ID: 968526944

View in Genome Browser
Species Human (GRCh38)
Location 4:1064223-1064245
Sequence ATACATATGACAAAGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968526940_968526944 -4 Left 968526940 4:1064204-1064226 CCCATATATATGTACATAAATAC 0: 1
1: 2
2: 20
3: 212
4: 1884
Right 968526944 4:1064223-1064245 ATACATATGACAAAGCAGGTGGG No data
968526941_968526944 -5 Left 968526941 4:1064205-1064227 CCATATATATGTACATAAATACA 0: 2
1: 3
2: 31
3: 360
4: 3231
Right 968526944 4:1064223-1064245 ATACATATGACAAAGCAGGTGGG No data
968526939_968526944 25 Left 968526939 4:1064175-1064197 CCATATTGTTAGATTTATAACAC 0: 1
1: 0
2: 1
3: 21
4: 239
Right 968526944 4:1064223-1064245 ATACATATGACAAAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968526944 Original CRISPR ATACATATGACAAAGCAGGT GGG Intronic
No off target data available for this crispr