ID: 968541296

View in Genome Browser
Species Human (GRCh38)
Location 4:1169664-1169686
Sequence GGAGCCCACCAACCTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541296_968541299 -9 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541299 4:1169678-1169700 GTGGGCTCCAGTTCCTCCTCGGG 0: 1
1: 0
2: 1
3: 22
4: 231
968541296_968541303 17 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541296_968541298 -10 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541298 4:1169677-1169699 GGTGGGCTCCAGTTCCTCCTCGG 0: 1
1: 0
2: 3
3: 21
4: 237
968541296_968541305 19 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data
968541296_968541304 18 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541296 Original CRISPR GGAGCCCACCAACCTGGCCA TGG (reversed) Intronic
900405326 1:2490421-2490443 GCAGCCCCCCACCCTGGCCCTGG - Intronic
900473311 1:2864888-2864910 GGAGCCCACCGGCCTGGCTCGGG - Intergenic
900610909 1:3544305-3544327 GGAGCCCACAGACCTGAACAGGG + Intronic
900841727 1:5054244-5054266 GGAGTCCACCCACATGCCCAGGG + Intergenic
901324293 1:8357713-8357735 CGAGCTGACCCACCTGGCCAGGG - Intronic
901437479 1:9256542-9256564 GCACACCACCAACCTGGTCAGGG + Intronic
901493901 1:9610566-9610588 GGAGGCCACCGAGCCGGCCACGG - Exonic
901854808 1:12037882-12037904 TGAGCCGACCGAACTGGCCAAGG + Intergenic
902268958 1:15289418-15289440 GGGGCCCAGCACCATGGCCAGGG + Exonic
902754021 1:18537389-18537411 GGAGCTCACAGACCTGGTCAGGG - Intergenic
902775997 1:18675444-18675466 AGAGACCACCTACCTGGCCAAGG + Intronic
903225779 1:21893552-21893574 GCAGCGCTCCCACCTGGCCAGGG + Intronic
903951503 1:26998451-26998473 GGAGCCACAGAACCTGGCCAAGG + Intronic
905914727 1:41676743-41676765 GGAGGCCACCATCCTGGCCAGGG + Intronic
907288477 1:53397239-53397261 GGAGCTAAACAACTTGGCCAGGG - Intergenic
907831168 1:58065635-58065657 GGAGCCCGCCAACTTGACCATGG - Intronic
911653264 1:100413641-100413663 GAAGCCTACCAAACTTGCCAGGG - Intronic
915319088 1:155046350-155046372 GGAGCTCCCTCACCTGGCCAAGG - Exonic
915593627 1:156884230-156884252 GGTTCCCCCCAACCTGGCCCAGG + Intergenic
922726826 1:227926639-227926661 GGAGGGCACCCACCTGGACAGGG + Intronic
1064622556 10:17229941-17229963 GGAGCGCGACAACCTGGCCGAGG + Exonic
1067531146 10:47074509-47074531 GGAGCCCCACAAGGTGGCCATGG - Intergenic
1067712111 10:48657611-48657633 GGAACACACCATCCTGGCCATGG - Intergenic
1069546765 10:69334641-69334663 GGAGCCACCCAACCTGGCCCAGG + Intronic
1069694917 10:70379669-70379691 GGAAGCCACCAAGCTGCCCAGGG + Intronic
1070563408 10:77584912-77584934 GAAGCCCACACACCTGGCCAAGG + Intronic
1070761015 10:79024480-79024502 GGAGCCCAGCAGTCTGGGCAAGG + Intergenic
1072122314 10:92415235-92415257 GGAGCCCCCACACCTGGCCATGG + Intergenic
1073126771 10:101155729-101155751 CAAGCCCACCAGCCTGGCCTTGG + Intergenic
1073517897 10:104094473-104094495 TGAGCCACCCCACCTGGCCAAGG + Intergenic
1074127759 10:110543266-110543288 GGAGCCCACAAGCATGGCCTCGG + Intergenic
1074400734 10:113139417-113139439 GCAGCCCTTCACCCTGGCCATGG + Intronic
1074661363 10:115661843-115661865 GCAGCACACCAACCTGGCACAGG - Intronic
1075924200 10:126236890-126236912 GGAGCCATCCACCCTGGGCATGG + Intronic
1078888871 11:15535366-15535388 GGAGCCAACACTCCTGGCCAAGG - Intergenic
1080231228 11:30018698-30018720 GGCGCCAACCAACCAGCCCAAGG - Intergenic
1080603563 11:33844586-33844608 GGGGCCCAACAGCCTTGCCAAGG - Intergenic
1081889514 11:46529126-46529148 GGAACCCACCACTCTGTCCAAGG + Intronic
1083170427 11:60921143-60921165 GGAGCCACCACACCTGGCCATGG - Intronic
1083708654 11:64534018-64534040 CTCGCCCCCCAACCTGGCCAAGG - Intergenic
1084034094 11:66497504-66497526 GGTCCCCACCAACCTCTCCAGGG + Intronic
1084064605 11:66696429-66696451 GGAGACCACCACCCAAGCCAAGG - Exonic
1084311190 11:68317264-68317286 GGACCCCACCAGCATGGGCAAGG - Intronic
1084502496 11:69543170-69543192 GGGACCCACCCACCTGGTCATGG + Intergenic
1086059858 11:82689576-82689598 GCAGCCTATCAAGCTGGCCAGGG + Intergenic
1088146402 11:106685621-106685643 GGAGCCCATCAACATTGCTAAGG + Intronic
1089384498 11:118058986-118059008 GGAGGCCTCCCACCAGGCCAGGG + Intergenic
1090824629 11:130375752-130375774 GGAGTTCACCATCTTGGCCAGGG - Intergenic
1091217139 11:133909024-133909046 TGAGCCCAGCAACCTCGCCCCGG + Exonic
1092008295 12:5087940-5087962 GGAGCACAGCAACCTGTGCAGGG + Intergenic
1093123681 12:15302963-15302985 GCAGCCCACCAACGTGGCACAGG + Intronic
1095048607 12:37536270-37536292 GGAGTCCTCCCACCTGACCACGG - Intergenic
1095979564 12:47963731-47963753 TGAGCCCACCAAAGTGGCCCAGG - Intronic
1096463441 12:51835398-51835420 GCAGCCCAGCAACCTGGGGAAGG + Intergenic
1098070351 12:66667910-66667932 GGAGCCACCCTTCCTGGCCATGG - Intronic
1101266921 12:103098270-103098292 GGAGCTAACCAATCTGCCCATGG - Intergenic
1101405234 12:104422747-104422769 GGACCCCACCCTCTTGGCCAAGG - Intergenic
1101513125 12:105410405-105410427 AGAGCCCTCCAACCTTGCCCTGG - Intergenic
1103917995 12:124385835-124385857 GGAGCCCACCATCCGGGCGATGG + Exonic
1104436160 12:128758371-128758393 AGACCCCACCCACATGGCCAGGG - Intergenic
1106133513 13:26958284-26958306 GGAGCCCACCCCCCTGCCCATGG - Intergenic
1108932260 13:55839918-55839940 GGAGCCCACCTACCTGAGCTGGG + Intergenic
1110499068 13:76204823-76204845 GGAGCCCACCAGCAAGGACAAGG - Intergenic
