGGCGGGCCGGGGCGG - Intronic
1157794259 18:50560059-50560081 GGCTGGGGCCGGGGCCGGGGCGG + Exonic
1158445703 18:57518547-57518569 CCCTAGGGCCCTGGTAGAGGAGG + Intergenic
1158629394 18:59099177-59099199 CCCTGGGGCAGGGGCCAGGGAGG - Intergenic
1159601242 18:70430587-70430609 ACCTGGTGCGCTGGCCGGCGCGG - Intergenic
1160266281 18:77342773-77342795 CCCTGGGACCCTGGCAGCGCTGG - Intergenic
1160266305 18:77342867-77342889 CCCTGGGACCCTGGCAGCGCTGG - Intergenic
1160340787 18:78087129-78087151 CCCTGGGGGCCTGGGCAGTGTGG + Intergenic
1160736089 19:663026-663048 CGGTGAGGCCCGGGCCGGGGCGG - Exonic
1160741984 19:690655-690677 ACCTGGTGCGCTGGCCGGTGCGG - Intronic
1160778841 19:868937-868959 GCCTGGGGCCCTGGCGGGAGAGG + Exonic
1160823736 19:1069737-1069759 CCTTGGAGGCCTGGCCTGGGCGG + Intronic
1160869573 19:1271053-1271075 GCCCGCGGCCCTGGGCGGGGGGG + Intronic
1160930250 19:1566962-1566984 GCCTGGGGCCCTGACTGGGGTGG - Intronic
1160957194 19:1699199-1699221 CCCCGGGGCCCTCACCCGGGCGG - Intergenic
1160972540 19:1775922-1775944 CCCTGGGGAGGGGGCCGGGGCGG - Exonic
1160979870 19:1812001-1812023 CTCTGGAGCCCTGTCCAGGGCGG - Intronic
1160996702 19:1885351-1885373 CCCGGGGGCGCGGGCCGGGGTGG - Exonic
1161089792 19:2354032-2354054 CCCTGGAGCCCTGGGAGGGAGGG + Intronic
1161091518 19:2361925-2361947 TCCTGGGGGCCTGGCTGGGTGGG + Intergenic
1161153756 19:2721908-2721930 CCCAGGGGCCTGGGCAGGGGCGG + Intronic
1161252116 19:3285864-3285886 GCCTGGGCCGCTGGGCGGGGAGG - Intronic
1161395750 19:4044087-4044109 CCCCGGGGCCGTGGCAGGAGCGG - Intergenic
1161492860 19:4571814-4571836 CCCTGGGGCCCAGGCATGAGGGG + Intergenic
1161500209 19:4610322-4610344 CCCTGGGGATCAGGCCAGGGAGG + Intergenic
1161594686 19:5144998-5145020 GCCTGGGGCACTGGCGGGTGTGG + Intronic
1162238161 19:9324432-9324454 CGCTGGGGCCTCGGCCCGGGAGG + Intronic
1162303327 19:9856766-9856788 CCCTGGGGTCAGGGCCTGGGAGG - Intronic
1162464062 19:10830263-10830285 CTCTGGGGTCCAGGCCGGGATGG - Exonic
1162524142 19:11197642-11197664 CCCGGGCGCCCCGGCCGCGGTGG + Intronic
1162558034 19:11399868-11399890 CCCTGGGGCCCTGGAGAGGCCGG + Exonic
1162567133 19:11450765-11450787 CTCTGGGGCCCAGGCGGGGCTGG + Exonic
1162612515 19:11767392-11767414 CACTGCGGCCCTGGCCCTGGAGG + Intronic
1162799854 19:13104434-13104456 CCCTGAGGCCCGGGGCGAGGGGG - Intergenic
1163152218 19:15422357-15422379 CTCTGGGGCCCTGGAGGGTGGGG - Exonic
1163153465 19:15428049-15428071 CCCTGGAGCCCCTCCCGGGGGGG - Intronic
1163154156 19:15431084-15431106 CCCTGGGGCCCTGGAGCAGGTGG - Intronic
1163295974 19:16413042-16413064 ACCTGGTGCACTGGCCGGCGCGG - Intronic
1163370292 19:16897588-16897610 CCCTGGGGGCTTGGCAGAGGAGG - Intronic
1163437322 19:17303253-17303275 CCGCGGGGCCCGGGTCGGGGCGG + Exonic
1163442624 19:17329369-17329391 CCCGTGGGTCCTCGCCGGGGTGG - Intronic
1163607139 19:18281573-18281595 CGCTGCGGCCGCGGCCGGGGCGG - Exonic
1163607266 19:18281981-18282003 GCGTGGGGCCCCGGCCGGGCGGG + Intergenic
1164173340 19:22746565-22746587 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
1164548441 19:29188102-29188124 CCCTGGGGCGCTGGGATGGGAGG - Intergenic
1164706252 19:30322559-30322581 TCCTGTGGGCCTGGCCAGGGGGG - Intronic
1164995807 19:32719975-32719997 CGGCGGGGGCCTGGCCGGGGCGG + Intronic
1165330855 19:35140541-35140563 TCCTGGGGTCCTGGCAGGGAGGG - Intronic
1165821088 19:38676592-38676614 CCCAGAGGCCCTGCCCGGGTGGG - Intronic
1166830922 19:45639260-45639282 CCCTGGGACCCAGACCGGCGTGG - Intronic
1167264791 19:48478167-48478189 CTCTGGGGTCCTGGGCGGAGTGG + Intronic
1167307821 19:48719306-48719328 CCCTGGGATCCTGGGAGGGGAGG + Intronic
1167410231 19:49339872-49339894 CCCTGGGGCTCTGGCCGCTGTGG + Intronic
1167507330 19:49877883-49877905 CCCTGGGGCGGTGGACGGGAGGG - Exonic
1167508475 19:49883407-49883429 CCCTGGTGCCCTGTCCAGTGGGG + Intronic
1167594535 19:50419986-50420008 CCCTGGGGGCCAGGGAGGGGTGG + Intronic
1167981895 19:53282587-53282609 ACCTGGGGCCATGGTGGGGGTGG + Intergenic
1167984198 19:53301075-53301097 ACCTGGGGCCATGGTGGGGGTGG - Intergenic
1168062094 19:53898767-53898789 CTCAGGGGGCGTGGCCGGGGGGG + Intronic
1168076406 19:53982777-53982799 CCCCGGGACCCTGGCCAAGGAGG + Exonic
1168267303 19:55229922-55229944 CCCTGGGGCTGTTGCCGGGGAGG + Exonic
