ID: 968528732

View in Genome Browser
Species Human (GRCh38)
Location 4:1078671-1078693
Sequence CTGTTGGTGTCAAGGAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968528732_968528740 10 Left 968528732 4:1078671-1078693 CCCTTTCTCCTTGACACCAACAG 0: 1
1: 0
2: 2
3: 33
4: 344
Right 968528740 4:1078704-1078726 GGACCAGCACGGGACCAACATGG 0: 1
1: 0
2: 2
3: 6
4: 103
968528732_968528743 22 Left 968528732 4:1078671-1078693 CCCTTTCTCCTTGACACCAACAG 0: 1
1: 0
2: 2
3: 33
4: 344
Right 968528743 4:1078716-1078738 GACCAACATGGGACCAGCAGAGG 0: 1
1: 0
2: 3
3: 25
4: 138
968528732_968528739 0 Left 968528732 4:1078671-1078693 CCCTTTCTCCTTGACACCAACAG 0: 1
1: 0
2: 2
3: 33
4: 344
Right 968528739 4:1078694-1078716 AGACTGACAGGGACCAGCACGGG 0: 1
1: 0
2: 1
3: 19
4: 229
968528732_968528741 11 Left 968528732 4:1078671-1078693 CCCTTTCTCCTTGACACCAACAG 0: 1
1: 0
2: 2
3: 33
4: 344
Right 968528741 4:1078705-1078727 GACCAGCACGGGACCAACATGGG 0: 1
1: 0
2: 4
3: 7
4: 98
968528732_968528738 -1 Left 968528732 4:1078671-1078693 CCCTTTCTCCTTGACACCAACAG 0: 1
1: 0
2: 2
3: 33
4: 344
Right 968528738 4:1078693-1078715 GAGACTGACAGGGACCAGCACGG 0: 1
1: 0
2: 4
3: 25
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968528732 Original CRISPR CTGTTGGTGTCAAGGAGAAA GGG (reversed) Intronic
901003922 1:6162591-6162613 GTGGTGGTGTCAGGGGGAAAGGG - Intronic
901805712 1:11737091-11737113 CTGTTGGTGTCTGGGACTAAAGG + Intronic
902552244 1:17225983-17226005 CTGTTGGTGGGGTGGAGAAAGGG + Intronic
903129766 1:21271205-21271227 CTGTCGGAGGCCAGGAGAAAGGG + Intronic
903920885 1:26799853-26799875 CAGCTGTTGGCAAGGAGAAAGGG - Intergenic
905581336 1:39084468-39084490 CTGTGGGTGTGAGGGAGGAATGG + Intronic
906340225 1:44973091-44973113 CTGTTGGTGGCAATGTAAAATGG + Intronic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
907904771 1:58774443-58774465 GGGTTGGTGTTAAGGGGAAATGG - Intergenic
908426584 1:64013699-64013721 CTGTTGATGTCATGGTCAAAGGG - Intronic
909046771 1:70720283-70720305 CAGTTGGTCTCAAGGGAAAAGGG - Intergenic
909312405 1:74169508-74169530 CTGTTGGTGGCAACGTAAAATGG - Intronic
909516417 1:76512245-76512267 GTGTGGGTTTGAAGGAGAAATGG - Intronic
909750452 1:79153729-79153751 CTTTTGGTAACAAGAAGAAATGG + Intergenic
911421522 1:97647170-97647192 CTGTTGACTTTAAGGAGAAATGG + Intronic
913547249 1:119881276-119881298 CTGTCGGTGCCATGAAGAAATGG - Intergenic
915078884 1:153337736-153337758 TTCTTGGTGAGAAGGAGAAAAGG - Intronic
915722618 1:157995450-157995472 CTGTTGGTGTCGGGGAGGAAGGG + Intronic
916071725 1:161174082-161174104 CTGTAGGTGGCACGGAGAAAAGG + Intronic
917594230 1:176512293-176512315 CTGTTGGTGGGAATGTGAAATGG + Intronic
918211915 1:182358678-182358700 GTGATGGAGTCAAGGAAAAAAGG + Intergenic
920871203 1:209796616-209796638 GTGTTTGTGTCTATGAGAAAGGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921838504 1:219802921-219802943 CTCTTGCTTTCAAGGATAAAAGG - Intronic
922469343 1:225866308-225866330 CTGTGGGCGGCAAAGAGAAAGGG + Intronic
923922880 1:238588707-238588729 GTGTTGGTAACAAGGAGAAAAGG - Intergenic
924155563 1:241172729-241172751 CTGTTTCTGTAAAGTAGAAAAGG + Intronic
924309738 1:242727971-242727993 CTGGGGGTGTCAAGGAGAGTGGG - Intergenic
924540536 1:244976682-244976704 CTGTTGGTGGCAATGAGAAATGG + Intronic
924878239 1:248128962-248128984 CTGCTGGTGCTAAGGAGAATGGG + Intergenic
1063498243 10:6529656-6529678 ATGTTGGTGTCATGGAGTATAGG + Intronic
1063654264 10:7971743-7971765 CTGCTGGTGTCCTGGAAAAATGG + Intronic