1118480636 14:66161766-66161788 GGATCCCACCAAGTGGGCCACGG - Intergenic
1120718439 14:87865261-87865283 GGAGCCCAGCTACCTGTCAATGG + Intronic
1122077709 14:99246486-99246508 GGAGCCTCCCGACCCGGCCAGGG + Intronic
1122375018 14:101251702-101251724 GGAGCCCACCCCACTGGCCTTGG + Intergenic
1122786963 14:104168360-104168382 TGAGCCCTCCAACCTCTCCAGGG + Intronic
1122843360 14:104477316-104477338 GGAGCCCAGGACCCTGGCCCAGG - Intronic
1123017919 14:105384362-105384384 GGAGCCTAGGTACCTGGCCACGG - Exonic
1123456411 15:20430355-20430377 GGAGGCCTCCCACCTGTCCAAGG + Intergenic
1123661654 15:22570002-22570024 GGAGGCCTCCCACCTGTCCAAGG - Intergenic
1124262548 15:28205507-28205529 GGAGGCCTCCCACCTGTCCAAGG + Intronic
1124315453 15:28664235-28664257 GGAGGCCTCCCACCTGTCCAAGG - Intergenic
1125163860 15:36679734-36679756 GGAACCCACCAACCTTTTCAAGG + Intronic
1125730961 15:41892684-41892706 GGAGAGCACCCAGCTGGCCATGG - Intronic
1127875210 15:63106132-63106154 GGAGCCAACCAAGCAAGCCATGG + Intergenic
1128513318 15:68326869-68326891 GAAGCCCCCCAGGCTGGCCAGGG + Intronic
1129002407 15:72345688-72345710 GGAGCCATCCAACCTGGCTGTGG - Intronic
1131540012 15:93268062-93268084 GCAGCCCACCAACGTGGCTCAGG + Intergenic
1132574150 16:657000-657022 CCAGCCAACCAGCCTGGCCATGG - Intronic
1132843362 16:1989370-1989392 GGAGCACCACCACCTGGCCACGG + Intergenic
1132884280 16:2175726-2175748 GCAGCCCACCCACCCAGCCAGGG - Intronic
1136277393 16:29187051-29187073 CGGCCCCACCAACCTGCCCAGGG - Intergenic
1137796015 16:51220810-51220832 GCAGCTCACAAACCTGACCAAGG - Intergenic
1139403986 16:66703901-66703923 GGAACCCAGGGACCTGGCCAAGG - Intergenic
1139628254 16:68209449-68209471 GTAGACCACCACCATGGCCACGG + Intronic
1139993748 16:70961230-70961252 GGGGCCCATCAACATAGCCAGGG + Intronic
1140828389 16:78728354-78728376 GGAGCCACCACACCTGGCCATGG + Intronic
1141488920 16:84358869-84358891 GGCACACACCAACCTTGCCAGGG - Intergenic
1141776587 16:86127187-86127209 GGCGGCCACCAACCTGGAAAGGG + Intergenic
1141887395 16:86901906-86901928 GGAGCCCACCCACCTGCAGAGGG - Intergenic
1142108767 16:88319904-88319926 GGAGCCCACCATTCTGGCTTTGG - Intergenic
1142179106 16:88658734-88658756 GAAGCCCACCGGCCTGGCCCTGG - Intronic
1142248816 16:88981840-88981862 GGGGCCCACCAAAGTGGCCCTGG + Intergenic
1142432592 16:90038013-90038035 AGAACCCAGAAACCTGGCCAAGG - Intronic
1142614373 17:1126129-1126151 GGAGCCCACCCACCTTGGGAGGG + Intronic
1143854172 17:9836271-9836293 GGAGCCCACCTTCCTGGCACTGG - Intronic
1144586035 17:16488354-16488376 GGATTCCATCTACCTGGCCAGGG - Intronic
1144703488 17:17353075-17353097 GGAGCCCTCCAGGCTGGCCTCGG + Intergenic
1144820071 17:18066539-18066561 GTAGCCCACAAACATGGCTAGGG + Exonic
