ID: 968541297

View in Genome Browser
Species Human (GRCh38)
Location 4:1169670-1169692
Sequence GGAACTGGAGCCCACCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541297_968541304 12 Left 968541297 4:1169670-1169692 CCAGGTTGGTGGGCTCCAGTTCC 0: 1
1: 0
2: 1
3: 21
4: 188
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
968541297_968541303 11 Left 968541297 4:1169670-1169692 CCAGGTTGGTGGGCTCCAGTTCC 0: 1
1: 0
2: 1
3: 21
4: 188
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541297_968541305 13 Left 968541297 4:1169670-1169692 CCAGGTTGGTGGGCTCCAGTTCC 0: 1
1: 0
2: 1
3: 21
4: 188
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541297 Original CRISPR GGAACTGGAGCCCACCAACC TGG (reversed) Intronic
901493902 1:9610572-9610594 GGAGCTGGAGGCCACCGAGCCGG - Exonic
901494306 1:9612638-9612660 GGAACAGGAGCACCCCATCCAGG - Intronic
902163738 1:14552952-14552974 GCAACTGCAGCCCATCAAACTGG + Intergenic
902388088 1:16087664-16087686 GGGAATGGAGCCCATCAACATGG + Intergenic
903913693 1:26747634-26747656 GGAGCTGGAGACCACCACCCTGG + Intronic
903995836 1:27305052-27305074 GGAAAAGGAGACCACCAACCTGG + Exonic
907126418 1:52055046-52055068 GAAACTGAAGCCCAGCAAACAGG + Exonic
907401194 1:54226002-54226024 GGAACTCCAGCCCCCCAAGCCGG + Intronic
910670094 1:89763621-89763643 GGAACTGCAGCTCAGCAACAGGG - Intronic
911358756 1:96851444-96851466 GGAACTGGAGCCCAAGAGGCTGG + Intergenic
911710304 1:101064153-101064175 GGAACTGGAGCCCAGGAATCTGG - Intergenic
912461284 1:109833394-109833416 GGAAATGGAACCCAGAAACCAGG + Intergenic
912497907 1:110103153-110103175 GGAAGAAGAGCCCTCCAACCAGG - Intergenic
912681775 1:111733630-111733652 GGAACCAGATCCCACCATCCTGG + Intronic
915272191 1:154761256-154761278 GGAGCTGCAGACCACCAGCCAGG + Intronic
916572571 1:166040380-166040402 GGCACTGGGGCCCTCCCACCTGG + Intergenic
918586533 1:186194618-186194640 GGAACTGAAACCCACAAACATGG - Intergenic
920299382 1:204978987-204979009 GGACCTGGAGCTGACCGACCTGG + Exonic
920933209 1:210407976-210407998 GGTCCTGGAGCCCACCCTCCAGG + Intronic
923403617 1:233639059-233639081 AGGACTGGAGCCCATCAGCCAGG - Intronic
1064323466 10:14327735-14327757 AGAACTGCAATCCACCAACCTGG + Intronic
1064791235 10:18959682-18959704 TGAACAAGGGCCCACCAACCAGG + Intergenic
1069331616 10:67300100-67300122 GGAGGTGGGGCCCAGCAACCTGG + Intronic
1069686778 10:70323881-70323903 GGCGCTGGAGACCATCAACCTGG - Exonic
1070327765 10:75399531-75399553 GGCACTTGACCCCACCAAGCCGG - Exonic
1075716655 10:124559534-124559556 GGAAATGGAGGTCACCACCCTGG + Intronic
1076075729 10:127532464-127532486 GGAAGTTGGGTCCACCAACCCGG - Intergenic
1077134951 11:993859-993881 GGAGGTGAAGCCCACCATCCAGG + Exonic
1077518368 11:3016077-3016099 GCCACTGGAGCCCAACAACAAGG + Intronic
1078101013 11:8330329-8330351 GAAACTGTAGCCCACAGACCAGG - Intergenic
1078761725 11:14257112-14257134 GGATCTGGAGCCAGACAACCTGG + Intronic
1079802799 11:24892037-24892059 GGAACAGCAGCCAACCAGCCTGG - Intronic
1082834198 11:57639876-57639898 GGAACTGGATCACACCAACAGGG - Intergenic
1083089125 11:60181631-60181653 GAAACCCGAACCCACCAACCAGG - Exonic
