ID: 968537541

View in Genome Browser
Species Human (GRCh38)
Location 4:1144055-1144077
Sequence TGGTATTCCCTAACAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968537541_968537549 28 Left 968537541 4:1144055-1144077 CCTTTTTTTGTTAGGGAATACCA No data
Right 968537549 4:1144106-1144128 TCATGGAAATGGTACCAACAGGG No data
968537541_968537546 11 Left 968537541 4:1144055-1144077 CCTTTTTTTGTTAGGGAATACCA No data
Right 968537546 4:1144089-1144111 TTAGAACACTGTGGATATCATGG No data
968537541_968537547 17 Left 968537541 4:1144055-1144077 CCTTTTTTTGTTAGGGAATACCA No data
Right 968537547 4:1144095-1144117 CACTGTGGATATCATGGAAATGG No data
968537541_968537548 27 Left 968537541 4:1144055-1144077 CCTTTTTTTGTTAGGGAATACCA No data
Right 968537548 4:1144105-1144127 ATCATGGAAATGGTACCAACAGG No data
968537541_968537545 2 Left 968537541 4:1144055-1144077 CCTTTTTTTGTTAGGGAATACCA No data
Right 968537545 4:1144080-1144102 AGGGAGAGCTTAGAACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968537541 Original CRISPR TGGTATTCCCTAACAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr