ID: 968523499

View in Genome Browser
Species Human (GRCh38)
Location 4:1045122-1045144
Sequence CCCTGGCCTGCACTGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968523499_968523514 26 Left 968523499 4:1045122-1045144 CCTCCCCACAGTGCAGGCCAGGG No data
Right 968523514 4:1045171-1045193 AGGCTTTGTCTGATTTCCAATGG No data
968523499_968523508 6 Left 968523499 4:1045122-1045144 CCTCCCCACAGTGCAGGCCAGGG No data
Right 968523508 4:1045151-1045173 TCTGCTTCCCCCAAGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968523499 Original CRISPR CCCTGGCCTGCACTGTGGGG AGG (reversed) Intergenic
No off target data available for this crispr