ID: 968541295

View in Genome Browser
Species Human (GRCh38)
Location 4:1169663-1169685
Sequence GAGCCCACCAACCTGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541295_968541305 20 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data
968541295_968541304 19 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
968541295_968541299 -8 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541299 4:1169678-1169700 GTGGGCTCCAGTTCCTCCTCGGG 0: 1
1: 0
2: 1
3: 22
4: 231
968541295_968541303 18 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541295_968541298 -9 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541298 4:1169677-1169699 GGTGGGCTCCAGTTCCTCCTCGG 0: 1
1: 0
2: 3
3: 21
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541295 Original CRISPR GAGCCCACCAACCTGGCCAT GGG (reversed) Intronic
905203238 1:36327904-36327926 CAGCCCACCAGCCTGTCCGTGGG + Exonic
906210634 1:44010663-44010685 GAGCCCACCCACCAGGGCCTGGG - Intronic
906677068 1:47700995-47701017 GAGCCACCCCACCTGGCCACAGG + Intergenic
908224653 1:62043934-62043956 GAGCCCAGCAGACTGGGCATGGG - Intronic
908600390 1:65732440-65732462 GACCCCACCTTCCTGGCCACAGG - Intergenic
909385907 1:75056612-75056634 GAACCCTGCAACATGGCCATAGG + Intergenic
909482349 1:76139669-76139691 GAGCCCAGAAACCTGGCACTAGG - Intronic
911630170 1:100174581-100174603 GAGCCACCACACCTGGCCATGGG + Intronic
915949189 1:160176588-160176610 GGGCGCACCAATCTGTCCATAGG - Exonic
917994651 1:180422862-180422884 GAGCTCACCACACTAGCCATAGG + Intronic
919755417 1:201063069-201063091 GAGCCCCCCTACCTGGGCCTTGG - Intronic
919802434 1:201361775-201361797 GGTCCCACCAAACTTGCCATGGG + Intronic
922220048 1:223551503-223551525 GATCCCAGCAGCCTGGCCAGAGG + Intronic
922722455 1:227905844-227905866 GTGCCCACCATGCTGGCCACAGG - Intergenic
923203008 1:231730664-231730686 CAGCCTACCAACAAGGCCATGGG - Intronic
1063175670 10:3548854-3548876 GAGACCTCCAGCCTGGCCACAGG + Intergenic
1064529275 10:16290676-16290698 GACCCCAGCAAAATGGCCATGGG + Intergenic
1065628651 10:27655358-27655380 GAGCCCAGGAGCCAGGCCATTGG - Intergenic
1066544210 10:36482086-36482108 GAGCCTCCCAACCTCTCCATGGG - Intergenic
1067203855 10:44197298-44197320 GAGCCACCACACCTGGCCATGGG + Intergenic
1067712110 10:48657610-48657632 GAACACACCATCCTGGCCATGGG - Intergenic
1070287504 10:75094618-75094640 AACCCCACCAGCCTGGCCCTGGG - Intronic
1070563409 10:77584913-77584935 AAGCCCACACACCTGGCCAAGGG + Intronic
1071150769 10:82631815-82631837 GAGCCACCACACCTGGCCATGGG - Intronic
1075763094 10:124871453-124871475 GAAACCACCCACCTGCCCATAGG + Intergenic
1075924201 10:126236891-126236913 GAGCCATCCACCCTGGGCATGGG + Intronic
1075969370 10:126639472-126639494 GAGCCCTTCTACCTCGCCATGGG - Intronic
1078513870 11:12007297-12007319 GGGCCAACCAGCCTGGACATTGG + Intronic