1083103506 11:60334970-60334992 GAAACCCGAACCCACCAACCAGG + Exonic
1083506784 11:63165327-63165349 AGAACTGGAGCACACCAACCTGG + Intronic
1083614183 11:64018315-64018337 GGAACTGGGTCCCAGCCACCAGG - Intronic
1083793683 11:65002174-65002196 GGAATTGGAGTCCATCTACCTGG - Intergenic
1084008432 11:66335084-66335106 GGACCTAGGGCCCACCAAGCGGG - Exonic
1085093550 11:73739846-73739868 GGAGATGGAGACCACCACCCTGG + Intronic
1087655925 11:100922892-100922914 GGAACTGAAGACCACCACTCAGG + Intronic
1088620015 11:111672128-111672150 GGAAGTGGACCCCAACATCCAGG - Intronic
1089706161 11:120279491-120279513 GCATCTGCAGCCCTCCAACCTGG - Intronic
1093261283 12:16940740-16940762 AGGACTGGAGCACACCATCCAGG - Intergenic
1097086031 12:56469124-56469146 GGGATTGGAGCCCACCAAGGTGG + Exonic
1101990517 12:109480439-109480461 GGAGTTTGAGACCACCAACCTGG + Intronic
1102616849 12:114162199-114162221 GGAAATGGAGACCAGCAAACAGG - Intergenic
1103510120 12:121467856-121467878 GGACCTGAAGCGCACGAACCCGG + Intronic
1104720748 12:131043860-131043882 GGGACTGAAACCCACCACCCTGG + Intronic
1105486018 13:20833607-20833629 GGATGTGGAACCCACAAACCTGG + Intronic
1110145603 13:72186814-72186836 GCCACTGGAGCCCAACTACCTGG + Intergenic
1111396394 13:87673078-87673100 CGGACTGGAGCCCAGCACCCAGG - Intronic
1112207897 13:97343597-97343619 GGATCAGGAGCCCAGCAACCAGG + Intronic
1112338957 13:98537082-98537104 GGAGCTGAAGGCCACCATCCTGG - Intronic
1113466929 13:110519627-110519649 CGACCTGGACTCCACCAACCAGG + Intergenic
1113524031 13:110959817-110959839 GGAAAGGGAACCCACCAGCCTGG + Intergenic
1113781012 13:112977394-112977416 GGAAGTGGCCCCCACCAGCCAGG + Intronic
1115912336 14:38270195-38270217 GGATATGGATCCCACCACCCAGG - Intergenic
1118784409 14:69034250-69034272 GGAACTGGAGTCCAACGCCCTGG - Intergenic
1118823186 14:69358319-69358341 GGAACTGCAGTCCACCCACGGGG - Intergenic
1119223742 14:72928782-72928804 TGGACTGGAGCCCAACAACCGGG - Intronic
1119619244 14:76119228-76119250 GGAAAGGGACCCCACCACCCAGG + Intergenic
1121629569 14:95412508-95412530 GGCACTTCTGCCCACCAACCAGG + Intronic
1121685810 14:95834181-95834203 GGCACAGGATCCCACCAGCCTGG + Intergenic
1122516475 14:102312418-102312440 GGAACTGGAAGCCACGAACTAGG - Intergenic
1125355893 15:38817114-38817136 GTAACTGGAGACCAGCAAACAGG - Intergenic
1127311418 15:57754975-57754997 GGAACTGGAGCCTAGCATTCAGG + Intronic
1129666281 15:77581316-77581338 AGAACAAAAGCCCACCAACCCGG + Intergenic
1133224200 16:4332848-4332870 AGAAGTGGTGCCCACCACCCTGG - Intronic
1134207498 16:12250020-12250042 GGCACTGGAGCTCCCCAACCCGG - Intronic
1141719274 16:85746674-85746696 GGGATTGGAGCCCACTCACCTGG - Intronic
1142327445 16:89425291-89425313 GGCACTGGAGCCAGCCAGCCTGG - Intronic
1142356758 16:89605007-89605029 GGCAATGCATCCCACCAACCTGG - Intergenic
1142717631 17:1755641-1755663 GGAGCTGGTGCCCGCCAGCCGGG + Intergenic
1143115623 17:4580377-4580399 AGGACTGGACCCCACCACCCTGG - Intergenic
1144581843 17:16463585-16463607 GGCACTGGACCCCAGCCACCTGG - Intronic
1144618173 17:16796084-16796106 GCAAGTCGAGCCCATCAACCTGG + Intronic
1144894531 17:18519611-18519633 GCAAGTCGAGCCCATCAACCTGG - Intergenic