1063898082 10:10703022-10703044 CTGATGCTGTCAAGGAGAGTGGG - Intergenic
1063905685 10:10777944-10777966 CTGAAGTTGTCAAGTAGAAAAGG - Intergenic
1064510755 10:16088204-16088226 CTGTTGGTGGGAAGGTAAAAAGG + Intergenic
1065226616 10:23549875-23549897 CTTTTGGGGTCACTGAGAAATGG - Intergenic
1065438380 10:25724661-25724683 TTGTTGGTGTCAGGGAAAAGAGG - Intergenic
1065834517 10:29644766-29644788 CTCGTGCTGTCAAGGAGACATGG - Intronic
1067961547 10:50857736-50857758 TTGTTGTTGGCAAGGAGAAGTGG + Intronic
1068502877 10:57862449-57862471 CTGTTGGTGTGAATGTAAAATGG - Intergenic
1069302583 10:66927027-66927049 CTGTAGGTGTGAAGGCAAAATGG + Exonic
1069471970 10:68701506-68701528 CTGTTGGCGTCCAGGAGCAATGG - Intergenic
1070834401 10:79438809-79438831 CTGTTGGAACCAAGGAGGAAAGG - Intronic
1071225276 10:83521560-83521582 CAGTTGCTGTCACAGAGAAAAGG - Intergenic
1072156960 10:92732482-92732504 CTGTAGGTATGAAGAAGAAAGGG - Intergenic
1073930822 10:108573781-108573803 CTGTTGGTGGCAATGTAAAATGG + Intergenic
1074753194 10:116606493-116606515 CTGATGGGGTCAGGGAGGAAAGG - Intronic
1074782405 10:116811474-116811496 CCTTTGGTGTGAGGGAGAAAGGG - Intergenic
1075213861 10:120515106-120515128 CTGTTCGTTTCAAGTAGATAAGG - Intronic
1075861367 10:125679503-125679525 CTGTTAGTTTCAGGGAGAGAAGG + Intronic
1075914330 10:126154437-126154459 GTGTTGGTGTCATGCAGAGAAGG + Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077804225 11:5573872-5573894 CTGTTGGTGGGAAGGTAAAATGG + Intronic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1078399413 11:11010832-11010854 TTCTTGGTGTCAAGGAGAAAAGG + Intergenic
1078831116 11:14978056-14978078 CTTTTGTTGACAAGGAGACAAGG - Intronic
1083475338 11:62911634-62911656 CTGTACGTCTCTAGGAGAAAGGG + Intronic
1083562419 11:63683230-63683252 CTGGTGGTTTAAAGGAGACAGGG - Intronic
1084454880 11:69262715-69262737 CTGTTGGTGGGAAGGCAAAATGG + Intergenic
1086847177 11:91765470-91765492 CTGTTACTGTATAGGAGAAAAGG - Intergenic
1088010373 11:104993905-104993927 CTGTTGGTGACAATGTCAAATGG - Intergenic
1088588294 11:111379197-111379219 CTGTCGGCTTCAAAGAGAAAAGG - Exonic
1090307145 11:125701210-125701232 CTGTTGGTGGAAATGGGAAATGG + Intergenic
1090429092 11:126630959-126630981 CAGGACGTGTCAAGGAGAAAGGG - Intronic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1091822073 12:3482992-3483014 TCGCTGGTGTCAAGGAGACAAGG + Intronic
1091846818 12:3662601-3662623 GTCTTGGTTTCAAGGATAAAAGG + Intronic
1091958138 12:4665672-4665694 CTGTTGGTGGCAATGTAAAATGG - Intronic
1092509267 12:9136627-9136649 CTGTTGGTGTTAATGCAAAATGG - Intergenic
1093286559 12:17270784-17270806 CTGGTGGTGTGGAAGAGAAATGG - Intergenic
1093428618 12:19057752-19057774 CTGATGGTGACAAGGAAAGAAGG - Intergenic
1093433821 12:19113050-19113072 CTGTTGCTGTAAAGGAACAACGG + Intergenic
1093905808 12:24690768-24690790 CTGATAGTTTTAAGGAGAAAGGG - Intergenic
1095909255 12:47409180-47409202 CTGTTGGTGTCGGGGTGGAAGGG + Intergenic
1096534644 12:52263564-52263586 CTGATGGTGTCCAGGAGTCAAGG - Intronic
1097389379 12:58990683-58990705 ACGTTGGTGTCAATGAGACATGG + Intergenic
1097501137 12:60404099-60404121 GTATTGGTGTCAAGGACACAAGG + Intergenic
1097781976 12:63717357-63717379 CTGTTGCTGTCCATGAGAACAGG - Intergenic
1097808172 12:63988403-63988425 CTGATGGTGTTAAGAAAAAAGGG + Intronic
1098066754 12:66626813-66626835 CTGCAGGTGTCAAGAAGAAAGGG + Intronic
1099133814 12:78867118-78867140 CTTTTGGTTACAAGGACAAAGGG + Intronic
1099334923 12:81343414-81343436 CTGGTAGTGTTAAGGAGAAGAGG + Intronic