1079237124 11:18698948-18698970 GAGCCCACCGGCCTGGCCACCGG + Intronic
1083742461 11:64718146-64718168 GGGCCCTCCAACCTGACCAAAGG + Intronic
1087788682 11:102384468-102384490 GAGCCCTACAGCCTGCCCATTGG - Intergenic
1090235217 11:125141940-125141962 GAGCCCACCACCGCGGCCAGAGG - Intergenic
1090238679 11:125166749-125166771 AAGCCCACAAACCCGGCCTTTGG + Intronic
1090265169 11:125349026-125349048 GATTCCACCATCCTGGCCCTTGG + Intronic
1091217140 11:133909025-133909047 GAGCCCAGCAACCTCGCCCCGGG + Exonic
1092923230 12:13250983-13251005 GTGCCCACCCACATGGCCAAAGG + Intergenic
1095743038 12:45627425-45627447 GAGCTCACCAACCAGGCTACAGG - Intergenic
1097086499 12:56472303-56472325 GAGCCAACAAATCTGGCTATAGG - Exonic
1097522408 12:60685973-60685995 CAGCCCTCCAACCTGGGCAGTGG - Intergenic
1101513124 12:105410404-105410426 GAGCCCTCCAACCTTGCCCTGGG - Intergenic
1101761269 12:107660761-107660783 GTGCCCACCCCCATGGCCATTGG + Intergenic
1103785478 12:123429828-123429850 GAGCCACCACACCTGGCCATTGG - Intronic
1104477845 12:129084934-129084956 GAGTCCACCAACCTAGCCACAGG - Intronic
1110800970 13:79694418-79694440 GAGCCACCGAACCTGGCCAAAGG - Intergenic
1110915965 13:81021203-81021225 CAGCCCTCCAACCTGCCCTTGGG + Intergenic
1113057419 13:106284110-106284132 GGGCTGACCAACCAGGCCATGGG - Intergenic
1113274924 13:108718284-108718306 CTGCCCACCCACCTGGACATTGG + Intronic
1118458458 14:65966341-65966363 GAGCAAACCCACCTGGCCACAGG - Intronic
1119544124 14:75459516-75459538 GAGACCAGCACCATGGCCATCGG - Intronic
1122375019 14:101251703-101251725 GAGCCCACCCCACTGGCCTTGGG + Intergenic
1122550415 14:102546104-102546126 GAGCCCAGCACCCTCTCCATGGG + Intergenic
1125959401 15:43816527-43816549 GAGCCACCGCACCTGGCCATGGG + Intronic
1132660997 16:1061525-1061547 GAGCCCAGCAACCTGGCAGGTGG + Intergenic
1133008875 16:2899173-2899195 CAGGCCACCAACCCAGCCATAGG + Exonic
1133619487 16:7512830-7512852 CACCCACCCAACCTGGCCATTGG + Intronic
1136470297 16:30475154-30475176 GAGCCACCCCACCTGGCCAGAGG + Intronic
1136562494 16:31048458-31048480 GAGCCACCGCACCTGGCCATGGG + Intergenic
1142165499 16:88585398-88585420 GGGCCCAGCAACTTGGCGATGGG + Intronic
1142248817 16:88981841-88981863 GGGCCCACCAAAGTGGCCCTGGG + Intergenic
1142296048 16:89223110-89223132 GAGCCTTCCAACGTGTCCATCGG - Intronic
1144309370 17:13998316-13998338 GAGCCACCCCACCTGGCCTTTGG - Intergenic
1145234788 17:21200843-21200865 GAGCTGAGCCACCTGGCCATTGG + Intronic
1145411870 17:22672430-22672452 GAGTCCTCCCACCTGGCCACAGG - Intergenic
1145728451 17:27154945-27154967 TAGTCCTCCAACCTGGGCATTGG + Intergenic
1146936892 17:36817670-36817692 CAGCCCATGAACCTGGCCCTGGG + Intergenic
1147864193 17:43542289-43542311 GATCCCAGCAACCTATCCATAGG + Intronic
1148836104 17:50466723-50466745 GAGCCGTCCAACCTGGCCAAAGG - Intronic
1152783318 17:82235991-82236013 GAACCAACCCTCCTGGCCATGGG + Exonic