1145137694 17:20424633-20424655 GCAAGTCGAGCCCATCAACCTGG + Intergenic
1146274692 17:31509365-31509387 GGAAGTGGAGCGCAGCAACCAGG + Intronic
1148392033 17:47279722-47279744 GGGACCGGAGCCCAGCAAACTGG - Intronic
1148567368 17:48641661-48641683 GGAACTGGAGCGCAGCAGGCAGG + Intergenic
1148878693 17:50708203-50708225 GGAAAAGGAGCCAACCAAACTGG - Intergenic
1151150999 17:72086733-72086755 GGAACTGAAGTCCACCACCCTGG - Intergenic
1151664762 17:75539448-75539470 GGAGCTGGAGACGACCAGCCTGG - Intronic
1152404302 17:80087722-80087744 GGAGCTGGAGCAGAACAACCGGG + Exonic
1152580680 17:81164388-81164410 GGCTCTGGGGCCCACCTACCAGG - Intronic
1156111129 18:33728991-33729013 GGACCTGGAGGCCACTAACCTGG + Intronic
1157063666 18:44321969-44321991 GGAGGTGGACCCCAACAACCAGG - Intergenic
1157869789 18:51219321-51219343 AGAACTGGAGGCCACCAATAAGG + Intergenic
1158311294 18:56161812-56161834 GGAAGTGGAGCCCAACCCCCTGG + Intergenic
1158672981 18:59493626-59493648 GGCTCTGGAGCCCAGCAGCCTGG - Intronic
1161104177 19:2435006-2435028 GGAGCTGGAGCAGACCTACCAGG - Exonic
1161338216 19:3726055-3726077 GGCACTGGAGCGCACCAATGGGG + Intronic
1162067798 19:8136707-8136729 GGATCTAGATCCCTCCAACCTGG + Intronic
1162067804 19:8136729-8136751 GGACCTAGATCCCTCCAACCTGG + Intronic
1162067812 19:8136750-8136772 GGGCCTGGATCCCTCCAACCTGG + Intronic
1162067821 19:8136772-8136794 GGGCCTGGATCCCTCCAACCTGG + Intronic
1162067829 19:8136793-8136815 GGGCCTGGATCCCTCCAACCTGG + Intronic
1162067844 19:8136837-8136859 GGGCCTGGATCCCTCCAACCTGG + Intronic
1162067852 19:8136859-8136881 GGACCTGGATCCCTCCAACCTGG + Intronic
1162067860 19:8136880-8136902 GGGCCTGGATCCCTCCAACCTGG + Intronic
1162067869 19:8136902-8136924 GGGCCTGGATCCCTCCAACCTGG + Intronic
1162067877 19:8136923-8136945 GGGCCTGGATCCCTCCAACCTGG + Intronic
1162067892 19:8136967-8136989 GGGCCTGGATCCCTCCAACCTGG + Intronic
1162067918 19:8137055-8137077 GGACCTGGATCCCTCCAACCTGG + Intronic
1162067981 19:8137275-8137297 GGACCTGGATCCCTCCAACCTGG + Intronic
1163233926 19:16020365-16020387 GGAACTAGGGCCCACCCAACAGG - Intergenic
1163460956 19:17437186-17437208 GACTCTGGAGCCCACCAGCCTGG - Intronic
1165851616 19:38852847-38852869 GGGACTGGAGCCACCCTACCGGG + Intergenic
1166095211 19:40534163-40534185 GGAGCTGGAGAGCACCACCCAGG + Exonic
1166304894 19:41932156-41932178 GGACCTGGAGCCAAGCAGCCTGG + Intergenic
1166745604 19:45140576-45140598 GGACCTGGAGCAGACAAACCTGG + Exonic
1166861589 19:45814759-45814781 GCAACTGGACCCCACCTTCCAGG - Exonic
1167779880 19:51592225-51592247 GGCTCTGGAGCCAACCTACCTGG + Exonic
1168497335 19:56864609-56864631 GGGACGCAAGCCCACCAACCTGG + Intergenic
930232536 2:48857634-48857656 GGTACTAGAGCCCTCCAGCCTGG - Intergenic
934553872 2:95277434-95277456 GGACCTGGAGCCAGCCATCCGGG + Exonic
936513703 2:113168413-113168435 GGGAGTGGAGCCCACCTTCCAGG - Intronic
938155111 2:128929998-128930020 GGAACTGAAGCCCACTACTCAGG - Intergenic
938497392 2:131807160-131807182 GGCACTGGAGCCCAAGGACCTGG + Intergenic
940396438 2:153196761-153196783 GCCCCTGGAGCCCACCACCCTGG - Intergenic