1099738639 12:86601833-86601855 CTGTGGGCGACAAGGAGAGAAGG + Intronic
1099777896 12:87157882-87157904 CTCCTAATGTCAAGGAGAAAAGG + Intergenic
1099829435 12:87821784-87821806 CTGTGGGTGTATGGGAGAAATGG + Intergenic
1101196787 12:102391793-102391815 CTGTTGGAGGCAAAGAGAAAAGG + Intergenic
1101884478 12:108649950-108649972 CTGCAGGTTTCCAGGAGAAATGG - Intronic
1104277708 12:127344920-127344942 CTGGAGGTGTCAAGGAGATGGGG - Intergenic
1104417613 12:128608234-128608256 CTGTTTGTTGCAAGGATAAATGG - Intronic
1106557343 13:30821536-30821558 TGGTTGGAGCCAAGGAGAAAAGG + Intergenic
1106925405 13:34607895-34607917 CTGATGGTGGGAAGGAGAGAAGG - Intergenic
1107382022 13:39867060-39867082 CTGTAGGTGTGAAAGAGAAGAGG - Intergenic
1108427795 13:50322180-50322202 CTGTTGGTGTGAATGTAAAATGG - Intronic
1108519759 13:51235837-51235859 CTGTGGAAGTCAGGGAGAAAAGG + Intronic
1109647713 13:65281449-65281471 CTGTTGGTGAAAATGTGAAATGG - Intergenic
1110028792 13:70578063-70578085 TTGTTGGTGGGAAGGAAAAATGG + Intergenic
1110523777 13:76511908-76511930 CTGGTGTTGACAAAGAGAAAAGG - Intergenic
1110810605 13:79807684-79807706 CTTTGGGTGTCAAGGAGCACAGG + Intergenic
1112759066 13:102672620-102672642 CTGATTTTGTGAAGGAGAAAGGG - Intronic
1114837639 14:26222428-26222450 GTGTTGTTTTCAAGTAGAAATGG - Intergenic
1114876723 14:26729618-26729640 CAGGTGGTTTCAAGGATAAAAGG + Intergenic
1115115416 14:29875917-29875939 CTGTTGCTGTCAAAGAGAGGTGG - Intronic
1116906131 14:50405380-50405402 CTGTTGGTGGGAATGTGAAATGG - Intronic
1117937423 14:60922288-60922310 CTCATGATGTAAAGGAGAAATGG + Intronic
1118127719 14:62927279-62927301 CTGTTGGTGGGAATGTGAAATGG + Intronic
1118215961 14:63808717-63808739 CTGTTGGAGTCAAAGTGAAGAGG + Intergenic
1118654127 14:67928622-67928644 CTTGTGGTGACAAGGAGAAGAGG + Intronic
1119095657 14:71828173-71828195 CTTTTGGAGGCAAGGAGAGAAGG + Intergenic
1119544270 14:75460359-75460381 CTGTTAGTGACAAGAGGAAATGG + Intronic
1119994448 14:79237593-79237615 TTCTTGGAGTAAAGGAGAAAAGG - Intronic
1120844427 14:89113542-89113564 GTGTTGGTGTGAAGGTTAAATGG - Intergenic
1120933485 14:89871768-89871790 CTGATGGAGTCAGGGGGAAAAGG - Intronic
1122211827 14:100178533-100178555 CTGGTGGTGGGAAGGAGCAAGGG + Intergenic
1122706752 14:103626697-103626719 GTGTTGGGGGAAAGGAGAAAAGG - Intronic
1122904771 14:104796550-104796572 CTGTGAGTGTCCAGGAGAAAGGG - Intergenic
1123416009 15:20096031-20096053 CTCTTAGTGTCAAGAAGATATGG - Intergenic
1123479609 15:20618700-20618722 CTATGAGTGTCCAGGAGAAATGG + Intergenic
1123525348 15:21103140-21103162 CTCTTAGTGTCAAGAAGATATGG - Intergenic
1123638398 15:22381664-22381686 CTATGAGTGTCCAGGAGAAATGG - Intergenic
1123702223 15:22923508-22923530 CTGCTGGTAAGAAGGAGAAATGG + Intronic
1124508348 15:30298761-30298783 CTGCTGGTGTGAATGAAAAATGG - Intergenic
1124735209 15:32239895-32239917 CTGCTGGTGTGAATGAAAAATGG + Intergenic
1125215388 15:37267197-37267219 TTGTTGGTGTAAATGAAAAATGG + Intergenic
1125339187 15:38657745-38657767 ATGTTGGTTTCACTGAGAAATGG - Intergenic
1126959184 15:53970956-53970978 CTGTTGGTGGAAATGAAAAATGG - Intergenic
1128887974 15:71305711-71305733 CTGATGCTGTCCAGGAGAAATGG + Intronic
1128955919 15:71944704-71944726 CTATTGGTGTTAAGGATCAATGG - Intronic
1131159611 15:90096554-90096576 CTGTTGGTGGGAATGTGAAATGG + Intronic
1134373482 16:13647880-13647902 CTTTTGGAGTCAAGTAGAAGAGG - Intergenic
1134432930 16:14228172-14228194 CTGTTGGTGGGAAAGTGAAATGG + Intronic
1135105822 16:19648392-19648414 CTGTTGCTGGCAGGCAGAAATGG - Intronic
1135394030 16:22117281-22117303 CAGGTGGGGACAAGGAGAAAAGG - Intronic
1138290310 16:55841090-55841112 ATGTTTGTGTAAAGGAAAAACGG + Intergenic
1139228545 16:65257499-65257521 CAGATGCTGGCAAGGAGAAATGG - Intergenic
1139501495 16:67370032-67370054 CTGATGATGCCAGGGAGAAAAGG + Intronic
1140293644 16:73687498-73687520 CTGTTGGTGTACATCAGAAAGGG + Intergenic
1143665416 17:8355956-8355978 TTGTTGGTGGGAAGGCGAAATGG + Intergenic
1143734132 17:8898489-8898511 CTTTTGGTATCAAAGAGATATGG + Intronic
1144293408 17:13849465-13849487 CTGATGGCATCAAGCAGAAAAGG - Intergenic
1144674602 17:17153779-17153801 TTGTTGGTGGCACTGAGAAAAGG - Intronic
1144741916 17:17588565-17588587 GTGTTGGTGTCAAGAAGAATGGG - Intronic
1145843029 17:28012310-28012332 CTGTTGGTGACAGTAAGAAATGG - Intergenic
1147360839 17:39928571-39928593 CTCTTGGTGACATGGAGAATGGG - Intergenic
1148042577 17:44720511-44720533 ATGTTGGTGGCAAGGTGAAAAGG - Intronic
1149041046 17:52188387-52188409 CCGTTGGTGGCAAAGAGTAAAGG - Intergenic
1149615518 17:57994489-57994511 CTGTGGGAAACAAGGAGAAAGGG + Intronic
1150439697 17:65181279-65181301 CAGATGCTGGCAAGGAGAAAAGG - Intronic
1150821181 17:68435713-68435735 CTGTTGGTGAAAAGGAAAAATGG + Intronic
1151825542 17:76521984-76522006 CTTTTGGTGGCAAGGAGCAAAGG - Intergenic
1152766410 17:82142633-82142655 ATGATGGTGAGAAGGAGAAATGG + Intronic
1153600504 18:6776702-6776724 CTTTTTGAGACAAGGAGAAACGG + Intronic
1154982056 18:21510786-21510808 CTGTTGGTGGGAAGGTAAAATGG - Intronic
1156359009 18:36367566-36367588 ATGCTGGTATCAGGGAGAAAAGG + Intronic
1156584075 18:38412567-38412589 TTGTTTGTGTTAAGGAAAAAAGG + Intergenic
1157434635 18:47658091-47658113 CTGAGGGTGTCAAGGAGGGAGGG - Intergenic
1157506619 18:48231010-48231032 CTTTGGGTGCCAAGGAGAACGGG + Intronic
1158667350 18:59444450-59444472 CTGTTGGTGTGAATGTAAAATGG - Intronic
1161686264 19:5704162-5704184 CTGTGGCTGTGAAGGAGGAAGGG + Intronic
1164398307 19:27885491-27885513 CTCATGGTGACAAGGAGAAGAGG - Intergenic
1168495355 19:56843311-56843333 ATGTTGGTGGTAAGGAAAAAAGG - Intergenic
925372359 2:3356026-3356048 ATGTTGGGGTGAAGGAGGAAGGG + Intronic
925376037 2:3386921-3386943 CTGTTGGTGGGAATGACAAACGG + Intronic
925522534 2:4763037-4763059 CTTTTTTTCTCAAGGAGAAAAGG + Intergenic
926242981 2:11102206-11102228 ATGCTGGTGGCAAGGTGAAAAGG + Intergenic
926703045 2:15816940-15816962 CTGTTGCTGTGATGGAGAAAAGG - Intergenic
926849615 2:17180636-17180658 CCTTTGATTTCAAGGAGAAAAGG - Intergenic
927595090 2:24389281-24389303 CTGTTGGTGGGAATGTGAAATGG - Intergenic
928999634 2:37333462-37333484 CTGTTGGTGGGAATGTGAAATGG + Intergenic
929033483 2:37670847-37670869 CACTTAGTTTCAAGGAGAAAGGG + Intronic
929070465 2:38024378-38024400 CTGTTGGTGAGAATGTGAAATGG - Intronic
930621358 2:53647044-53647066 CAGGTGGTGACAAGGAGAAGAGG + Intronic
931969190 2:67567131-67567153 AGGTTGGTGTCTAGGAGAAATGG + Intergenic
931973450 2:67616066-67616088 CTGTTGGAGTGAAGAAGAAAAGG - Intergenic
932661272 2:73654899-73654921 CTGTTGGTGGCAATGTAAAATGG - Intergenic
932857494 2:75252101-75252123 CTGTTGGTGTGAATGTGAAACGG - Intergenic
933434010 2:82221504-82221526 CTGTTAGTGGCAAGGTAAAATGG - Intergenic
933593123 2:84255012-84255034 CTGTTGAGGTCATGGAGAAAAGG - Intergenic
933622478 2:84558902-84558924 ATTTTGGTGTCAAGAAGAAAAGG - Intronic
935727105 2:106032955-106032977 CTGCTGGTGGGAAAGAGAAATGG + Intergenic
936022322 2:109004257-109004279 CTGTGGGTGTGAGGGAGTAAGGG + Intergenic