1155432867 18:25779572-25779594 GAGCCCCCGCACCTGGCCAGTGG + Intergenic
1159957870 18:74532679-74532701 GATCCCAGCAACTTGGCCTTCGG + Intergenic
1160162336 18:76483262-76483284 AAGCCAGCCAACCTGACCATTGG + Intronic
1160424657 18:78771687-78771709 GAGCCCCCCAGCCTGTGCATGGG - Intergenic
1160567712 18:79797758-79797780 GAGCCCACCCAGCTGCCCTTGGG - Intergenic
1161241945 19:3227687-3227709 GAGCCCACCTCCATGGCGATGGG - Intronic
1161296945 19:3524938-3524960 GAGCCCCGCAACCTGGGAATGGG - Intronic
1161828553 19:6586210-6586232 CACCCCACCACCCTGGCCGTGGG - Exonic
1162069943 19:8147529-8147551 GAGCCCCCCACCCTAGCCATGGG + Intronic
1162108593 19:8387092-8387114 GAACCCACCAATCTGGACACAGG + Intronic
1162219426 19:9163636-9163658 GAGCCCATACACCTGGTCATTGG + Intergenic
1162909661 19:13842274-13842296 TAGCCCCCCGACCTGGCCTTTGG - Intergenic
1162929733 19:13951961-13951983 CATCCCACCAACCCGCCCATCGG + Intronic
1165061388 19:33206849-33206871 CACCCCCCCCACCTGGCCATGGG - Intronic
1165179169 19:33953049-33953071 GAGCCACCGCACCTGGCCATTGG + Intergenic
1168298092 19:55387604-55387626 GAGCCCACGCTCCTGGCAATGGG - Intronic
1168484390 19:56748461-56748483 TAGCCCACCACCGTGGCCTTGGG + Intergenic
925991439 2:9258187-9258209 GAGCCCCCACACCTGGCCAAAGG - Intronic
928984059 2:37163632-37163654 GAGCCACCACACCTGGCCATGGG + Intergenic
932918784 2:75885804-75885826 GAGCACACACACCTGGCCCTGGG - Intergenic
934586638 2:95504697-95504719 GAGCCAACGCACCTGGCCAGAGG + Intergenic
940002961 2:148985085-148985107 GAGCCACCACACCTGGCCATTGG + Intronic
944328336 2:198434102-198434124 GAGCTCACCAACCACACCATGGG - Intronic
948373443 2:237505122-237505144 GACCCCATCAACCTGGCCACCGG - Intronic
948379457 2:237542401-237542423 GGGACCACCAACATGGGCATGGG + Intronic
948751850 2:240137680-240137702 GAGCCCCCCACCCTGGATATTGG + Intergenic
948795423 2:240399985-240400007 GTGCCCACCAGCCTGGACACAGG + Intergenic
1169685617 20:8267819-8267841 GAGCCAATCAAACTGGTCATGGG - Intronic
1170002425 20:11629632-11629654 GAACACACCAACTTGGCCTTAGG + Intergenic
1170127881 20:12985900-12985922 GAGCTTTTCAACCTGGCCATGGG + Intergenic
1171371025 20:24661884-24661906 GAACCCCCCACCCTGCCCATTGG - Intronic
1171543130 20:25979746-25979768 GAGTCCTCCCACCTGACCATGGG - Intergenic
1172492719 20:35353504-35353526 GAGCCACCACACCTGGCCATAGG - Intronic
1173638204 20:44579492-44579514 GAGCCGACCAACCTGCTCAAAGG - Intronic
1175424654 20:58855689-58855711 GACCCCACCAGCCTAGCCAGGGG - Intronic
1178403696 21:32308086-32308108 GAGCCCCCACACCTGGCCAAAGG - Intronic
1179899124 21:44379753-44379775 GAGCCCACCCCCCTGGTCAAGGG - Intronic
1182484256 22:30629960-30629982 AAGCCCTCCACCCTGGCCACAGG + Intergenic
1183739418 22:39661846-39661868 AAGACCACCCACCTGGCCAGCGG - Intronic
1184558379 22:45246442-45246464 GAGCCCTGGAACCTGGCCTTCGG - Intergenic