1144899632 17:18572769-18572791 GCAGCCTATCAAGCTGGCCAGGG + Intergenic
1146257271 17:31398849-31398871 GGAGCCCAGGAACCTGGGAACGG + Intronic
1146648246 17:34589772-34589794 GCAGCCCACCCTCCTAGCCAAGG + Intronic
1146677754 17:34785182-34785204 GGGGACCACCATCCTGGCCTGGG + Intergenic
1147340717 17:39751899-39751921 GGAGCCCACCTCCCTGGGCGGGG + Intergenic
1147952296 17:44113978-44114000 GGAGCCCATCAGCATGGCCTGGG + Intronic
1150139608 17:62716990-62717012 GGAGGCCACCAGCCTGGCCGTGG - Intronic
1151646555 17:75436420-75436442 TGACACCACCAACCTGGCAAGGG + Intergenic
1152586258 17:81190760-81190782 CGAGCGCAGCAACCTGGCCCAGG - Exonic
1152649289 17:81484482-81484504 GGAGGCCGCCATCCCGGCCACGG - Intergenic
1152783317 17:82235990-82236012 GGAACCAACCCTCCTGGCCATGG + Exonic
1153514408 18:5891103-5891125 GGAGCCCCCGAGCCTGGCCGAGG - Exonic
1155026729 18:21947333-21947355 GGAACCCACCAGTCTGGGCATGG - Intergenic
1157623106 18:49027277-49027299 GGGGCCCACCCGCCTGGCCTGGG - Intergenic
1160562873 18:79770586-79770608 GGAGCCCTGCAGCCTGGCCTCGG + Intergenic
1160567713 18:79797759-79797781 GGAGCCCACCCAGCTGCCCTTGG - Intergenic
1160801488 19:972096-972118 GGAGCCCGCCGGCCTGGGCAGGG + Exonic
1161068625 19:2249886-2249908 GGTGCCCACCTTCCAGGCCACGG - Intronic
1161104176 19:2435000-2435022 GGAGCAGACCTACCAGGCCAAGG - Exonic
1161150008 19:2702618-2702640 GGCGCCCGCGAACCGGGCCAGGG - Intronic
1161241946 19:3227688-3227710 GGAGCCCACCTCCATGGCGATGG - Intronic
1162067824 19:8136778-8136800 GGATCCCTCCAACCTGGGCCTGG + Intronic
1162067855 19:8136865-8136887 GGATCCCTCCAACCTGGGCCTGG + Intronic
1162067872 19:8136908-8136930 GGATCCCTCCAACCTGGGCCTGG + Intronic
1162069942 19:8147528-8147550 TGAGCCCCCCACCCTAGCCATGG + Intronic
1162097860 19:8321548-8321570 GCAGCCTATCAAGCTGGCCAGGG + Exonic
1162489099 19:10981260-10981282 GAAGCCCAGCAACGTGGGCACGG - Intronic
1163273122 19:16266237-16266259 AGAGGCCACCAACCTGGACAGGG + Intergenic
1164307104 19:24013448-24013470 GCAGCACACCAACATGGCAAAGG - Intergenic
1165114941 19:33523021-33523043 GGCTCCCACCAGCCTGGCCATGG - Intergenic
1165420601 19:35720229-35720251 GGAGCCCACCACCTCGGCCGCGG - Exonic
1165438791 19:35812184-35812206 GGAGCCCCCCAGCCTGGCTGAGG - Exonic
1166095212 19:40534169-40534191 GGAGAGCACCACCCAGGCCAAGG + Exonic
1166304896 19:41932162-41932184 GGAGCCAAGCAGCCTGGCCGAGG + Intergenic
1166543825 19:43622727-43622749 GGAGCCCAGGAACCTGGGGAAGG + Exonic
1166739088 19:45103400-45103422 GGAGCCCGCCCACCTAACCAGGG - Intronic
1167002839 19:46756088-46756110 GGTGCCCACCGGCCGGGCCAGGG - Exonic
1167706867 19:51086327-51086349 AGGGCCCAGCAACCTGGCCACGG - Intergenic