1168330640 19:55565865-55565887 CCCTGGTCACCTGGCAGGGGTGG - Intergenic
1168544736 19:57240862-57240884 CCCTGTGGCCCTAGCGGGGCGGG - Intronic
925148384 2:1598434-1598456 CCCTGGGGCCCAGCCCGGTTTGG - Intergenic
925391046 2:3494356-3494378 CACTGGGGCCCTGGCTAAGGAGG + Intergenic
925910710 2:8571919-8571941 CCTGGGGGCCCTGAGCGGGGAGG - Intergenic
925917811 2:8619302-8619324 CCCTGGGCCCCGGGGCGGGGGGG - Intergenic
925979297 2:9164190-9164212 CCCTGGGGCCCAGCCTGAGGAGG + Intergenic
926212370 2:10880428-10880450 ACCTGGGGCCCTGGCAAAGGAGG + Intergenic
926242822 2:11101294-11101316 CCCAGCTGCCCTGGCCTGGGTGG - Intergenic
926718639 2:15942741-15942763 CCCCGGGGCCCCGGCTGGGGCGG - Exonic
927519625 2:23690963-23690985 ACCTGGGGCCTGGCCCGGGGCGG - Intronic
927592012 2:24364654-24364676 GCCTGGGGCACAGGCCTGGGTGG + Intergenic
927640201 2:24841161-24841183 CCCAGGGGCCATGGCCAGCGCGG + Intronic
927811751 2:26184388-26184410 GGCCGGGGCGCTGGCCGGGGTGG + Exonic
927857556 2:26536955-26536977 CCCTCGGTACCTGGCCGGGCTGG - Intronic
927962635 2:27250403-27250425 CACCGGGGCCCTGACCGGGCGGG + Intergenic
928201374 2:29249746-29249768 CCGTGGGGCCCAGGGCGGGGAGG - Intronic
928476201 2:31630058-31630080 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
929584958 2:43107757-43107779 CCCTGAGGCCCGGGCAGGGAAGG - Intergenic
929776274 2:44932920-44932942 CCCTGGGGCTATGTCTGGGGAGG + Intergenic
930156417 2:48111736-48111758 GCCGGGGGCGCCGGCCGGGGAGG - Intergenic
930631321 2:53757770-53757792 ACTTGGGGCCCTGGCAAGGGTGG - Intronic
932321740 2:70827471-70827493 ACCTGGAGCCCTGGCCAGGTGGG + Intergenic
932418422 2:71587235-71587257 CCCTGGGCCCCTGCCAGGAGAGG - Intronic
932559533 2:72855078-72855100 CCTTGGGGCACTGGGGGGGGTGG + Intergenic
934171769 2:89546143-89546165 CCCTGGGCCCCTTGCCGCGTAGG + Intergenic
934282078 2:91620461-91620483 CCCTGGGCCCCTTGCCGCGTAGG + Intergenic
934763547 2:96868865-96868887 CCCAGGGACCCTGGCCTGGGCGG + Intronic
934953134 2:98592929-98592951 CCTGGGGCCCCTGGCAGGGGAGG - Intronic
936073749 2:109388466-109388488 CCTGGGGGGCCTGGCTGGGGAGG - Intronic
936082247 2:109440309-109440331 CCATGGGCCCCTGGCCTCGGCGG - Intronic
936287102 2:111189349-111189371 CCCTGGGGCCTGGGCTGGAGGGG - Intergenic
936387554 2:112043791-112043813 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
937081470 2:119143183-119143205 CCCCGGGGCCTGGGCCAGGGCGG + Intergenic
937208625 2:120252995-120253017 CCCGCGGGCCCCGGGCGGGGTGG + Intronic
937283223 2:120734931-120734953 CCCAGGGGCCCTGGAGAGGGTGG + Intergenic
937297706 2:120819752-120819774 CCCTGGGGGCTTGGCCAGTGGGG - Intronic
937363082 2:121242543-121242565 CCCTGGGGCCCTGGGTGAGGTGG - Intronic
940251899 2:151687586-151687608 ACCTGGGGACCTGGACAGGGTGG - Intronic
940790226 2:158023923-158023945 CCCTTGGGCCCTGGGAGGGAGGG - Intronic
942224959 2:173806993-173807015 CCCTCTGGCCCTGGGCTGGGAGG - Intergenic
944039620 2:195338872-195338894 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
945041486 2:205746698-205746720 ACCTGGGGCTCTGGCGGAGGAGG - Intronic
945108890 2:206344112-206344134 CCCTGGAGCCCTGTCAGGGCAGG + Intergenic
946167225 2:217871739-217871761 TCCTGGGGCCCAGGCCGGATGGG - Intronic
946426524 2:219601324-219601346 CCATGGGGCCCTGGCCAGACAGG + Exonic
947642279 2:231713802-231713824 CCCTGGTGCCCTGGGGGTGGGGG + Intergenic
947724550 2:232388688-232388710 CCCTGGAGCACCGGCCGGGGAGG + Intergenic
947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG + Intronic
948437193 2:237961672-237961694 ACCTGGGGCCCTGACCTGGCAGG + Intergenic
948485291 2:238276932-238276954 CCCGGGGGCTCTGGACGGTGAGG + Intronic
948874077 2:240818190-240818212 CCCTGCGGACCTGCCCGGGGAGG + Intronic
948993285 2:241565186-241565208 GCCTGGGGCGCTGGGTGGGGTGG - Intronic
1168795979 20:610364-610386 CCCTCCGCCCCCGGCCGGGGCGG - Exonic
1168968303 20:1913452-1913474 CCCTCTGGCTCTGGCTGGGGAGG - Intronic
1170874446 20:20237199-20237221 CCTCGGGGACCTGGCAGGGGAGG - Intronic
1171039012 20:21742653-21742675 ACCTGGGAGCCTGGCCGGTGAGG - Intergenic
1171290156 20:23978592-23978614 TGCTGGGTCCCTGGCCGGGCTGG - Intergenic
1172010430 20:31843086-31843108 CCCAGGGGACCTGTCGGGGGAGG + Intergenic