1185365778 22:50436121-50436143 GTGCCCACCACCCTGCCCACAGG + Intronic
950413796 3:12856603-12856625 GAGCCTCCCAACCTTCCCATGGG - Intronic
950515245 3:13460710-13460732 GAGCCTCCCACCATGGCCATTGG - Intergenic
950525824 3:13522662-13522684 GAGCTCACCAGCCTGCCCAAAGG - Intergenic
951868385 3:27333259-27333281 GAGCCACCGCACCTGGCCATGGG - Intronic
952824361 3:37512770-37512792 GAGCCCACAAGCCTGGCTAAAGG - Intronic
953210241 3:40869109-40869131 CAGCCCAGCAATGTGGCCATGGG + Intergenic
955101278 3:55852496-55852518 GAGCCATCCAACCTGACCACCGG + Intronic
956617405 3:71186426-71186448 GAGCCACCGCACCTGGCCATAGG - Intronic
958438448 3:94126384-94126406 GAGCCCACATTCCTGGCCAGTGG - Exonic
958511144 3:95050550-95050572 TAGCCCACTAAACTGTCCATTGG - Intergenic
962476413 3:135759019-135759041 GAGCCCACCAACCTGAATCTAGG - Intergenic
962703644 3:138022847-138022869 GAGCCCTCCTGACTGGCCATGGG - Intronic
962809741 3:138949999-138950021 CAGCCCACCACCCTGGCCTTTGG - Intronic
967708537 3:192679816-192679838 GAGCCAGCTAACCAGGCCATGGG + Intronic
968541295 4:1169663-1169685 GAGCCCACCAACCTGGCCATGGG - Intronic
969700727 4:8766224-8766246 AAGGCCACCAACCTGGCCCAGGG + Intergenic
969876300 4:10137844-10137866 GGCCCAACCAACCTGGACATGGG - Intergenic
971592449 4:28485266-28485288 GGGCCCACCAAGATGGCCAAAGG - Intergenic
974710594 4:65588851-65588873 GTTGCCACCACCCTGGCCATTGG - Intronic
975759499 4:77604995-77605017 GATCCCACCAACTAGTCCATGGG - Intronic
977853589 4:101860298-101860320 GGGCCCATGAAGCTGGCCATGGG + Intronic
981055565 4:140357565-140357587 GAGCCCAGCCACATGGCAATAGG - Intronic
985842742 5:2320875-2320897 CACCCCACCCTCCTGGCCATGGG - Intergenic
986030562 5:3889184-3889206 GAAGCCACCAGCCTGGCCACTGG + Intergenic
986315681 5:6584890-6584912 GAGCCCATCAGCCTGGCCTTCGG + Intergenic
993089204 5:83402972-83402994 AAGCCCACTGACTTGGCCATTGG - Intergenic
995356771 5:111246687-111246709 GAATCCACCATCCTGGCCAGGGG + Intronic
998445322 5:142193986-142194008 GAAGCCACCAACCTGTCCTTTGG + Intergenic
999085479 5:148885111-148885133 GAGCCCATCTACCTGGAGATTGG + Intergenic
1001910894 5:175516759-175516781 GAGCCCAGGAAACTGGCCTTCGG - Intronic
1002310496 5:178310802-178310824 GAGGCCAACCACCTGGCCAAAGG - Intronic
1002711721 5:181198936-181198958 ACGCCCACCTGCCTGGCCATGGG - Intronic
1002789667 6:427891-427913 CAGCCCACCACACTGGCCTTGGG + Intergenic
1004090441 6:12494853-12494875 GAGGCCAGCACCCTGGCCCTGGG + Intergenic
1005070879 6:21861252-21861274 GAGCCCCCAAGCATGGCCATGGG - Intergenic
1005958331 6:30679829-30679851 GAGCCCAGCAGACTGGCCAGTGG + Intronic
1008159891 6:48064157-48064179 GATCCCAACATCCTGGCCAACGG - Intronic
1012962896 6:105641362-105641384 GAGCCCACCTTCCTCTCCATTGG - Intergenic
1015351991 6:132230986-132231008 GAGACCACCTACCTGCACATTGG + Intergenic
1019546734 7:1581137-1581159 GAGCCCCCAGACCTGGCCCTGGG - Intergenic