1167749759 19:51372497-51372519 GGAGCCCCCCAGCAGGGCCAGGG + Exonic
926027323 2:9556179-9556201 GGGGCCCAGCGACCTGCCCAGGG + Intergenic
927184148 2:20470069-20470091 GGTGCCCACCAACCAAGCCAGGG - Intergenic
927436268 2:23069165-23069187 GGAGCCCAACAACCAGCCCAGGG + Intergenic
927633403 2:24793550-24793572 TCAGCCCGCCACCCTGGCCACGG - Intronic
927959680 2:27233374-27233396 GCTGCCCAACAACATGGCCATGG + Exonic
928115084 2:28540396-28540418 GGAGACCACCCGGCTGGCCAAGG + Exonic
932802598 2:74754780-74754802 GCAGCCTATCAAGCTGGCCAGGG - Intergenic
935162789 2:100543768-100543790 GAATCCCACAAACCTGGGCAGGG - Intergenic
936946729 2:117937716-117937738 GGGGCCCTCCTACCTGGCAAAGG - Intronic
937323544 2:120975128-120975150 GCAGCCCGCCAACCGGGGCACGG + Intronic
937336226 2:121064050-121064072 GGTGCCTACCAAGCTGCCCAGGG + Intergenic
938078578 2:128355687-128355709 GGAGCTCACCATGTTGGCCAGGG + Intergenic
938807996 2:134824661-134824683 GGATCACACAGACCTGGCCAAGG + Intergenic
939967218 2:148622269-148622291 AGAGCACATCAGCCTGGCCAAGG - Intergenic
941287582 2:163632905-163632927 TGAGCCACCCAACCTGGCCTAGG - Intronic
944826945 2:203493687-203493709 GGAGCCACCACACCTGGCCAGGG - Intronic
946239343 2:218344498-218344520 GGAGCCCGAGAACCTGGCCCGGG + Exonic
947528666 2:230894808-230894830 AGGGCCCACCACCCTGCCCAAGG - Intergenic
947573741 2:231256114-231256136 GCAGCCTATCAAGCTGGCCAGGG + Intronic
948379456 2:237542400-237542422 GGGGACCACCAACATGGGCATGG + Intronic
949013067 2:241692975-241692997 TGAGCCAACGCACCTGGCCAAGG - Intergenic
1169311657 20:4547469-4547491 GGAGGCCAGCAAGGTGGCCAAGG - Intergenic
1170127880 20:12985899-12985921 GGAGCTTTTCAACCTGGCCATGG + Intergenic
1171543131 20:25979747-25979769 GGAGTCCTCCCACCTGACCATGG - Intergenic
1171981435 20:31632003-31632025 GGAGGCGTCCAACCTGGCAAAGG - Intergenic
1173218985 20:41115801-41115823 TAAGCCCACCAACCTGGGCCAGG + Intronic
1173531341 20:43772028-43772050 GGAGGCCACCCACCAAGCCAGGG - Intergenic
1173711019 20:45155846-45155868 GGTGCCCTGCATCCTGGCCATGG + Intergenic
1174097940 20:48104339-48104361 GGAGCCAACAGCCCTGGCCACGG + Intergenic
1175210995 20:57354761-57354783 TTAGCCCACCAACCTTGCCGGGG + Exonic
1175424655 20:58855690-58855712 GGACCCCACCAGCCTAGCCAGGG - Intronic
1175846810 20:62064103-62064125 TGAGCCTACCAACCCGGGCAGGG + Intronic
1176195507 20:63834970-63834992 GCAGCTCCCCAACCTCGCCAGGG + Intergenic
1177037528 21:16061377-16061399 AGAGCCCGCCCACCTGGGCACGG - Intergenic
1178082662 21:29080897-29080919 TGAGCTCACAAGCCTGGCCATGG - Intronic
1179273119 21:39866713-39866735 GGAGACCTTCAACCAGGCCAGGG + Intergenic
