ID: 968521418

View in Genome Browser
Species Human (GRCh38)
Location 4:1036275-1036297
Sequence GCGGCTTGTGCGCCCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968521415_968521418 -3 Left 968521415 4:1036255-1036277 CCTGCAGGGTGCGTGTGGCCGCG No data
Right 968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG No data
968521409_968521418 22 Left 968521409 4:1036230-1036252 CCATGGGGGATTGGCCTGGCCTA No data
Right 968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG No data
968521413_968521418 3 Left 968521413 4:1036249-1036271 CCTAGACCTGCAGGGTGCGTGTG No data
Right 968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG No data
968521412_968521418 8 Left 968521412 4:1036244-1036266 CCTGGCCTAGACCTGCAGGGTGC No data
Right 968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG No data
968521408_968521418 23 Left 968521408 4:1036229-1036251 CCCATGGGGGATTGGCCTGGCCT No data
Right 968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968521418 Original CRISPR GCGGCTTGTGCGCCCAGTGC TGG Intergenic
No off target data available for this crispr