ID: 968534756

View in Genome Browser
Species Human (GRCh38)
Location 4:1116987-1117009
Sequence AAGCTCTCCAGCTCCCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968534750_968534756 16 Left 968534750 4:1116948-1116970 CCTTTAATCAACTTCATGGCTCT No data
Right 968534756 4:1116987-1117009 AAGCTCTCCAGCTCCCTCTTTGG No data
968534749_968534756 17 Left 968534749 4:1116947-1116969 CCCTTTAATCAACTTCATGGCTC No data
Right 968534756 4:1116987-1117009 AAGCTCTCCAGCTCCCTCTTTGG No data
968534751_968534756 -7 Left 968534751 4:1116971-1116993 CCTTTGAACCCCTTCCAAGCTCT No data
Right 968534756 4:1116987-1117009 AAGCTCTCCAGCTCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968534756 Original CRISPR AAGCTCTCCAGCTCCCTCTT TGG Intergenic
No off target data available for this crispr