1179899125 21:44379754-44379776 GGAGCCCACCCCCCTGGTCAAGG - Intronic
1181337177 22:22145769-22145791 GGAGCCACCACACCTGGCCAAGG + Intergenic
1182299155 22:29328390-29328412 GGACCCTGCCAACCTGGCCTGGG - Exonic
1182592935 22:31396312-31396334 TGAGCCACCAAACCTGGCCAGGG + Intergenic
1182764360 22:32747989-32748011 AGAGTCCACCAGCCTGGACATGG + Intronic
1183221519 22:36516882-36516904 GGGCCCCAGGAACCTGGCCAGGG - Intronic
1183469622 22:37998506-37998528 GGACCACCCCAACCTGCCCAGGG - Intronic
1184150056 22:42632558-42632580 GGGGCCCACCAACCTCTCCCAGG + Intronic
1184271534 22:43387282-43387304 GGAGCCCTCCCAGCTGCCCATGG + Intergenic
1184524190 22:45012018-45012040 GGAGGCCACCACCCTGACCCGGG - Intergenic
1185068685 22:48644636-48644658 CCAGCCCAGCACCCTGGCCAGGG - Intronic
950098699 3:10344626-10344648 GGGGCTGACCAGCCTGGCCAGGG - Intronic
953687158 3:45087011-45087033 GGAACCCATCCTCCTGGCCAGGG - Intronic
954677614 3:52324467-52324489 GGTGGCCTCCCACCTGGCCAGGG + Intronic
961115380 3:124324685-124324707 AGACCCTACCAACCTGGCCCAGG + Intronic
961275971 3:125727079-125727101 TGAGCCACCAAACCTGGCCAAGG - Intergenic
961662850 3:128479401-128479423 GGAGCCCACAAGACAGGCCAGGG + Intergenic
965013131 3:163122823-163122845 GCAGCACACCAACATGGCCCAGG + Intergenic
967708536 3:192679815-192679837 GGAGCCAGCTAACCAGGCCATGG + Intronic
968480277 4:830194-830216 GCAGCCCACCCGCCAGGCCAGGG + Intergenic
968541296 4:1169664-1169686 GGAGCCCACCAACCTGGCCATGG - Intronic
968849623 4:3070013-3070035 GGTGCACACCAGCCTGGGCAGGG - Intergenic
969242707 4:5911327-5911349 GGAGCCCACCAGCTGTGCCAGGG + Intronic
969700726 4:8766223-8766245 CAAGGCCACCAACCTGGCCCAGG + Intergenic
972879090 4:43401367-43401389 TGAGCCACCCCACCTGGCCAAGG - Intergenic
974340165 4:60604140-60604162 GGAACCCCCAACCCTGGCCAAGG - Intergenic
983722056 4:170867473-170867495 GGAGGCCAACAAACTGGACATGG + Intergenic
985671657 5:1209987-1210009 GAAGCCCACCCACCTGTCCTGGG + Intronic
988046595 5:25963349-25963371 GGTGTGCACCAACCTGGCTAAGG - Intergenic
990710888 5:58578848-58578870 GGAGCACACCAACATGGCACAGG + Intergenic
995047822 5:107670763-107670785 GGCGCCCACCAAGCTGGGGAGGG + Exonic
995356770 5:111246686-111246708 AGAATCCACCATCCTGGCCAGGG + Intronic
996366315 5:122705070-122705092 GCTCCACACCAACCTGGCCAGGG + Intergenic
998094131 5:139387844-139387866 GAAGCCCACCAACAAGGCCGAGG - Exonic
999859783 5:155633311-155633333 GGAGTCCATCCTCCTGGCCAGGG + Intergenic
1001966296 5:175912061-175912083 GGAGGCCAGCAACTTGCCCAGGG - Intergenic
1002101974 5:176862234-176862256 GCAGCTCACCTGCCTGGCCAGGG + Intronic
1002250651 5:177927142-177927164 GGAGGCCAGCAACTTGCCCAGGG + Intergenic