1172083286 20:32358858-32358880 CCGTGGGGCCCGGGGTGGGGGGG + Intronic
1172445367 20:34990518-34990540 CCCTGGGGCTCTGGGAGGGACGG + Intronic
1172622834 20:36331079-36331101 CCCTGGGGGCCTGTGGGGGGAGG + Intronic
1173310784 20:41894537-41894559 TCCTGAGGTCCTGGCCAGGGTGG + Intergenic
1175256835 20:57652756-57652778 CGCGGGGGCCCTGGCCTGGGGGG + Intronic
1175479954 20:59303616-59303638 CCCCGGAGCACTGGCTGGGGAGG + Intronic
1175721073 20:61287678-61287700 CCCTGGGCCTCTTGCTGGGGTGG + Intronic
1175897597 20:62346293-62346315 CCCCATGGCCCTGGCTGGGGAGG - Intronic
1175926099 20:62472336-62472358 TCCTGGGGCCCTGGGCTGTGGGG - Intronic
1175930539 20:62491866-62491888 CCCTGGGAGCCTGGTGGGGGTGG - Intergenic
1175956099 20:62610174-62610196 CCCACGGGCCCTGGCAGAGGAGG + Intergenic
1176089424 20:63312357-63312379 GCCTGGAGCCCTTGCTGGGGTGG - Intronic
1176096908 20:63348556-63348578 CTCTGGGGTCCTGGCAGAGGTGG + Intronic
1176129040 20:63488480-63488502 CCCCAGGGCTCTGGCCGGGCGGG + Intronic
1176151856 20:63595553-63595575 CTCTGTGGCCATGGCCAGGGTGG + Intronic
1176229599 20:64025376-64025398 CCCTGGGCACCGGGCTGGGGAGG + Intronic
1176267679 20:64219174-64219196 CCTTGGGGCCATGGCCAGGAGGG - Intronic
1176412656 21:6457425-6457447 CCCTGTGTCCCAGGCAGGGGCGG - Intergenic
1178587657 21:33883685-33883707 CCCTGGGGCCCATGCTGGGGAGG - Intronic
1178843747 21:36157343-36157365 TGCTGGTGCCCTGGCTGGGGAGG + Intronic
1179259425 21:39745215-39745237 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
1179492098 21:41747266-41747288 CCCTGGTGCACCGGCAGGGGAGG - Intronic
1179555575 21:42173360-42173382 CATTTGGGCCCTGGCCGGTGTGG + Intergenic
1179605804 21:42514356-42514378 CACCGCGGCCCGGGCCGGGGTGG - Exonic
1179688150 21:43065747-43065769 CCCTGTGTCCCAGGCAGGGGCGG - Intronic
1179799346 21:43803652-43803674 CCCAGGGGCCGTGGCCAGAGAGG + Exonic
1179993120 21:44958831-44958853 CCCTGGGGCCAGAGCCGGGAAGG + Intronic
1180081969 21:45491164-45491186 CTCTGGGGTCCTGGCCAGAGCGG + Intronic
1180083542 21:45497491-45497513 GCCTGGGGGCCTGGATGGGGGGG - Intronic
1180109726 21:45642445-45642467 CCCGCGGGTCCTCGCCGGGGTGG - Intergenic
1180195451 21:46191037-46191059 CCAAGGGGTCCTGGCCGGGTTGG - Exonic
1180736958 22:18024438-18024460 CCCCTGGGCCCTGGGCGAGGGGG - Exonic
1180767278 22:18352438-18352460 CGCTGGGACCCTGGCCGGGCTGG + Intergenic
1180779031 22:18509941-18509963 CGCTGGGACCCTGGCCGGGCTGG - Intergenic
1180811752 22:18767261-18767283 CGCTGGGACCCTGGCCGGGCTGG - Intergenic
1180947667 22:19705544-19705566 CCCTGGGAGCCAGGCCTGGGTGG - Intergenic
1181082536 22:20424643-20424665 TCCTGGGGCACCGGCCGAGGGGG + Exonic
1181082842 22:20425747-20425769 CGCTCGGGCCCTGGGCGGCGAGG + Exonic
1181085494 22:20437716-20437738 CCCGGGGGGCCGGGCCGGCGCGG - Exonic
1181121670 22:20671203-20671225 CCCGGGGGCGCGGGCCGGGGTGG - Intergenic
1181197905 22:21201503-21201525 CGCTGGGACCCTGGCCGGGCTGG - Intergenic
1181256855 22:21568179-21568201 CGCTGCGGCCCAGGGCGGGGCGG - Intronic
1181334639 22:22118243-22118265 CCCGGGGGCGCGGGCCGGGATGG - Intergenic
1181401840 22:22654303-22654325 CGCTGGGACCCTGGCCGGGCTGG + Intergenic
1181647715 22:24242803-24242825 CACTGGGACCCTGGCCGGACTGG - Intronic
1181703794 22:24635397-24635419 CGCTGGGACCCTGGCCGGGCTGG + Intergenic
1182283747 22:29232270-29232292 CCAGGGAGCCCTGGCCGGGCTGG + Exonic
1182316101 22:29448481-29448503 CCCTGCCTCCCTGGCCTGGGTGG + Intergenic
1182349085 22:29688594-29688616 CCCTGTGGCACTGGCCGGCGGGG - Intronic
1182518323 22:30871445-30871467 CCCTGGGGGACTGTCCTGGGAGG - Intronic
1182549176 22:31091757-31091779 CCCTGGGACCCTGGCTCGGCTGG + Exonic
1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG + Intergenic
1183483553 22:38077643-38077665 CCCTGGGGTCCTGGGGAGGGTGG - Intergenic
1183684127 22:39351616-39351638 CCCTGGGCCTCTGGCCTGGAAGG + Intronic
1183690952 22:39388296-39388318 CTCTGGAGCCCAGGCCGGGTGGG + Intergenic
1183716734 22:39537619-39537641 CCCTGGGGACCTGGCAGGACTGG - Intergenic
1183719239 22:39552742-39552764 TCCTGGGGACTTGGCAGGGGAGG + Intergenic
1183720170 22:39557864-39557886 CCCGGGGGCCCGGGCCATGGCGG - Intergenic
1184036564 22:41920814-41920836 CCCCAGGGCCCTGGCCGGTGGGG - Intergenic
