ID: 968527881

View in Genome Browser
Species Human (GRCh38)
Location 4:1073466-1073488
Sequence CCTCCCATGCACCGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968527876_968527881 -3 Left 968527876 4:1073446-1073468 CCATTTTGGTGAATATGTAGCCT 0: 1
1: 0
2: 0
3: 16
4: 169
Right 968527881 4:1073466-1073488 CCTCCCATGCACCGGGTGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 98
968527874_968527881 20 Left 968527874 4:1073423-1073445 CCTGGAAGGACTCAAAAGCTGCA 0: 1
1: 0
2: 0
3: 13
4: 218
Right 968527881 4:1073466-1073488 CCTCCCATGCACCGGGTGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 98
968527873_968527881 21 Left 968527873 4:1073422-1073444 CCCTGGAAGGACTCAAAAGCTGC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 968527881 4:1073466-1073488 CCTCCCATGCACCGGGTGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968527881 Original CRISPR CCTCCCATGCACCGGGTGGA AGG Intronic
911061414 1:93751270-93751292 CCTCCCATGCAGTGGGTGACAGG + Intronic
915230364 1:154441429-154441451 CCACACATGCATAGGGTGGAGGG - Intronic
917943587 1:179947439-179947461 CCTACCCTGCCCAGGGTGGAAGG + Intergenic
1063971041 10:11381401-11381423 GCTCCCATGCATCCGGTGGGAGG + Intergenic
1067055280 10:43046319-43046341 CCTTCCTTGGACCGGGTGCAGGG + Intergenic
1067158226 10:43800537-43800559 CCTGCCATGCACCGAGAGGGAGG - Intergenic
1067771884 10:49132292-49132314 CCTGCCATTCCCCGGGAGGAGGG - Exonic
1067797514 10:49331605-49331627 CTTCCCTTCCACCAGGTGGATGG + Intergenic
1067797517 10:49331609-49331631 CCACCCATCCACCTGGTGGAAGG - Intergenic
1069628201 10:69881047-69881069 GCTCCCAGCCACGGGGTGGAGGG - Intronic
1070167643 10:73910891-73910913 CCTCCCATGCACCTGGCCGGGGG - Exonic
1070310460 10:75269817-75269839 CCTCCCTTGCAGCTGGGGGAGGG - Intergenic
1074011056 10:109480546-109480568 CATGGCAGGCACCGGGTGGAAGG + Intergenic
1074545428 10:114398753-114398775 CTGCCCATGCTCTGGGTGGATGG - Intronic
1075924202 10:126236894-126236916 CTGCCCATGCCCAGGGTGGATGG - Intronic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077421340 11:2451539-2451561 GGTCCCAGGCACTGGGTGGATGG + Intronic
1078190903 11:9091747-9091769 CCTCCCCGGCCTCGGGTGGAGGG + Intronic
1079403564 11:20125984-20126006 CCTCTAATGCACCTTGTGGAGGG - Intergenic
1083749360 11:64752914-64752936 CCTCGCATCCACCTGGAGGAGGG - Intronic
1084072483 11:66745235-66745257 CCTTCCATGCACCGGGTGCTGGG + Intronic
1085751205 11:79162743-79162765 CCTCCCTGGCACCAGGTGGCAGG + Intronic
1091667622 12:2430744-2430766 CCTCCTATACACCTGGGGGAAGG - Intronic
1092169147 12:6362498-6362520 CCTCCCCTGCCTAGGGTGGAAGG + Intronic
1092192827 12:6533258-6533280 CCTCCCATGCACCTGCTGATGGG + Intergenic
1092522559 12:9289560-9289582 CCTCCCAAGTACCTGGTGGCTGG + Intergenic