1002382634 5:178841255-178841277 GGTGACCCCCACCCTGGCCAGGG + Intergenic
1002789666 6:427890-427912 GCAGCCCACCACACTGGCCTTGG + Intergenic
1002823956 6:755799-755821 GAAGTCCCCCTACCTGGCCACGG + Intergenic
1002867112 6:1131259-1131281 GGAGGCCAGAGACCTGGCCAAGG + Intergenic
1003117919 6:3295555-3295577 GGAGCCCAGCCAGCCGGCCAGGG + Intronic
1004090440 6:12494852-12494874 GGAGGCCAGCACCCTGGCCCTGG + Intergenic
1005070880 6:21861253-21861275 GGAGCCCCCAAGCATGGCCATGG - Intergenic
1006411817 6:33878233-33878255 GGAGCACCCCACCCTGGCCAGGG - Intergenic
1010169865 6:72961891-72961913 TGAGCCAACCCACCTGGCCTTGG - Intronic
1011824052 6:91285851-91285873 GGAGACCACAGACTTGGCCAAGG - Intergenic
1011984428 6:93424839-93424861 GGAACCCAGCAACCTAGCTATGG + Intergenic
1015123403 6:129725569-129725591 GGAGCCCAAAAACCAAGCCAAGG - Intergenic
1017791665 6:157805153-157805175 GCAGTCCCCCAACCTAGCCAAGG - Intronic
1017905999 6:158757871-158757893 GGAGCCCCACATCCTAGCCAGGG - Intronic
1019257949 7:63599-63621 GGAGCCTGCCTTCCTGGCCATGG - Intergenic
1019289306 7:242556-242578 GGCCCCCTCCATCCTGGCCAGGG + Intronic
1019546735 7:1581138-1581160 GGAGCCCCCAGACCTGGCCCTGG - Intergenic
1019648156 7:2141926-2141948 AGAGGCCACCAGCCAGGCCAGGG + Intronic
1019932470 7:4233388-4233410 GGAGCCCAGCAACCCCTCCACGG + Exonic
1022712145 7:32861999-32862021 GCAGCTCACCAACCTGTTCAAGG - Intergenic
1023891949 7:44399138-44399160 GGTGCCCAGCACCCTGTCCATGG + Intronic
1024061063 7:45699113-45699135 TGAGCCCAGCAAGCTGGCTAAGG - Intronic
1024965610 7:55019958-55019980 GGCGCCCGCCAGCCTGGCCCCGG + Intronic
1025294523 7:57764848-57764870 GGAGTCCTCCCACCTGACCATGG - Intergenic
1026322209 7:69277727-69277749 GGAGCCCAACAAACTTGCCCAGG - Intergenic
1026620046 7:71942276-71942298 GCAGCCTATCAAGCTGGCCAGGG + Intronic
1033561414 7:142535784-142535806 GGAGACCAGCAACCTGAGCAGGG + Intergenic
1034443646 7:151100944-151100966 GGCACCCACCCACCAGGCCAGGG - Intronic
1034922446 7:155095159-155095181 GGAGCACAGCATCCTGGCCTGGG + Intergenic
1037425059 8:18746481-18746503 GGGGCACACCAGCGTGGCCAAGG + Intronic
1037550823 8:19969682-19969704 GCAGCACACCAACATGGCCCAGG - Intergenic
1037811627 8:22089862-22089884 GGGGCCCACCAGCCTGCCCCGGG - Intronic
1038763011 8:30402082-30402104 TGAGCCACCCCACCTGGCCACGG - Intronic
1039946998 8:42138795-42138817 GGAGCCACCGAGCCTGGCCATGG - Intergenic
1041285195 8:56253174-56253196 GGAGCCCACTAAGGTGGCCCTGG - Intergenic
1043832798 8:85010198-85010220 GGAGCACATCAACCTGTCAAAGG + Intergenic
1044472292 8:92583907-92583929 GGACCCCACAAACATGGCCTGGG - Intergenic
1048976214 8:139674444-139674466 GGGGCCCTCCCACCTGGCCCTGG - Intronic