1184398886 22:44262119-44262141 TCTTGGGGTCCTGGCCAGGGTGG + Intronic
1184479132 22:44736971-44736993 CGGTGGGGCCCTGGCCGGGCGGG - Exonic
1184511237 22:44934524-44934546 ACCTGACGCCCTGGCAGGGGAGG - Intronic
1184561127 22:45263498-45263520 CCCTGGGGCCTGGGCGGTGGGGG + Intergenic
1184642504 22:45879876-45879898 CTCTCTGACCCTGGCCGGGGTGG - Intergenic
1184645671 22:45893349-45893371 ACCTGCGGCCCTGGCCGTCGCGG + Intergenic
1184677809 22:46053211-46053233 CCCCTGGGCCCTGGCATGGGAGG + Intronic
1184679658 22:46063444-46063466 CCCCGGGTGCCTGGCCAGGGAGG + Intronic
1184687767 22:46104233-46104255 CTCTGGGGCCGTGCGCGGGGCGG + Intronic
1184785911 22:46671984-46672006 CCCTGGGGCCCCTGCAGGGAGGG + Intronic
1184894511 22:47399383-47399405 TTCTGGGGCCCTGGACGGAGTGG - Intergenic
1185037533 22:48487640-48487662 GCCTGGGACCCTGGCAGGGAGGG - Intergenic
1185068152 22:48642233-48642255 CCCTGGGGCTCTGGCAGGGCTGG - Intronic
1185080208 22:48705471-48705493 CCCTGGGGTCATCGCAGGGGAGG - Intronic
1185282816 22:49983009-49983031 GCCTGAGGCCCTGCCCGGGTGGG + Intergenic
1185335051 22:50267683-50267705 CACTGGGGGCGTGGCCCGGGGGG - Intronic
1185376152 22:50483481-50483503 CCCTGGAGCCCAGACCGAGGTGG + Exonic
1203228900 22_KI270731v1_random:93332-93354 CGCTGGGACCCTGGCCGGGCTGG + Intergenic
950021770 3:9792617-9792639 CCCCGGGGCACAGCCCGGGGCGG + Exonic
951200997 3:19875437-19875459 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
951481625 3:23167924-23167946 CCCTGGGACTCTGCCTGGGGTGG - Intergenic
952334331 3:32391860-32391882 CCCTGGGCAGCTGCCCGGGGAGG + Exonic
952451791 3:33440156-33440178 CCGGGGGGCCCCGGGCGGGGCGG - Exonic
952520415 3:34151496-34151518 CCCTGGGTCCCTGCCCAGCGGGG - Intergenic
952968536 3:38636480-38636502 GCTCGGGGCCCTGGCCTGGGAGG + Intronic
952970818 3:38649369-38649391 CTCTGGGGCACTGATCGGGGAGG + Intronic
953250916 3:41245178-41245200 CCATGTGGCCCTGGCCTGGCTGG - Intronic
953850596 3:46463359-46463381 CCCTGGAGCCATGGGCTGGGAGG - Intronic
953881608 3:46693901-46693923 CCCTGGGACCCGGCGCGGGGAGG + Intergenic
953910503 3:46890316-46890338 CCTTGGGTCCCTGGCCTGGCTGG + Intronic
954028804 3:47803430-47803452 CCATGGAGCCCGGGCGGGGGCGG + Intronic
954096788 3:48335031-48335053 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
954116069 3:48467489-48467511 CCCTGGAGCCCTATCCAGGGAGG + Exonic
954156665 3:48688820-48688842 CCCTGGACCCCGGGCGGGGGTGG + Intronic
954211207 3:49098471-49098493 CACTGGGGCCCTGGAAGTGGGGG + Exonic
954493513 3:50930655-50930677 GCTTGGGGCCCTGCCCAGGGTGG + Intronic
954539493 3:51384450-51384472 CCCCGAGGGCCTAGCCGGGGAGG + Intergenic
955656440 3:61250233-61250255 GCCTGAGGCCTTGGCCGCGGAGG - Intronic
956692957 3:71894477-71894499 CACTGGGACCCGGGACGGGGAGG - Intergenic
958630186 3:96673986-96674008 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
960838153 3:121928430-121928452 TCCTGGGGACCTGGCTGGGCTGG - Exonic
961377292 3:126475526-126475548 CGCTGGGGCCCTGCTCGGGGCGG + Exonic
961506630 3:127374716-127374738 CCCTGGGGCCTGGGCCAGAGGGG - Intergenic
961651911 3:128421044-128421066 TCCTGGGGCCCAGGATGGGGTGG - Intergenic
961907404 3:130276859-130276881 CCCTGTGGTTCTGGCCTGGGTGG + Intergenic
966048155 3:175578347-175578369 CGCTGGAGCCCTGGAGGGGGAGG + Intronic
966314004 3:178625209-178625231 CCCTGTGGCACTGGCTTGGGTGG - Intronic
966732524 3:183162783-183162805 CCCAGGGCCGCTGGGCGGGGAGG + Exonic
967623295 3:191659978-191660000 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
967896049 3:194396978-194397000 GCCTGGGGCCCTTCCTGGGGTGG - Exonic
968088371 3:195884934-195884956 CCCTGGGGGCCCAGCAGGGGAGG - Exonic
968391446 4:196268-196290 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
968471495 4:784639-784661 ACCTGGGGCCCTGGGCCCGGTGG + Intergenic
968473437 4:792128-792150 GCCTGGGGCCCTGGGCCGAGGGG - Intronic
968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG + Intronic
968512329 4:1001157-1001179 CCCTGGGGCCCCAGGCTGGGGGG + Intronic
968512353 4:1001209-1001231 CCCTGGGCCCCTGGGGTGGGGGG + Intronic
968512833 4:1002977-1002999 CGCTGGGGCTCTGGAGGGGGCGG + Intronic
968534274 4:1113529-1113551 CCTTCGGGCCCTGCGCGGGGAGG - Intronic
