ID: 968521998

View in Genome Browser
Species Human (GRCh38)
Location 4:1038243-1038265
Sequence GGCACTGCCTACTTTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968521979_968521998 26 Left 968521979 4:1038194-1038216 CCAGGAAAGCCCCTGCCCACCCC No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521984_968521998 16 Left 968521984 4:1038204-1038226 CCCTGCCCACCCCCGGGCTGGTC No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521987_968521998 10 Left 968521987 4:1038210-1038232 CCACCCCCGGGCTGGTCCTACAA No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521986_968521998 11 Left 968521986 4:1038209-1038231 CCCACCCCCGGGCTGGTCCTACA No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521985_968521998 15 Left 968521985 4:1038205-1038227 CCTGCCCACCCCCGGGCTGGTCC No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521988_968521998 7 Left 968521988 4:1038213-1038235 CCCCCGGGCTGGTCCTACAACCC No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521989_968521998 6 Left 968521989 4:1038214-1038236 CCCCGGGCTGGTCCTACAACCCA No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521983_968521998 17 Left 968521983 4:1038203-1038225 CCCCTGCCCACCCCCGGGCTGGT No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521993_968521998 -6 Left 968521993 4:1038226-1038248 CCTACAACCCATCCACAGGCACT No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521990_968521998 5 Left 968521990 4:1038215-1038237 CCCGGGCTGGTCCTACAACCCAT No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data
968521991_968521998 4 Left 968521991 4:1038216-1038238 CCGGGCTGGTCCTACAACCCATC No data
Right 968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968521998 Original CRISPR GGCACTGCCTACTTTAAAGG AGG Intergenic
No off target data available for this crispr