ID: 968514037

View in Genome Browser
Species Human (GRCh38)
Location 4:1008993-1009015
Sequence CACCGGCGTCTCCCTCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968514037_968514048 15 Left 968514037 4:1008993-1009015 CCCAGTTGAGGGAGACGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 968514048 4:1009031-1009053 TCTGCACCGGCCTGGGCAGTGGG No data
968514037_968514043 2 Left 968514037 4:1008993-1009015 CCCAGTTGAGGGAGACGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 968514043 4:1009018-1009040 TGCCTGGGTTTTCTCTGCACCGG No data
968514037_968514045 7 Left 968514037 4:1008993-1009015 CCCAGTTGAGGGAGACGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 968514045 4:1009023-1009045 GGGTTTTCTCTGCACCGGCCTGG No data
968514037_968514050 19 Left 968514037 4:1008993-1009015 CCCAGTTGAGGGAGACGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 968514050 4:1009035-1009057 CACCGGCCTGGGCAGTGGGCGGG 0: 1
1: 0
2: 5
3: 46
4: 369
968514037_968514047 14 Left 968514037 4:1008993-1009015 CCCAGTTGAGGGAGACGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 968514047 4:1009030-1009052 CTCTGCACCGGCCTGGGCAGTGG No data
968514037_968514046 8 Left 968514037 4:1008993-1009015 CCCAGTTGAGGGAGACGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 968514046 4:1009024-1009046 GGTTTTCTCTGCACCGGCCTGGG No data
968514037_968514049 18 Left 968514037 4:1008993-1009015 CCCAGTTGAGGGAGACGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 968514049 4:1009034-1009056 GCACCGGCCTGGGCAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968514037 Original CRISPR CACCGGCGTCTCCCTCAACT GGG (reversed) Intergenic
900172092 1:1274108-1274130 CACCGGGGTCGCCCTCAGCCGGG - Intergenic
903213913 1:21832832-21832854 CACTGGAGTCTCCCTCAAGGGGG + Intronic
903363557 1:22792366-22792388 CCCCTCCTTCTCCCTCAACTGGG - Intronic
906151597 1:43591018-43591040 CACCAGTGTCACCCTCACCTGGG + Exonic
914802772 1:150973342-150973364 CACCGGCGTCTCCCTGCCCCTGG - Intronic
915590964 1:156869991-156870013 CAGTGGCATCTCCCTCAACATGG - Intronic
1069689095 10:70337842-70337864 CACCTGCGTCTCCCAGACCTAGG - Intronic
1069988163 10:72298082-72298104 CACCCGCTAATCCCTCAACTGGG + Intergenic
1087102736 11:94380851-94380873 CACTGGCCTCTCCTTCCACTGGG + Intronic
1088175738 11:107051075-107051097 CATCTGCGACTGCCTCAACTTGG - Intergenic
1090797846 11:130150642-130150664 CACTGGAGTGTCCCTAAACTGGG - Intergenic
1095910422 12:47420425-47420447 CACAGGCATTTACCTCAACTGGG + Intergenic
1096798702 12:54095075-54095097 CACCAGCCACTCCCTCTACTTGG - Intergenic
1100169044 12:91952054-91952076 CCCCGGCCTCTCCAGCAACTGGG - Intergenic
1100992695 12:100267433-100267455 CACCGGCGGCTCTCTCGCCTGGG + Exonic
1102508667 12:113399615-113399637 CACCAGCGTCTACCTCAAGATGG - Exonic
1102560336 12:113757505-113757527 CACCTGCCTCTCCCACAAGTTGG - Intergenic
1103894364 12:124263505-124263527 CACCGGCGTCTCCCTGCGCCTGG + Intronic
1108697135 13:52912467-52912489 AACCAACATCTCCCTCAACTGGG - Intergenic
1112218448 13:97460906-97460928 CTCCAGCTTCACCCTCAACTCGG + Intronic
1113337757 13:109393300-109393322 CACCACCCTCTCCCTCTACTGGG + Intergenic