941164296 2:162068892-162068914 GGAACTGGGGCCCACACACTAGG + Intronic
943674382 2:190702912-190702934 GGAACTGGAGTCCAAGAAGCTGG + Intergenic
1170568248 20:17618577-17618599 GGACATGGAGGCCACCTACCAGG + Exonic
1170827392 20:19808602-19808624 CAAACAGGGGCCCACCAACCAGG - Intergenic
1171053727 20:21885676-21885698 GGCACTGGAGCTTACCAACATGG + Intergenic
1171976764 20:31599975-31599997 GGAGTTGGAGACCACCAGCCTGG + Intergenic
1172386879 20:34540256-34540278 TGAACTGGAGTCCCCCCACCTGG + Intronic
1172512058 20:35507740-35507762 TGAACTGGAGCTCACCAGACGGG + Exonic
1173274480 20:41567417-41567439 GGAAAGGGAGACCACCACCCTGG + Intronic
1173467246 20:43292964-43292986 GGGAGGGGAACCCACCAACCTGG + Intergenic
1173560921 20:44004726-44004748 GGAATTGGCCACCACCAACCAGG + Intronic
1173802769 20:45905071-45905093 GGAACTGGAGCCTCCCCAACCGG - Exonic
1173822723 20:46029507-46029529 GCAACTGGCGCCCACCGCCCGGG - Intronic
1174390649 20:50216566-50216588 GGAGCTGGAGCCCCCCCATCAGG + Intergenic
1175364701 20:58444616-58444638 GGAGCTGGAGCCCAGCATGCTGG + Exonic
1175640620 20:60626888-60626910 TGAACTGGAGGACACCCACCTGG - Intergenic
1175895197 20:62332962-62332984 GGCAATGGAGCCCAGCACCCAGG - Intronic
1176038640 20:63052615-63052637 GGGACAGGAGCCCACCCACAGGG + Intergenic
1176128769 20:63487488-63487510 GGAACTCCAGCCCCCGAACCCGG - Intergenic
1178623492 21:34196927-34196949 GCAAATGGAGTCCACCAACCAGG - Intergenic
1180708656 22:17825048-17825070 GGAACTGGAGGCCAGCACCAAGG + Intronic
1181548982 22:23625460-23625482 GGAAAGGGAGCCCAACAAGCAGG - Intronic
1181570954 22:23767635-23767657 GGAGCTGCAGCCCTCCAGCCTGG - Intronic
1184339982 22:43880800-43880822 GGAGCTCGGGCCCACCCACCAGG - Exonic
1184551682 22:45207828-45207850 GGAAGTGGGGCCCCCCGACCCGG - Intronic
1185199582 22:49493483-49493505 AGAAAGGGAGCCCACCAACCCGG - Intronic
1185332137 22:50256625-50256647 GGACCTGAAGCCCGGCAACCTGG - Exonic
1185334914 22:50267153-50267175 GGACCTGAAGCCCAGCAACGTGG - Exonic
950155447 3:10718275-10718297 GGAACTGGAACCCAAGCACCTGG + Intergenic
951009704 3:17662097-17662119 GGAGTTAGAGACCACCAACCTGG - Intronic
951243417 3:20313204-20313226 GGCACTGGCGCCCACCCACCTGG - Intergenic
952034488 3:29183029-29183051 GGAACAGCAGCCAACCAGCCTGG + Intergenic
952746743 3:36788604-36788626 AGCACTGGTGCTCACCAACCTGG + Intergenic
952824362 3:37512777-37512799 CAAACTGGAGCCCACAAGCCTGG - Intronic
953028481 3:39159622-39159644 GCAAGTGGGGCCCAGCAACCTGG + Intergenic
953567222 3:44043095-44043117 GTGACTGGAGCCCACCATTCTGG + Intergenic
954416745 3:50397000-50397022 GGAGCTGGAACCCCCCAGCCAGG - Intronic
954685874 3:52369899-52369921 GTACCTGGAGCCCAGCATCCTGG + Exonic
955489715 3:59470068-59470090 TGAACTGGGGCCCACTCACCTGG + Intergenic
965677338 3:171211917-171211939 TGATTTGGAGTCCACCAACCTGG + Intronic
968541297 4:1169670-1169692 GGAACTGGAGCCCACCAACCTGG - Intronic
974079097 4:57194605-57194627 GGAACTGGAGCCACTCAAGCGGG - Intergenic
975712083 4:77170944-77170966 AGAACTGGGGTCCACCCACCCGG - Intronic
977553843 4:98468896-98468918 GGAGCTGGAGCCCAGTGACCTGG - Intergenic
979492504 4:121344259-121344281 GGAACTGGAGTCTGACAACCTGG - Intronic