968603669 4:1521489-1521511 CCACGGGGCCCCGGCGGGGGCGG - Intergenic
968655848 4:1778164-1778186 CCCTGGGGGCTTGGCCAGGCAGG - Intergenic
968811782 4:2803297-2803319 CCCTGGGGCTCCTGCTGGGGTGG - Intronic
968890113 4:3364366-3364388 CCCAGAGGCCCTGGCAGGGTGGG + Intronic
968908638 4:3465810-3465832 CCCCGGGGCCCTGCCCAGAGAGG - Intronic
968935564 4:3608315-3608337 CACTGTGGCCATGGCAGGGGAGG + Intergenic
969228527 4:5814432-5814454 TTCTGAGGCCCTGGCCAGGGCGG + Intronic
969592438 4:8129756-8129778 CTCTGGGGCCCTGGGAGGGCTGG + Intronic
969612683 4:8236036-8236058 CCCTGGTGCCCAGGCGGGAGGGG + Intronic
969626358 4:8307698-8307720 GGCTGGGGGCCTGGCAGGGGTGG - Intergenic
969633668 4:8352974-8352996 CCCTGGGGCCATGGCTCGAGTGG - Intergenic
969644842 4:8421802-8421824 ACTTGGGGCCCTGGCAAGGGTGG - Intronic
969749833 4:9101585-9101607 CTGTGGGGCCCTGGCCAAGGCGG + Intergenic
972781602 4:42291446-42291468 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
977141409 4:93376804-93376826 CACTGGGGCCTTCCCCGGGGTGG + Intronic
977624824 4:99179090-99179112 TCCTGTGGGCCTGGCAGGGGAGG - Intergenic
978761141 4:112357352-112357374 CCCTGGTTCCCTGGCAGGGCTGG + Intronic
979523812 4:121697039-121697061 GGTTGGGGCCCTGGCGGGGGTGG - Exonic
980443987 4:132883479-132883501 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
983319456 4:166177559-166177581 CTCTGTGGCCCTGGCTGGAGTGG + Intergenic
983667257 4:170195891-170195913 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
984330480 4:178309252-178309274 CCCTTGGGTCCTGGCTGAGGTGG - Intergenic
985472384 5:53938-53960 CCCGGGGGCCGGGGCCGAGGGGG + Intergenic
985511381 5:315997-316019 CGCTGGGCGCCTGGCCGTGGAGG - Intronic
985520987 5:373828-373850 TCCTGGCGCCCTGCCCGGGCGGG + Intronic
985537195 5:472240-472262 CCCTGGGACGCTGGAAGGGGTGG + Intronic
985573071 5:660850-660872 CCCTGGGGCCCGGGATGGAGTGG + Exonic
985760749 5:1747340-1747362 CCCTGAGGCCCTGTCAGGGGCGG - Intergenic
985801442 5:2007526-2007548 CCCTGGGGTCCGAGCCGGCGGGG - Intergenic
985810019 5:2075860-2075882 CCCAGGGACCCTGGCCTGGGAGG + Intergenic
985895733 5:2749198-2749220 TCCTCGGGCCCTTCCCGGGGAGG - Intronic
989688181 5:44112536-44112558 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
991286828 5:64986687-64986709 CCTGGGGGCCCAGTCCGGGGGGG - Intronic
992530208 5:77645649-77645671 CCCTGGGGGCCGGGCGGGGCGGG - Intergenic
995465353 5:112445123-112445145 GCTTGGGGCCCTGGCAAGGGTGG - Intergenic
995662385 5:114499696-114499718 CCCTGGGGGCCTGGCCAGTTAGG + Intergenic
997303429 5:132822841-132822863 CCCTGGGGGCCGCGCCGGGCTGG + Exonic
997472392 5:134124163-134124185 CCCAGGGGCTTTGGCAGGGGTGG + Intronic
997582039 5:135024299-135024321 CACTGGAGCCCTGGCTGGAGGGG - Intergenic
997592681 5:135085607-135085629 CCCAGGGTCTCTGGCTGGGGAGG + Intronic
997613846 5:135232977-135232999 CCTTGGGGCCCTTGGCAGGGCGG + Intronic
998157745 5:139796014-139796036 CGCTGGCGGCCAGGCCGGGGCGG + Intronic
998583756 5:143404798-143404820 GACGCGGGCCCTGGCCGGGGTGG - Intronic
999262032 5:150244397-150244419 CCCTGGGGCCCTCGCCAGGCAGG + Intronic
999300109 5:150485871-150485893 CCCCGGGGCGGGGGCCGGGGCGG - Intronic
1001496038 5:172188264-172188286 CCCTGGGGACCTGACAGGGCGGG - Exonic
1001517531 5:172366274-172366296 CCCTGGGGCCAGGGGAGGGGAGG + Intronic
1001564410 5:172690111-172690133 CCCTGGAGCCCTGGCTGCTGTGG - Exonic
1001758890 5:174191486-174191508 CCCAGGGGCACTGGCCTTGGAGG - Intronic
1002382639 5:178841263-178841285 CCCAGGAGCCCTGGCCAGGGTGG - Intergenic
1002622101 5:180494940-180494962 CCCGGGGGCGCGGCCCGGGGCGG - Intronic
1006169981 6:32087110-32087132 CCCTGGAGCCCCGGCCAGGTAGG + Intronic
1006314030 6:33279811-33279833 CCCACGAGCCCTGGCCGAGGTGG - Exonic
1006802012 6:36765489-36765511 CCCCAGGGCCCTGGGTGGGGAGG + Intronic
1007382990 6:41502710-41502732 CCCTGGGACCCTGGCCCAGTGGG - Intergenic
1007652763 6:43433400-43433422 ACCTGGGGACCTGGGCTGGGTGG - Intronic
1008076033 6:47147089-47147111 GTCTGGGGCCCTGGCAGGTGAGG - Intergenic
1010414822 6:75601632-75601654 CCATGGGGCCCTGGGCGGTGGGG + Intronic
1010893210 6:81338419-81338441 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