1092544724 12:9442337-9442359 CCTCCCAAGTACCTGGTGGCTGG - Intergenic
1092926160 12:13274440-13274462 CCTGGAATGCACCGGGAGGATGG + Intergenic
1094508224 12:31079735-31079757 CCTCCCAAGTACCTGGTGGCTGG + Intronic
1094818546 12:34208201-34208223 CCTCCCAGGTACCAGGTGGTGGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1103731837 12:123033019-123033041 CCTCCCCTGACCTGGGTGGAAGG + Intronic
1112372808 13:98809798-98809820 CCTCCCAAGCCCAGGATGGACGG + Intronic
1116100486 14:40427431-40427453 CCTCCCATGCGCCAGGTAGCAGG + Intergenic
1120247035 14:82019640-82019662 CCTCCCATGCACAAGGTAGCTGG + Intergenic
1121374530 14:93395553-93395575 CCTCCCCATCACCTGGTGGATGG - Intronic
1121507517 14:94487877-94487899 CCTTTCATCCACCTGGTGGATGG + Intronic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129892655 15:79081760-79081782 CCTCCCTGGCACTGGGAGGATGG - Intronic
1131119821 15:89815026-89815048 CATCCCAGGCCCCGGGGGGAAGG - Intronic
1132714483 16:1283980-1284002 TCTCCCATGCCCAGGGTGTAGGG + Intergenic
1133299781 16:4775293-4775315 CCTGCCATGCACTGGATGCAGGG + Intergenic
1134003710 16:10803383-10803405 CCTCCCATCTACCAGGTGGAGGG + Intronic
1142247942 16:88978377-88978399 CCTCCCCTGCCCTGGGTGGTCGG + Intergenic
1150281855 17:63933533-63933555 CCTCCCATGCCATGGTTGGAAGG + Intergenic
1152762487 17:82116341-82116363 CCTGCCATGCACCCTGTGGGTGG - Intronic
1158436511 18:57438294-57438316 CTTCCCATGGATCGGGTGGAGGG + Intronic
1160789523 19:917173-917195 CCGACCTTGCACCGGGAGGAGGG + Intergenic
1161056853 19:2195050-2195072 CCTCCCATGGACCCTGGGGATGG + Intronic
1161138805 19:2636204-2636226 CCTCCCACTCAGGGGGTGGATGG + Intronic
1161250606 19:3278076-3278098 GCTCCCATGCAAGGCGTGGATGG - Exonic
1163226410 19:15964457-15964479 GCTCCCATGGCCTGGGTGGAGGG + Intergenic
1163753171 19:19090767-19090789 CCTCCCCTGTACCTGGAGGAGGG - Intronic
1163850037 19:19657477-19657499 CCTGCCATGCTCAGGTTGGAGGG - Intronic
1166312155 19:41969121-41969143 CCTCCCTGGCCCCTGGTGGATGG - Intronic
926198676 2:10778346-10778368 CCGTGCATGCACCGGGTGGCTGG + Intronic
928095110 2:28399736-28399758 TCTCCCATGCTCAGGTTGGAGGG - Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932441680 2:71741258-71741280 CCCCCAAAGCACCGGGGGGAGGG + Intergenic
940008293 2:149029851-149029873 CTTCCCATCCACCGGCTGGCTGG + Intergenic
948921811 2:241069407-241069429 CCTCCCATGCACTGGGGAGGGGG - Intronic
1169059560 20:2652124-2652146 CCTCCCCGGCGCCGGGTGGGCGG - Exonic
1170408351 20:16063232-16063254 CCTCCCCTGCTCCATGTGGAGGG - Intergenic
1170802138 20:19599378-19599400 CCTCCCGCGCACCTGGCGGACGG + Intronic
1171183473 20:23108311-23108333 CATCCCATGCTCCAGCTGGAGGG + Intergenic
1173092164 20:39983391-39983413 CCTCTCATGTAAAGGGTGGAGGG + Intergenic
1175252156 20:57616294-57616316 CCGCCCAAGCACCAGGTGGCAGG + Exonic