985485267 5:145216-145238 GGGACAGGTGCCCACCACCCGGG - Intronic
985565917 5:617223-617245 GGAACAGAAGCCAACCAGCCAGG - Intronic
986318634 5:6609492-6609514 GGAACTAGAGCACAGAAACCTGG + Intronic
991100969 5:62792827-62792849 GAAACTGTATCTCACCAACCTGG - Intergenic
992048892 5:72925743-72925765 GGACCTGCAGCCCACCATGCCGG + Intergenic
995975838 5:118034028-118034050 GGACCTGCAGCCCACCATGCCGG + Intergenic
997202120 5:132017090-132017112 GCAACTCAAGCCCACCAACCAGG + Intergenic
998062159 5:139127259-139127281 GGAACTGATGCCCACCACACAGG + Intronic
998268087 5:140681456-140681478 GGAATTCAAGACCACCAACCTGG + Intronic
999085478 5:148885104-148885126 AGAGCTGGAGCCCATCTACCTGG + Intergenic
999190509 5:149743493-149743515 GGGACTGGAGCTCATCAAGCTGG + Intronic
1001036282 5:168299137-168299159 AGGACTGGAGCCCACCTAGCTGG + Intronic
1001333041 5:170775774-170775796 GGCTCTGGAGCCAACCAAGCAGG + Intronic
1002182892 5:177440762-177440784 GGAGCTGGAGCCTACCGACCAGG + Exonic
1002196745 5:177505206-177505228 GGAACTGGAGCCCAGGCCCCTGG - Intronic
1002428890 5:179191730-179191752 GGAAGTGGAGCCCAGAACCCCGG - Intronic
1005921185 6:30403276-30403298 TGAACTGGGGCCCACTCACCTGG + Intergenic
1006040737 6:31252476-31252498 TGAACTGGAGTCCACTCACCTGG + Intergenic
1007518299 6:42430685-42430707 GGAGATGGAGACCACCATCCTGG + Intronic
1017304206 6:152898178-152898200 GGATCTGGAGCCCAGCACCGGGG + Intergenic
1019064430 6:169284847-169284869 TGAGCTGGAGCCCTCCAGCCTGG + Intergenic
1026033440 7:66814958-66814980 GGAGTTGGAGACCACCAGCCTGG + Intergenic
1027002509 7:74663495-74663517 GGAGTTGGAGACCACCAGCCTGG - Intronic
1030850395 7:114477554-114477576 GGGAATGGATCCCACCACCCAGG - Intronic
1035369384 7:158369434-158369456 AGAACAGGACCCCCCCAACCTGG + Intronic
1035850964 8:2919020-2919042 GGAACTGGAGCCCCCCTCCCTGG - Intergenic
1038691853 8:29771554-29771576 GGAGCTTGAGCACACCAAACTGG - Intergenic
1039885492 8:41651862-41651884 GGAATTGGAGCCCACTTTCCAGG + Intergenic
1041285196 8:56253180-56253202 GGGACTGGAGCCCACTAAGGTGG - Intergenic
1045922704 8:107549990-107550012 GGGACTGGAGTCCAGCAGCCTGG - Intergenic
1049159731 8:141089539-141089561 GGAACTGGGGCCACCCGACCAGG - Intergenic
1049944486 9:580880-580902 GGACCTGCAGCCCACCATGCCGG - Intronic
1052199562 9:25761804-25761826 GGAAATGCAGCACCCCAACCAGG + Intergenic
1058957314 9:109960997-109961019 GGAACTGGAGCTCCCCAGCAGGG + Intronic
1060023693 9:120153295-120153317 GGGACTTGAACCCAGCAACCAGG - Intergenic
1061518807 9:131105192-131105214 GGAACAGGACTCCACCAGCCAGG - Intronic
1061876593 9:133547177-133547199 GGCACAGGGGCCCACCAACCAGG + Exonic
1061908582 9:133711262-133711284 AGCTCTGGAACCCACCAACCAGG - Intronic
1185677641 X:1861592-1861614 GGAACTGGCGTCCACCAGCCGGG + Intergenic
1189902367 X:45719862-45719884 GCAGCGGGATCCCACCAACCTGG - Intergenic
1195663697 X:107408392-107408414 GGAACTGGAGGCCATTATCCTGG - Intergenic
1198630948 X:138637947-138637969 GTAACTGGAATCCACCATCCTGG + Intronic
1200210124 X:154343431-154343453 GGAACTGGTGCCCAGCGTCCAGG - Intergenic
1200220728 X:154388661-154388683 GGAACTGGTGCCCAGCGTCCAGG + Intergenic