1113831388 13:113297956-113297978 CACCGGCTTCTCCCTGTCCTGGG - Intronic
1117920692 14:60723276-60723298 CACCGGCCTCTCCCTCACCCAGG - Exonic
1119421392 14:74509803-74509825 CACAGGCCTCTGCCTCAACACGG - Exonic
1121252683 14:92511620-92511642 CTCCGCCGTCTCCCTCAACAGGG - Intergenic
1133310976 16:4846936-4846958 CACCGGCGGCTCCCTTCACGGGG + Intronic
1134648354 16:15888787-15888809 CCCTGCCGTCTCACTCAACTGGG - Intergenic
1142189800 16:88712596-88712618 CACTGGCGTCTCCCTCATCCCGG + Intronic
1142627972 17:1204052-1204074 TCCCGGCCTCTCCCTCATCTCGG + Intronic
1143879975 17:10022623-10022645 CTCCGTCGTCTTCCACAACTGGG - Intronic
1147210142 17:38868479-38868501 CAAGGGCGTCCCCCTCGACTAGG - Intergenic
1147405419 17:40208355-40208377 CACTGGCCTCTCCCTCAGCCTGG + Intergenic
1151323037 17:73362944-73362966 CCCCGGCATGTCCCTTAACTTGG + Intronic
1160929534 19:1563657-1563679 CACAGGCGTCTCCCTCCAGCCGG - Intronic
926758745 2:16257746-16257768 CTCCGGCATCTGCCTCATCTAGG - Intergenic
934901541 2:98163672-98163694 CACTGGCGTCCCCCTGACCTTGG - Intronic
1171797716 20:29579269-29579291 CACCAGCCACTCCCTCTACTTGG + Intergenic
1171850531 20:30304892-30304914 CACCAGCCACTCCCTCTACTTGG - Intergenic
1183839439 22:40485877-40485899 CTAAGGCATCTCCCTCAACTGGG + Intronic
1185074251 22:48674695-48674717 CCACGGCGTCTCCCTGAACGAGG - Intronic
1185336333 22:50272266-50272288 CACCGGCGGCTCCCTCCAGGGGG - Intergenic
963714511 3:148787118-148787140 CTCTGCCGTCTCCCTCAGCTTGG - Intergenic
968514037 4:1008993-1009015 CACCGGCGTCTCCCTCAACTGGG - Intergenic
969375402 4:6760379-6760401 CACTGACGTGTCACTCAACTGGG + Intergenic
969927005 4:10594359-10594381 CAGGGGCCTCTCCCTCCACTTGG + Intronic
970476479 4:16428945-16428967 AACAGCCCTCTCCCTCAACTGGG - Intergenic
981937043 4:150249663-150249685 CACCGGGGTCTCCGTCATCATGG + Exonic
985833313 5:2251804-2251826 CACTGGCGTCTCCCTTACCCTGG - Intergenic
991115050 5:62945598-62945620 CACCCGAGTCTCCCTCAAACAGG + Intergenic
995269280 5:110203058-110203080 CACCGCCATGTCCCTGAACTTGG - Intergenic
997583026 5:135028958-135028980 CACCGGCTCCTCGCTCAACTCGG - Exonic
998208237 5:140174915-140174937 CACAGGCGTCCCCCTCAGATTGG - Exonic
1002426768 5:179181263-179181285 CCCAGGCGTCACCATCAACTAGG + Intronic
1011043996 6:83061872-83061894 CACCCGCATCTCTCTGAACTAGG + Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019705993 7:2497669-2497691 CACGAGCGTCTGACTCAACTGGG - Intergenic
1028543550 7:91972383-91972405 AACCAGCTTCTCCATCAACTTGG - Intronic
1037737526 8:21579550-21579572 CCCCTTCGTCTCCCTCAACATGG + Intergenic
1037890912 8:22623308-22623330 CCCCAGCGTCTCCTTCCACTCGG - Intronic
1040581149 8:48699653-48699675 CACCTGCACCTCCCTCACCTGGG + Intergenic
1048727277 8:137400740-137400762 CAACTGCATCTCCCTCAACTGGG + Intergenic
1053788312 9:41668183-41668205 CACCAGCCACTCCCTCTACTTGG - Intergenic
1054156829 9:61646585-61646607 CACCAGCCACTCCCTCTACTTGG + Intergenic
1054176594 9:61879522-61879544 CACCAGCCACTCCCTCTACTTGG - Intergenic
1054660941 9:67701284-67701306 CACCAGCCACTCCCTCTACTTGG + Intergenic
1056570984 9:87814521-87814543 CACCAGCCTCTCACACAACTGGG + Intergenic
1195246729 X:103001845-103001867 CACCTGCTTCTCCCTCTGCTTGG - Intergenic