1049191003 8:141287509-141287531 GAAGCCCAGCGTCCTGGCCATGG - Intronic
1049525207 8:143121934-143121956 AGAGCCCAGCAACCTGGCACAGG + Intergenic
1049573641 8:143380817-143380839 GAAGGCCCCCACCCTGGCCAGGG - Intronic
1049803948 8:144530556-144530578 GGATGTCAGCAACCTGGCCATGG - Exonic
1051348213 9:16171796-16171818 CCAGCCCACCCACGTGGCCATGG - Intergenic
1051668665 9:19488925-19488947 GGAGGCCAACAAGCTGGCCACGG - Intergenic
1054161897 9:61679451-61679473 GGAGGCCTCCCACCTGACCACGG + Intergenic
1056954904 9:91074035-91074057 GCATTCCACCAATCTGGCCATGG - Intergenic
1057167524 9:92940624-92940646 GGAGACCACAGGCCTGGCCAAGG - Intergenic
1057187097 9:93063036-93063058 GAGGCCCACAAACCTGCCCAAGG - Intronic
1057525085 9:95791974-95791996 GAAACCCACCCACCTGGCCCTGG + Intergenic
1057819652 9:98321370-98321392 AGAGCCCAGCAACCAGGCCTGGG - Intronic
1058670865 9:107359481-107359503 TGAGGTCACCGACCTGGCCATGG + Intergenic
1058713004 9:107697345-107697367 TGAGCCCATCACCCAGGCCAGGG - Intergenic
1059250802 9:112886510-112886532 GGAGCCCACAAACATGTCCATGG + Exonic
1060112033 9:120913387-120913409 GGAGGCCTCCCACCTGGCCCTGG - Exonic
1061131411 9:128710453-128710475 GGAGCCCTCTCACCTGGCCTTGG + Intronic
1061277259 9:129576675-129576697 GGAGGGCACCCACCTGGGCAGGG - Intergenic
1061290141 9:129646083-129646105 GGAGCCCACCAGCCACGTCAAGG - Intergenic
1061324136 9:129852545-129852567 GGAGTCCCCCATCCTGGCCTGGG - Exonic
1061482468 9:130903739-130903761 AGACTCCACCATCCTGGCCAGGG + Exonic
1061993032 9:134170391-134170413 CCAGCCCACCACCCAGGCCAAGG - Intergenic
1062103632 9:134740957-134740979 GGAGCCCACCGGCCTCCCCAGGG + Intronic
1062273834 9:135721484-135721506 GGGCCCCACCGGCCTGGCCAAGG - Intronic
1062358401 9:136175949-136175971 GGAGCCCACATTCCTGCCCAGGG - Intergenic
1062368769 9:136225725-136225747 AGAGCCCACACACCTGGCAACGG + Intronic
1062534721 9:137016427-137016449 GGAGCCCACCCACCTGCCTCTGG - Exonic
1062582341 9:137234131-137234153 GGAGCTCACGGACCTGGCCGTGG + Exonic
1203787124 EBV:134284-134306 CGAGACCGCCAACCTGGCCGAGG + Intergenic
1186846902 X:13540004-13540026 GGAGACTACCCACCTGGCCCAGG + Intergenic
1187570410 X:20495119-20495141 AGAGCCCAGCAAGCTGGCCTAGG - Intergenic
1189015593 X:37093321-37093343 TGAGCCACCCCACCTGGCCACGG - Intergenic
1193736138 X:85159296-85159318 GGTCCCCACCCTCCTGGCCATGG + Intergenic
1196065312 X:111457862-111457884 CTATCCCACAAACCTGGCCATGG - Intergenic
1198641456 X:138760500-138760522 GGAACCCACCAAGGTGGGCAGGG + Intronic
1199657094 X:150006768-150006790 TGGGCCCACAAACCTGGCCCAGG - Intergenic
1199900611 X:152168479-152168501 CTATCCCATCAACCTGGCCAAGG - Exonic