936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG + Intronic
936814487 2:116443333-116443355 CTGTAGGGGTTAAAGAGAAAAGG + Intergenic
937593445 2:123643815-123643837 GTGTTGGTGTGATGGAAAAAAGG - Intergenic
937679406 2:124627412-124627434 CTGGTGATATCCAGGAGAAAAGG + Intronic
937794591 2:126001889-126001911 CTGCTGGTGTGAAGGCCAAAGGG - Intergenic
937815248 2:126243999-126244021 CTCTTGGTCTGAAGGAGAATGGG - Intergenic
937925596 2:127165316-127165338 ATAATGGTTTCAAGGAGAAATGG - Intergenic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
939681784 2:145144719-145144741 CTGTTGGTGGGAAGGCAAAATGG + Intergenic
940219623 2:151338138-151338160 TTGTTGGAGTGGAGGAGAAAAGG + Intergenic
941139849 2:161765906-161765928 CTCTTGGTAACAAGGAGGAAGGG + Intronic
941161008 2:162034024-162034046 CTTTTGGTCTCAGGGAGACAGGG - Intronic
942501620 2:176596792-176596814 CTATTTGGGTCAAGGAGCAAAGG + Intergenic
943678654 2:190744193-190744215 CTGTTGGTGTGTGGGAGCAAAGG - Intergenic
943964446 2:194314691-194314713 CTGTTGGTGGAAATGAAAAATGG - Intergenic
944061441 2:195573175-195573197 CTGTTTGTTTAAAGTAGAAAAGG + Intergenic
944723097 2:202443409-202443431 CTGTTGGTGGGAATGAAAAATGG - Intronic
945348951 2:208753441-208753463 TTGTTGGTGGCAATGAAAAATGG - Intronic
945381187 2:209142861-209142883 CTGTTGGTGGGAATGTGAAATGG + Intergenic
945902627 2:215556102-215556124 CTTCTGGTTCCAAGGAGAAATGG + Intergenic
947414695 2:229882600-229882622 CTGTTTGGGTCCAGGTGAAATGG - Intronic
948529104 2:238592387-238592409 CTGTTGGTGGGAATGCGAAATGG - Intergenic
1168849798 20:968762-968784 CTGATGGTGACAGTGAGAAATGG - Intronic
1169979172 20:11364293-11364315 CTGTTGGTGGCATGGGGAACAGG + Intergenic
1171559729 20:26112475-26112497 GGGTGGGTGTCAAGGAGAATGGG + Intergenic
1172544726 20:35751262-35751284 CTATTGTTGTAAAGGAGCAAGGG + Intergenic
1174434278 20:50494551-50494573 CCGTGGGCGTCAAGGAGAAGGGG - Intergenic
1176308345 21:5136109-5136131 GTGTTGGGGTCAAAGAGCAAGGG - Intronic
1176422868 21:6530488-6530510 CTGTTGGTGTTAGTGAAAAACGG - Intergenic
1177676477 21:24307754-24307776 GTGTTGCTGTCAAGGAAAACTGG + Intergenic
1178728296 21:35075238-35075260 GTGTTGGTAGCAAGGAGCAATGG - Intronic
1178908064 21:36652436-36652458 GTGTTTGTGCCAAGGAGAAGAGG - Intergenic
1179698361 21:43138805-43138827 CTGTTGGTGTTAGTGAAAAACGG - Intergenic
1179848715 21:44125923-44125945 GTGTTGGGGTCAAAGAGCAAGGG + Intronic
1180124666 21:45781527-45781549 CTGTTGGTGGGAATGGGAAATGG + Intronic
1181296522 22:21844333-21844355 CTGTTGGTGGGAATGTGAAAAGG + Intronic
1181682834 22:24507749-24507771 CAGGTGGTGACAAGGAGAAGAGG - Intronic
1182585432 22:31341994-31342016 CTGTTGGTGGCAAGGGGAGAGGG - Intronic
1184220012 22:43094045-43094067 CTGTTGGTGGGAATGTGAAATGG - Intergenic
1184505844 22:44901643-44901665 ATGCTGGTGGCAAGGTGAAAAGG + Intronic
1185213645 22:49586286-49586308 CTGGTGGTACCAAGGAGAACAGG - Intronic
950085414 3:10254157-10254179 CTGTTGTTGCCAAGGACAATCGG + Intronic
950999364 3:17539941-17539963 CTGTTGGTGGGAAGGTAAAATGG - Intronic
951106093 3:18744829-18744851 CTGTTGGGGGTAAGGAGACAAGG - Intergenic
951308019 3:21089801-21089823 CTGTTGGTGGCAATGTAAAATGG + Intergenic
952773519 3:37022968-37022990 CTGCTGGTGGCAGGGAGAGAAGG - Intronic
954893593 3:53955867-53955889 CTGCTGGTGTCTATTAGAAATGG - Intergenic
955943630 3:64170123-64170145 ATGTGGGTCTCCAGGAGAAAAGG - Intronic
956729438 3:72183242-72183264 CTCTTGCTGTCAAGCAGGAAAGG + Intergenic
