ID: 968520265

View in Genome Browser
Species Human (GRCh38)
Location 4:1031922-1031944
Sequence CACTCTCCACAGAGGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968520254_968520265 28 Left 968520254 4:1031871-1031893 CCTCTGGTGATTTGGCCAGGGCC No data
Right 968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG No data
968520260_968520265 7 Left 968520260 4:1031892-1031914 CCACAGCCGACAAAAGGGGTGGT No data
Right 968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG No data
968520255_968520265 13 Left 968520255 4:1031886-1031908 CCAGGGCCACAGCCGACAAAAGG No data
Right 968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG No data
968520261_968520265 1 Left 968520261 4:1031898-1031920 CCGACAAAAGGGGTGGTGAAGCT No data
Right 968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968520265 Original CRISPR CACTCTCCACAGAGGGACCC AGG Intergenic
No off target data available for this crispr