1023811759 7:43917408-43917430 AAGCCCAGCAAACTGGCCAGTGG + Intronic
1025294522 7:57764847-57764869 GAGTCCTCCCACCTGACCATGGG - Intergenic
1031072017 7:117172227-117172249 GAGCCACCACACCTGGCCATTGG + Intronic
1032200757 7:129821128-129821150 GAGCCACCACACCTGGCCATTGG + Intergenic
1033267796 7:139900964-139900986 GAGCCCACCACCATGACCAGAGG + Intronic
1035158799 7:156935770-156935792 CTGCCCTCCAACCTGGCCAACGG - Intergenic
1037236816 8:16730131-16730153 GAGACCACCAGCCTGCTCATCGG + Intergenic
1042418737 8:68559829-68559851 GAGCCCACCCACATGTCCCTAGG - Intronic
1044659120 8:94578392-94578414 GAGCCACCACACCTGGCCATAGG + Intergenic
1046324430 8:112621925-112621947 GAGCCTAACAACCATGCCATAGG + Intronic
1048370273 8:133771098-133771120 GCACCCACCCAGCTGGCCATAGG - Intergenic
1049525208 8:143121935-143121957 GAGCCCAGCAACCTGGCACAGGG + Intergenic
1051106567 9:13587541-13587563 GAGCCCGCCAACGTGGACTTAGG - Intergenic
1051377181 9:16414166-16414188 GAGCCGACTCACCTGGTCATAGG + Exonic
1053928656 9:43092984-43093006 GAGCCCACCCACCAGGGCCTTGG + Intergenic
1056672060 9:88638803-88638825 GAGGCCTCCTACCTGTCCATGGG - Intergenic
1056954903 9:91074034-91074056 CATTCCACCAATCTGGCCATGGG - Intergenic
1056970426 9:91196457-91196479 TACCCCACCACCCTGGCCACAGG + Intergenic
1058713003 9:107697344-107697366 GAGCCCATCACCCAGGCCAGGGG - Intergenic
1058894401 9:109387079-109387101 GAGCTCACCAGTCTGGCCAGTGG - Intronic
1059992143 9:119875445-119875467 GAGCCTACCAACCTGGGCCGAGG - Intergenic
1060747757 9:126148948-126148970 AAGCCCACCAGGCTGGCCACTGG - Intergenic
1061088292 9:128411983-128412005 GAGCCCAGGATCCTGGCCAGAGG - Intronic
1061131412 9:128710454-128710476 GAGCCCTCTCACCTGGCCTTGGG + Intronic
1061228319 9:129294461-129294483 GAGCCACCGCACCTGGCCATGGG + Intergenic
1061482469 9:130903740-130903762 GACTCCACCATCCTGGCCAGGGG + Exonic
1062167603 9:135115703-135115725 GAAACCACCAATCTGGCCAGTGG - Intronic
1062368770 9:136225726-136225748 GAGCCCACACACCTGGCAACGGG + Intronic
1062582342 9:137234132-137234154 GAGCTCACGGACCTGGCCGTGGG + Exonic
1187091791 X:16104474-16104496 GAGCCACCGCACCTGGCCATGGG + Intergenic
1187570409 X:20495118-20495140 GAGCCCAGCAAGCTGGCCTAGGG - Intergenic
1190449677 X:50566040-50566062 TCACCCACAAACCTGGCCATGGG + Intergenic
1191020712 X:55857734-55857756 AAACCCACCAGCCAGGCCATAGG + Intergenic
1192357743 X:70419773-70419795 TAGCCCACCTACCTTGCTATTGG - Exonic
1194210472 X:91063779-91063801 GGACCCATCAACCTGGCTATGGG - Intergenic
1195247245 X:103005657-103005679 GAGCCAACACACCTGGCCCTGGG + Intergenic
1196060571 X:111403759-111403781 GAGCCGTCGCACCTGGCCATGGG - Intronic
1198649057 X:138840757-138840779 TAGACCACCACCCTGGCCACTGG - Intronic
1199991289 X:152988997-152989019 GAGCCCACCATCCTGGCAAGAGG - Exonic
1200034232 X:153317905-153317927 GAGTCCACCATCCTGGCAAGAGG - Intergenic