957204008 3:77171128-77171150 CTGTCAGTGACGAGGAGAAAAGG - Intronic
957477307 3:80741138-80741160 CTTTTGATGTCAAAGAGTAATGG - Intergenic
957713458 3:83894344-83894366 CTGGTGGTGTAAAGGAGGTAAGG - Intergenic
960405369 3:117253128-117253150 TTCTTGGAGTTAAGGAGAAAAGG - Intergenic
961557401 3:127705988-127706010 CTGTTGGTGAGAATGTGAAATGG + Intronic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
961860695 3:129914894-129914916 CTGTTGGTGGGAATGTGAAATGG + Intergenic
963047013 3:141109996-141110018 CTGTTGGCCTGAGGGAGAAATGG + Intronic
963109895 3:141679555-141679577 CTGTTGGTGGCAATGTAAAATGG + Intergenic
963185221 3:142408142-142408164 GTGTTGGTGTCAAGAAAAATAGG - Intronic
964163348 3:153672002-153672024 CTTTTGGTATTAAGGAGCAATGG - Intergenic
964413090 3:156419653-156419675 TTGTAGGTATCATGGAGAAAAGG - Intronic
965643678 3:170857920-170857942 GTGTTGGTGTCATTGAGAACTGG + Intronic
967922807 3:194625328-194625350 CTGCTGGTGTCAAGGAAGCATGG - Intronic
968527034 4:1065231-1065253 CTGTTGGTGAGAATGTGAAATGG - Intronic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
969447141 4:7251888-7251910 GTTTGGGTGGCAAGGAGAAAGGG + Intronic
970272887 4:14366245-14366267 ACGTGGGTCTCAAGGAGAAATGG + Intergenic
970424608 4:15934654-15934676 CTGATGGTGGCAGGGAGGAATGG - Intergenic
970464569 4:16309759-16309781 CTGATGGTGGCAGGGAGGAATGG + Intergenic
970830897 4:20338574-20338596 CTGTTTGTGTCAAGAAACAAAGG - Intronic
971034226 4:22675650-22675672 CTGTGAGTGTCCAGAAGAAAAGG + Intergenic
971641974 4:29146076-29146098 CTGTTGGGGGCAAGGAGTTAAGG - Intergenic
971714161 4:30153696-30153718 CTTTGGGTGTCAAGGAGCATAGG - Intergenic
972128924 4:35805264-35805286 ATGATGGTAACAAGGAGAAAAGG + Intergenic
972981592 4:44710507-44710529 CTGTTGGTTTCCAGCAGAAAAGG - Intronic
973652766 4:53013161-53013183 CTGTAGGTGTAAAGGAAGAATGG - Intronic
974978273 4:68919272-68919294 CTGTTGGTGGTAATGACAAATGG + Intergenic
974986975 4:69040258-69040280 CTGTTGGTGGGAATGACAAATGG - Intronic
976527878 4:86115004-86115026 CTGCTGGTGTCAGGGAGACTGGG - Intronic
977558371 4:98507585-98507607 CTGTGGTTGTCAAAGAGAAAGGG + Intronic
977760774 4:100734039-100734061 CTGTAGGAGTTAAGGAAAAATGG + Intronic
978537369 4:109776074-109776096 CCGTTGCTGGCAAGGAGAAGAGG - Intronic
978981558 4:114953061-114953083 CTGATGGTCTCTGGGAGAAATGG - Intronic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979465696 4:121036025-121036047 CGGTTGGTGTCAAAGATAGAGGG - Exonic
979718265 4:123867881-123867903 CCTTTGGTATCAAAGAGAAAAGG - Intergenic
981114707 4:140976312-140976334 CAGATGGTGGCAAGGAGAGATGG - Intronic
981914592 4:150020226-150020248 TTGGTGGTTTCAAGCAGAAAAGG - Intergenic
983685662 4:170405489-170405511 TTGTTGGGGGTAAGGAGAAAGGG - Intergenic
983979191 4:173973366-173973388 CTGTAGATGTCAAGGAGTTATGG + Intergenic
984694276 4:182763991-182764013 TTGTTTGTGTTAAGGAGAATGGG - Intronic
984928496 4:184826458-184826480 CCGTCAGTGTCAAGGAAAAACGG - Intronic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
990447534 5:55906471-55906493 CTGTGGGTGTCAAGCAGACCAGG + Intronic
990734498 5:58845208-58845230 CTGTGGGTATCAATGTGAAAAGG + Intronic
990937036 5:61162351-61162373 CTCCTGGTGTCCAGCAGAAACGG - Exonic
998625515 5:143841379-143841401 CTCTTGGTGGAAAGTAGAAAAGG + Intergenic
998679868 5:144455143-144455165 CTGTTGGGGGAAAGGAGAAAAGG - Intronic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
998827109 5:146113889-146113911 CTTTGGGTGTCCAAGAGAAATGG - Exonic
998951582 5:147397901-147397923 CTGAAGGTCTCAAGGAGAGAAGG - Intronic