1011076566 6:83444931-83444953 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
1011540197 6:88420279-88420301 ACTTGGGGCCCTGGCAAGGGTGG + Intergenic
1013021943 6:106229324-106229346 ACTTGGGGCCCTGGCAAGGGTGG - Intronic
1013372461 6:109482983-109483005 CCCGCGGGGCCTGGGCGGGGAGG - Intronic
1013429681 6:110044263-110044285 TCCTGGTGCCCGGGCAGGGGCGG + Intergenic
1014064693 6:117111007-117111029 CCCTGAGACCCTGGCTGGAGTGG - Intergenic
1014386161 6:120804964-120804986 CACTGGGGCCTTGGAGGGGGTGG + Intergenic
1014932782 6:127353695-127353717 CCATGAGGGCCTGGGCGGGGTGG + Intergenic
1016163491 6:140909304-140909326 CACTGTTGCCCTGGCCAGGGAGG + Intergenic
1017020059 6:150132988-150133010 CCCTGTTGCCCAGGCTGGGGTGG + Intergenic
1017719941 6:157236792-157236814 GCCTGGGCCCCTCGCCAGGGTGG - Intergenic
1018658890 6:166067084-166067106 CCCATGGGCCGTGGCCGTGGTGG - Intergenic
1018959103 6:168434068-168434090 CCCAGGGGCCCTGGACAGGTAGG - Intergenic
1019079193 6:169418023-169418045 CCCTGGGGCCCTGACCAGTGAGG - Intergenic
1019170629 6:170131420-170131442 CTCTGGGACCGTGGCCCGGGTGG - Intergenic
1019264892 7:109415-109437 CACTGGAGCCATGGCCGTGGAGG - Intergenic
1019334193 7:475287-475309 CCCTGGGGTCCCAGCCAGGGCGG - Intergenic
1019414809 7:922311-922333 CCCTGAGGCCCTGGCCTTGAAGG - Intronic
1019416757 7:931186-931208 CCCTGGCTGCCTGGCCAGGGTGG + Intronic
1019524743 7:1475891-1475913 CCCAGGTGCCCTGGCCGGGCAGG - Intronic
1019539651 7:1545937-1545959 CCCTGAGTACCTGGGCGGGGGGG - Exonic
1019554101 7:1620012-1620034 CCCTGAGGCCCGGGCGGGGGCGG - Intergenic
1019727748 7:2612440-2612462 CCCTGGGGCCGTGGGCAAGGAGG - Exonic
1019733874 7:2641123-2641145 GCCTGGGGCACTGGCTGGTGAGG - Intronic
1020013072 7:4816842-4816864 CCCTGTGGCCCTGGCCAGCTTGG - Intronic
1020210470 7:6154548-6154570 GCCTGTCGCCGTGGCCGGGGTGG - Exonic
1020259055 7:6520537-6520559 CGGTGGGGCCCTGCCCTGGGTGG - Intronic
1020323153 7:6955057-6955079 CTGTGGGGCCCTGGCCAAGGTGG - Intergenic
1020596527 7:10213642-10213664 TCCTGGGGCCCGGGCCCAGGTGG + Intergenic
1021719349 7:23490827-23490849 ACCTGGTGCGCTGGCCGGCGCGG - Intergenic
1022101875 7:27173846-27173868 GCCTGCGGCGCTGGCTGGGGTGG + Exonic
1022479207 7:30732132-30732154 ACCAGGAGCCCTGGCAGGGGAGG + Intronic
1022814926 7:33904948-33904970 CCCTGGGGCCCTGGCCTCCCTGG + Exonic
1023875038 7:44282297-44282319 CCCTGGGGCCCAGCCCGTGGTGG - Intronic
1024116339 7:46197375-46197397 CCCTGGGACTCTGGCTGTGGGGG - Intergenic
1024222415 7:47298989-47299011 CCCTGGGTCCCTTGCATGGGCGG - Intronic
1024578361 7:50782581-50782603 CCGCAGGCCCCTGGCCGGGGCGG - Intronic
1024897325 7:54275154-54275176 TCCTGGGGCCCTAGCCAGGGAGG - Intergenic
1025049417 7:55721933-55721955 CCCTGGGGGGCTGGGCGAGGTGG - Intergenic
1025078771 7:55964783-55964805 CGCTGGGGACAGGGCCGGGGCGG - Intronic
1025099491 7:56123219-56123241 TCCTGGGGCCATGGCCAGGGGGG - Intergenic
1025198511 7:56948887-56948909 CCCCTGGGCCCTGGCCATGGAGG - Intergenic
1025673440 7:63628046-63628068 CCCCTGGGCCCTGGCCATGGAGG + Intergenic
1026038371 7:66845890-66845912 TCCTGGGGCCATGGCCATGGGGG + Intergenic
1026562504 7:71462135-71462157 CCCTGGAGCCCTTGCCTGGTGGG + Intronic
1027213032 7:76165699-76165721 TCCTGGGGCCATGGCCACGGGGG - Intergenic
1028588902 7:92476730-92476752 ACTTGGGGCCCTGGCAAGGGTGG + Intronic
1028989537 7:97034620-97034642 CCCAGGGTCCCGGGGCGGGGGGG - Intergenic
1029110557 7:98211378-98211400 CCCTCGGGGCGGGGCCGGGGCGG - Intergenic
1029549909 7:101232272-101232294 ACACGGGGCCGTGGCCGGGGCGG + Exonic
1030337006 7:108338504-108338526 ACTTGGGGCCCTGGCAAGGGTGG - Intronic
1030378272 7:108779858-108779880 ACCTGGAACCCTGGCTGGGGAGG + Intergenic
1031264505 7:119566720-119566742 ACTTGGGGCCCTGGCAAGGGTGG - Intergenic
1031665786 7:124480864-124480886 ACCTGGTGCGCTGGCCGGCGCGG - Intergenic
1032081146 7:128859075-128859097 CCCTGGGAGCCTGGCTTGGGTGG - Exonic
1032121722 7:129161887-129161909 TCCAGGGGCACTGGCCTGGGGGG - Intronic
1032269065 7:130387445-130387467 CCCTGGGGCTCTGGTCTGTGAGG - Intronic
1032798790 7:135301477-135301499 CCCTGGGGCTCTGCCCAGAGGGG - Intergenic
1034433547 7:151052454-151052476 ACCTGGGGCCCAGGCTGAGGTGG - Exonic
1034443642 7:151100936-151100958 CCCTGCAGCCCTGGCCTGGTGGG + Intronic
1034455457 7:151167645-151167667 CCCTGGCTCCCGGGCCGAGGTGG + Intronic
1035201913 7:157273103-157273125 CCCAGGGCCCCAAGCCGGGGAGG - Intergenic
1035266047 7:157690855-157690877 GCCCGGGGGCCGGGCCGGGGCGG - Intronic
1035710494 8:1709837-1709859 CCCTGAGAACCTGGCGGGGGGGG - Intergenic
1035749966 8:1990289-1990311 CCTTGGTGCCCTGTCCGGGTGGG + Intronic
1035749994 8:1990382-1990404 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750053 8:1990580-1990602 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750064 8:1990613-1990635 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750075 8:1990646-1990668 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750086 8:1990679-1990701 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750097 8:1990712-1990734 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750108 8:1990745-1990767 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750119 8:1990778-1990800 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750130 8:1990811-1990833 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750141 8:1990844-1990866 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750152 8:1990877-1990899 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1035750173 8:1990943-1990965 CCTTGGCGCCCTGTCCGGGTAGG + Intronic
1036189998 8:6661606-6661628 CCCAGGGGCCCTGGGAGGGCGGG + Intergenic
1037705116 8:21311412-21311434 CACTGGGACCCAGTCCGGGGTGG + Intergenic
1038351211 8:26777848-26777870 CCCTGGGGGCCTGCCCAGTGTGG + Intronic
1039504718 8:38043678-38043700 CTCTGAGGCCCTGGCATGGGAGG - Intronic
1039885871 8:41653742-41653764 CCCTGGAGGCCGGGCCGGGGTGG + Intronic
1041244933 8:55880418-55880440 CCCTCGGGCCCTCACCGGGAAGG - Intronic
1043428377 8:80171242-80171264 TCCTGGGGCCCTGGAAGGAGCGG - Intronic
1044692879 8:94896196-94896218 CCCCGGGGACCTGGCCGGGTGGG + Intronic
1044750607 8:95411897-95411919 CCCTGAGTCCCTGGCAGGAGGGG + Intergenic
1044820594 8:96153486-96153508 CCCTGGGGCCGGGACCTGGGGGG + Intronic
1045246437 8:100445487-100445509 GCCTGGGGCCTGGGCCAGGGAGG + Intergenic
1045499564 8:102734786-102734808 CCCTGGGGCCCTGGGAGGGAAGG + Intergenic
1045658629 8:104412620-104412642 CCCTGCAACCCTGGCAGGGGTGG - Intronic
1047247319 8:123156959-123156981 CCCTTGGGCACTGGCCGTCGCGG - Intergenic
1049208900 8:141376328-141376350 GCCTGGGGCCCTGCACGGGCAGG - Intergenic
1049243251 8:141549265-141549287 CCCAGGGGCCCAGTCCAGGGAGG - Intergenic
1049255662 8:141612322-141612344 CCCTGGGGCACTTGTCAGGGAGG + Intergenic
1049347104 8:142144928-142144950 GGCTGGGGCCCAGGCAGGGGTGG - Intergenic
1049427704 8:142544719-142544741 CCCTGGGACGCTGGCCGCGCTGG - Exonic
1049428905 8:142550239-142550261 CCCTGTGGCCCTGGGAGGGAAGG - Intergenic
1049622343 8:143604330-143604352 CCCTGGGAACCAGGCAGGGGAGG + Exonic
1049685227 8:143936735-143936757 CCCTCTGGCCCTGGCTGGGCAGG - Intronic
1050555338 9:6784803-6784825 AGCTGGGGCCCAGGCCTGGGGGG + Intronic
1051334287 9:16052642-16052664 GCCCCGGGCCCTGGCTGGGGAGG - Intronic
1052840720 9:33289393-33289415 CCCTGCGGCACTGGCTTGGGTGG + Intergenic
1052857292 9:33415315-33415337 CCCTTGAGCCCTGGGCGAGGGGG + Intergenic
1053142779 9:35691279-35691301 CCCGAGGCCGCTGGCCGGGGCGG + Intergenic
1056143515 9:83707469-83707491 GCCTGGGGCTCGGGCCGGGATGG - Intronic
1056704844 9:88943287-88943309 ATCTGGGGCCCTGGCAAGGGTGG + Intergenic
1056848063 9:90057602-90057624 CCCTGAGGCCCTGGTCTGGAAGG - Intergenic
1056992449 9:91424046-91424068 GGCGGTGGCCCTGGCCGGGGAGG - Intergenic
1057248644 9:93481175-93481197 CCAGGGGGCCCTGCCCAGGGTGG - Intronic
1057276139 9:93676880-93676902 CCCAGGGGCCATGGGCTGGGAGG - Exonic
1057888902 9:98853095-98853117 CCCTAGAGCCCTGGCAGGGCAGG - Intergenic
1057953125 9:99385813-99385835 CCCTGGGGACCTCCCCAGGGAGG + Intergenic
1058140494 9:101352786-101352808 CCCTGGAGCCCTGGCAGGGTAGG - Intergenic
1058687205 9:107489488-107489510 CGCAGGGGCTGTGGCCGGGGCGG + Exonic
1059320628 9:113465677-113465699 CCCTGAGGCCATGGCTGGGCAGG - Intronic
1060048181 9:120357668-120357690 CCTTGGGTCCCTGGGCAGGGTGG + Intergenic
1060153015 9:121300644-121300666 CACTGGGGCTGGGGCCGGGGAGG - Intronic
1060223138 9:121774842-121774864 CCTTGGGGGCCAGGCTGGGGTGG - Intronic
1060481231 9:124017847-124017869 CCCTCGGGCCCGGGCCCCGGTGG + Intronic
1060511807 9:124240079-124240101 CACAGGGGCCCAGGCCGGGAAGG - Intergenic
1060790528 9:126482803-126482825 CCTTGGAGCCCTGGCCGAGGTGG - Intronic
1060821748 9:126665296-126665318 CCCTGGAGCCAGGGCTGGGGCGG + Intronic
1060932164 9:127496077-127496099 CCCAGGGGACCTGGCCAAGGTGG + Exonic
1060963617 9:127699233-127699255 CCCTGGCGCTCTGGCAAGGGTGG + Intronic
1061725818 9:132581382-132581404 CCCTGTGGGCCTGGCGGGAGTGG - Intergenic
1061765201 9:132877542-132877564 AACTGGGGCCCTGGCGGGGACGG + Intronic
1061864326 9:133484795-133484817 CCCTGGGGCCTTCCTCGGGGAGG - Intergenic
1061876480 9:133546596-133546618 CCCTGCAGCCCTGGCCTGGCTGG - Intronic
1061899404 9:133665376-133665398 CCCTGGGGCCATGGTCCTGGGGG - Intronic
1061919727 9:133776213-133776235 CCCAGCGCCCCTGGCCTGGGAGG + Intronic
1061945216 9:133904938-133904960 ACTTGGGGCCCTGGCAGGGAGGG + Intronic
1061961668 9:133991962-133991984 CCCAGGCGCCCTGGCTGGGGCGG - Intronic
1062077610 9:134600333-134600355 CCCAGCTGCCCTGGACGGGGTGG + Intergenic
1062280010 9:135747612-135747634 GCCTGGAGCCCTGGCTGGGGAGG - Intronic
1062346564 9:136117997-136118019 CCGTGGGGACCTGGCCAGGGCGG + Intronic
1062483739 9:136764058-136764080 CCCTGGGTCCCTGGGCAAGGAGG - Intronic
1062524315 9:136972136-136972158 CCCAAGGGCCTTGGCCGGGAAGG + Intergenic
1062537375 9:137026944-137026966 CCCTGGGCACCTGGCCTTGGCGG - Intronic
1062538586 9:137031675-137031697 CTTGGGGGTCCTGGCCGGGGTGG - Exonic
1062554319 9:137107131-137107153 CCCTGGTACCCTGGGAGGGGAGG - Intronic
1062595039 9:137295652-137295674 CCCCGCGGACCGGGCCGGGGCGG + Intergenic
1062599538 9:137313652-137313674 GGCTGGGGCCCTGGCCTGGGTGG + Intronic
1062600333 9:137316338-137316360 CCCTGCGACCCTGGACGGGCAGG - Intronic
1203761467 EBV:14584-14606 CCGGGGGGCCCGGGCCGGGTTGG - Intergenic
1203762396 EBV:17656-17678 CCGGGGGGCCCGGGCCGGGTTGG - Intergenic
1203763325 EBV:20728-20750 CCGGGGGGCCCGGGCCGGGTTGG - Intergenic
1203764254 EBV:23800-23822 CCGGGGGGCCCGGGCCGGGTTGG - Intergenic
1203765183 EBV:26872-26894 CCGGGGGGCCCGGGCCGGGTTGG - Intergenic
1203766112 EBV:29944-29966 CCGGGGGGCCCGGGCCGGGTTGG - Intergenic
1203767041 EBV:33016-33038 CCGGGGGGCCCGGGCCGGGTTGG - Intergenic
1203449020 Un_GL000219v1:92821-92843 CCCTGGGGCCAAGGGCTGGGGGG + Intergenic
1185647019 X:1623189-1623211 CCCAGGGCCCCTGGACGTGGCGG + Exonic
1185877442 X:3712710-3712732 CCCTGGGGCCGCTGCCAGGGAGG + Intronic
1186786024 X:12956434-12956456 GCCTGGTGCCCCGGCAGGGGAGG - Intergenic
1187127753 X:16469922-16469944 CCCTGGTGTCCTGGTCTGGGAGG + Intergenic
1187290121 X:17945311-17945333 CCCTGGGGTACTGGCTGAGGGGG + Intergenic
1187836490 X:23437071-23437093 CCCTGGGGCTGTGGGGGGGGAGG - Intergenic
1187932994 X:24311244-24311266 CCCTGTGGCCCTGGCTGAGGAGG + Intergenic
1187939217 X:24364918-24364940 CCCTGTGGCCCTGGCTGAGGAGG - Intergenic
1189337011 X:40176341-40176363 CCGTGAGGCCGAGGCCGGGGAGG - Intronic
1189410297 X:40764474-40764496 CTCTGGGGGCCTGTCAGGGGTGG + Intergenic
1190385633 X:49879957-49879979 CGCCGGGGCCGGGGCCGGGGCGG - Exonic
1191846573 X:65551617-65551639 CCGTGGGGCCAGGGCCGGGCCGG - Intergenic
1192196771 X:69033934-69033956 CTCTGGGGCCCTGGGCTGAGAGG + Intergenic
1192795267 X:74420818-74420840 CCCTGGCGGCCTGGGAGGGGAGG - Intergenic
1196425133 X:115561793-115561815 CCCTGGGGCTCTGGAGAGGGGGG + Intronic
1198741888 X:139851242-139851264 CCCTTGAGCCATGGCTGGGGTGG - Intronic
1199949766 X:152698671-152698693 CCCTGGGTTCCGGGCAGGGGTGG - Intergenic
1199959908 X:152769790-152769812 CCCTGGGTTCCGGGCAGGGGTGG + Intergenic
1199973767 X:152879475-152879497 CCCTGGGGCCCTGGACGCAGAGG - Intergenic
1200045893 X:153400938-153400960 CCCTGGGTCCCTGGGCGGAGAGG - Intergenic
1200076794 X:153555214-153555236 CCCTGAGGCCATGGGCAGGGGGG - Intronic
1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG + Exonic
1200179211 X:154140379-154140401 AGCTGGGGCCCTGGCCAGGGTGG - Intergenic
1200215120 X:154364886-154364908 GCCTGGGGCCCTGGGCTGGAGGG - Exonic
1200215923 X:154368242-154368264 CCCTGGGACCCTGGGCAGAGAGG - Intronic