1175605367 20:60308240-60308262 CCTTCCACGCACCAGGTAGAGGG + Intergenic
1175816998 20:61888367-61888389 CCTCCCTTGCAGCGGCTGGACGG - Intronic
1180050770 21:45330097-45330119 CCTCCCACCCACCGGGTTGCTGG + Intergenic
1180182798 21:46125338-46125360 GGGCCCATGCACCGGGTGGAGGG + Intronic
1182135400 22:27897749-27897771 CCTCTCATTCTCAGGGTGGAGGG + Intronic
1183257311 22:36770834-36770856 CCTCCCCTGCACACTGTGGAAGG - Intronic
1183704725 22:39469578-39469600 GCTCTCATGCACCAGGTGGCAGG - Intronic
1185071677 22:48659999-48660021 CCTCCCCTGCTCCGGGTGTGGGG + Intronic
1185181836 22:49368195-49368217 CTTCCCACACACCGGGTGTACGG + Intergenic
949779690 3:7672069-7672091 CCTCCCCTGCCCCGGGGGGAGGG + Intronic
950500788 3:13362225-13362247 CCACCCCTGCACGCGGTGGAAGG + Intronic
950992847 3:17459344-17459366 CCTCGCATGCACAGGGTTCATGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
968527881 4:1073466-1073488 CCTCCCATGCACCGGGTGGAAGG + Intronic
968896912 4:3409663-3409685 CCTCCCTTGCTGCCGGTGGAGGG - Intronic
969273454 4:6118592-6118614 CTGCCCATGCACTGGGTGCAAGG + Intronic
969668023 4:8573439-8573461 CCTCCCATGTCCTAGGTGGAGGG + Intronic
974618521 4:64323515-64323537 CCTCCAAAGCACCGGGAGAATGG + Intronic
989646547 5:43639611-43639633 CCTCCCATATGCAGGGTGGATGG - Intronic
990739734 5:58900188-58900210 TCTCCCATGCAGCTGGAGGATGG - Intergenic
990954797 5:61331535-61331557 GCTCCCCTGGACCGGCTGGAGGG + Intergenic
1001413122 5:171524690-171524712 CCTGCCATGCAACGGGAGGAGGG + Intergenic
1003913534 6:10764488-10764510 CCTCCCATGCACTGAGGGAATGG + Exonic
1006117950 6:31785234-31785256 CCTCCCACGCACAGGGTCCATGG + Exonic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1019406995 7:889128-889150 CCTCCCATGCACTCCCTGGACGG - Intronic
1024398441 7:48895020-48895042 CCACCCATGCTCTGGGAGGATGG + Intergenic
1027171931 7:75878884-75878906 CCTCCCACGCACGGGGGGGGGGG + Intronic
1031347760 7:120690564-120690586 CTTCCCATTCACCTGGTGAAGGG + Intronic
1037192226 8:16140715-16140737 CCTCTCATGCACGGACTGGAGGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1043028921 8:75106633-75106655 CTTCCCAGGCACCTGGGGGAAGG + Intergenic
1047900537 8:129416817-129416839 CCTCCTATGCACTGGGGAGATGG + Intergenic
1049291732 8:141806912-141806934 CCTCCCAGGCCCCAGCTGGATGG - Intergenic
1058676916 9:107407912-107407934 CTTCCATTGCACCGGGTGGTTGG + Intergenic
1061481927 9:130901697-130901719 CCTACCAAGCACCGGCTGAATGG - Intergenic
1062176455 9:135165922-135165944 GCTCCTAAGCACCAGGTGGAAGG - Intergenic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1194809671 X:98375077-98375099 CCACCTGTGCACTGGGTGGATGG - Intergenic
1196823539 X:119722926-119722948 ACTCCCATACGCCGGGTGGTGGG + Intergenic
1201147461 Y:11072889-11072911 CCACCCATGCTCCCGGAGGAGGG + Intergenic