1000727175 5:164785698-164785720 ATGTTGGGTTCATGGAGAAATGG + Intergenic
1001110732 5:168893986-168894008 CTGTTGGTGTCAGGAAGGAGGGG + Intronic
1001224144 5:169929287-169929309 TTGTTGGTGTCAATGGGGAAAGG - Intronic
1001738203 5:174024304-174024326 CTTTTGATTTCAAGGGGAAAAGG - Intergenic
1003221551 6:4165056-4165078 GTGTTGGGGACAAGAAGAAAAGG + Intergenic
1004849830 6:19687873-19687895 CTCTTGCTGTCAATGAGAAAAGG + Intergenic
1005131793 6:22517103-22517125 CTGTTGCAGCCAAGGAGAGAAGG - Intergenic
1005741705 6:28797182-28797204 CTGTTGGTGTTGATGAGAATTGG + Intergenic
1007132863 6:39492920-39492942 CTTTAGATGTCAATGAGAAAAGG - Intronic
1008103175 6:47414697-47414719 CAATGGGTGTCAAGGATAAAAGG + Intergenic
1008237825 6:49071631-49071653 ATGTTGGTGTTAACTAGAAAAGG + Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012660086 6:101877542-101877564 CTGTTGATATCCAGGGGAAATGG - Intronic
1012806700 6:103903742-103903764 CTGTTGGTGCCAGGAAGGAATGG + Intergenic
1015157937 6:130118208-130118230 ATTTTGGTGTCAAGAAGAACGGG + Intronic
1015740685 6:136450224-136450246 GTGTTGGTGAAAAGGATAAAAGG - Intronic
1016217797 6:141624354-141624376 CTGTTGGCTCTAAGGAGAAAAGG - Intergenic
1016809553 6:148246540-148246562 CTTTTGGTGCCAAGTACAAAAGG + Intergenic
1016849976 6:148608759-148608781 CTGTTGGTGAAGAGTAGAAATGG + Intergenic
1017130805 6:151106901-151106923 CAGTTGGTTTCTAGGACAAAAGG + Intergenic
1017525069 6:155235235-155235257 CCGTTTGGGTCAAGAAGAAAAGG - Intronic
1017684011 6:156893832-156893854 CTGTTGGTGGGAATGTGAAATGG + Intronic
1018022528 6:159775292-159775314 GTTTTGGTGTCAACTAGAAAAGG + Exonic
1018026607 6:159811742-159811764 CTCTTGGTATCAATGAGAACAGG - Exonic
1018833113 6:167461253-167461275 AGGTTGGTGTGAAGGAGAGAGGG + Intergenic
1020032867 7:4945081-4945103 GTGTTGGTGTCCAGAAGAAGGGG - Intronic
1022387161 7:29912319-29912341 CTGTTGGTGAGAATGTGAAATGG + Intronic
1022530130 7:31061744-31061766 CTGTGGGAGGCAAGGAGAGAGGG + Intronic
1022789142 7:33669484-33669506 CTGTCAGTGTCAGGGAGGAAAGG + Intergenic
1022940577 7:35233452-35233474 CTGTTGCTGTCCATGAGAACAGG - Intronic
1023623882 7:42097508-42097530 CTGCTGGTGTCCAGGGGAAGGGG - Intronic
1024422477 7:49185171-49185193 TTGTTGATGACATGGAGAAAAGG + Intergenic
1024464770 7:49700624-49700646 CTGTTGCTATACAGGAGAAAAGG - Intergenic
1024765564 7:52654279-52654301 TTATTGGTGTCTAGAAGAAAGGG + Intergenic
1024912750 7:54464924-54464946 CTGTAGGAATCAAGGAGAAGTGG - Intergenic
1025482759 7:61004689-61004711 TAGTTGATTTCAAGGAGAAATGG + Intergenic
1028931179 7:96414791-96414813 GTGTGGGTGTCAAGGTGAGAGGG + Intergenic
1029106657 7:98182625-98182647 CTGTTGGTGGGAAGGTAAAATGG + Intronic
1029622615 7:101699382-101699404 CTATTGGCATGAAGGAGAAATGG - Intergenic
1030031850 7:105376870-105376892 GTGTGTGTGTAAAGGAGAAAAGG - Intronic
1030841909 7:114364383-114364405 CAGTTGGTGACAAGGAGAACTGG + Intronic
1031576490 7:123421298-123421320 CTGTTGGGTTTATGGAGAAAAGG - Intergenic
1031652968 7:124314460-124314482 GTGGTGGAGACAAGGAGAAAAGG + Intergenic
1031826007 7:126566572-126566594 CTGTTGGTGGAAATGAGGAATGG + Intronic
1033013271 7:137644840-137644862 CTGTTGGGGTCAATGACACATGG + Intronic
1033110753 7:138572920-138572942 CTGTTGTTTTGTAGGAGAAAAGG - Intronic
1033535559 7:142308683-142308705 CTGTTGTTGTCATGGTGAAAAGG - Intergenic
1033614986 7:143005283-143005305 CTGTTGGAGGCAAAGAGAGAGGG + Intergenic
1035027006 7:155832714-155832736 TTCTAGATGTCAAGGAGAAACGG + Intergenic
1036250166 8:7155300-7155322 CATTTGTTGTAAAGGAGAAAGGG + Intergenic
1036367322 8:8132150-8132172 CATTTGTTGTAAAGGAGAAAGGG - Intergenic
1036883560 8:12533512-12533534 CATTTGTTGTAAAGGAGAAAGGG + Intergenic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1038861287 8:31391671-31391693 CTGCTGGTGTCAAGGACAACAGG + Intergenic
1039271647 8:35887828-35887850 CTTTTGGTGTTAAGGGAAAAAGG + Intergenic
1040533006 8:48281279-48281301 CTTTTGGATTCAAGGTGAAATGG + Intergenic
1042440138 8:68816236-68816258 TTTTTCCTGTCAAGGAGAAAGGG - Intronic
1043008151 8:74846470-74846492 CTATTTATGTCAGGGAGAAAGGG - Intronic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1045205570 8:100036281-100036303 ATGGTGTTGGCAAGGAGAAAGGG - Intronic
1046583950 8:116128371-116128393 GTGTGTGTGTCAAGGATAAATGG - Intergenic
1046780536 8:118210076-118210098 CTGTCAGGGTCCAGGAGAAATGG + Intronic
1047522520 8:125606160-125606182 CTGCCGGTGTCAAAGAGAAGTGG - Intergenic
1049643130 8:143724544-143724566 GTGTTGGTGACAAAGAGGAAAGG + Exonic
1050642126 9:7679623-7679645 CTGTTTATGTTAAGGAGGAAAGG - Intergenic
1050653429 9:7798516-7798538 CTGTGTGTGTCACGGGGAAAGGG + Exonic
1052255517 9:26451595-26451617 CAGATGCTGGCAAGGAGAAAAGG - Intergenic
1052937201 9:34102718-34102740 CTGTTGGTGGCAAGCTAAAATGG + Intronic
1053606328 9:39663973-39663995 CTGTTGGTGTCAACGTAAAATGG + Intergenic
1053864252 9:42420588-42420610 CTGTTGGTGGCAACGTAAAATGG + Intergenic
1054247212 9:62678450-62678472 CTGTTGGTGTCAACGTAAAATGG - Intergenic
1054561331 9:66712982-66713004 CTGTTGGTGTCAACGTAAAATGG - Intergenic
1054913653 9:70476738-70476760 GTGCTGGAGTCAAGGAGAAATGG - Intergenic
1056273334 9:84968408-84968430 GTGTTGGTTGCAAGAAGAAAAGG + Intronic
1056904314 9:90632211-90632233 CTGTTACTGTCAGGGAGACAGGG - Intronic
1059035938 9:110753503-110753525 CTGTTGGTGCCATTGAGAATGGG - Intronic
1061323449 9:129847232-129847254 CTGTTGGTGGGAATGTGAAATGG - Intronic
1061514906 9:131083420-131083442 CAGTTGGTGTTCAGGATAAAAGG + Intronic
1061829094 9:133279327-133279349 TTGCAGGTGTCATGGAGAAATGG - Intergenic
1186218466 X:7324994-7325016 CAGCTGGTGTAAAGTAGAAATGG + Intronic
1187101675 X:16199205-16199227 ATGCTGGTGGCAAGGTGAAAGGG - Intergenic
1187798042 X:23025988-23026010 CTTTTAGTGTCAAGGAAGAAGGG - Intergenic
1191043805 X:56114197-56114219 CTGTGGGTGCCAAGGAGACTGGG - Intergenic
1191972272 X:66829696-66829718 GTGTTGCTGTCTAGGAGAAGAGG - Intergenic
1192044586 X:67658690-67658712 CTGTAGGGGTCAAGGCCAAAGGG + Intronic
1192092648 X:68176577-68176599 CTGTTGGTGGCAATGTGAAATGG + Intronic
1193312380 X:80024077-80024099 CTGTTCGGGTCAAGGTGAAAGGG + Exonic
1193653807 X:84172508-84172530 CTGTTGGTGACAACGTAAAATGG + Intronic
1193781764 X:85711715-85711737 CTGTTGGTGGGATGGTGAAATGG - Intergenic
1194450233 X:94036552-94036574 CTATTGGTGGGAATGAGAAATGG - Intergenic
1194943342 X:100039521-100039543 CTGTTGGAGACAAAGAGGAAGGG - Intergenic
1195502578 X:105619352-105619374 CTCTTTGTGCCAAGAAGAAAGGG - Intronic
1197094836 X:122581497-122581519 CTGGTGGTGTTGTGGAGAAAAGG + Intergenic
1198270835 X:135054747-135054769 AAGTTGTTGTCAAGAAGAAATGG - Intergenic
1198431926 X:136576103-136576125 GACTTGGTGTCAAGGAGATAGGG - Intergenic
1198432224 X:136578951-136578973 CTCTTGGAGACAAGGAGAAGAGG - Intergenic
1199635190 X:149806865-149806887 GTGTTGGTGTAAAGGCGAGATGG + Intergenic
1200042702 X:153381310-153381332 CTGTTGCTTCCCAGGAGAAAAGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic