ID: 968541300

View in Genome Browser
Species Human (GRCh38)
Location 4:1169685-1169707
Sequence AGACTTTCCCGAGGAGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541300_968541303 -4 Left 968541300 4:1169685-1169707 CCAGTTCCTCCTCGGGAAAGTCT 0: 1
1: 0
2: 1
3: 8
4: 110
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541300_968541308 29 Left 968541300 4:1169685-1169707 CCAGTTCCTCCTCGGGAAAGTCT 0: 1
1: 0
2: 1
3: 8
4: 110
Right 968541308 4:1169737-1169759 GACTGTCCCACACCCATATCAGG 0: 1
1: 0
2: 1
3: 4
4: 195
968541300_968541304 -3 Left 968541300 4:1169685-1169707 CCAGTTCCTCCTCGGGAAAGTCT 0: 1
1: 0
2: 1
3: 8
4: 110
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
968541300_968541305 -2 Left 968541300 4:1169685-1169707 CCAGTTCCTCCTCGGGAAAGTCT 0: 1
1: 0
2: 1
3: 8
4: 110
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541300 Original CRISPR AGACTTTCCCGAGGAGGAAC TGG (reversed) Intronic
901759600 1:11462100-11462122 GGCCTTTGTCGAGGAGGAACGGG + Intergenic
901843456 1:11967384-11967406 AGACTTCCCCCAGGTGGAGCTGG + Intronic
902147802 1:14418303-14418325 AGACTTTCCTGGGGAGGAAATGG - Intergenic
903064840 1:20693616-20693638 AATCTTTCCCAAGGAGGAGCAGG - Intronic
904005884 1:27363012-27363034 ATCTTTTCCCTAGGAGGAACAGG - Exonic
911414640 1:97556212-97556234 AGACTTTCATGAGGAGGAAGTGG - Intronic
916595445 1:166237784-166237806 AGATTTTCCAGAGGAGAGACAGG - Intergenic
920340406 1:205272055-205272077 AGTGCTTCCAGAGGAGGAACAGG - Exonic
922356865 1:224784620-224784642 AGACTTTCCCCGGAAGGAAATGG - Intergenic
922996032 1:229962425-229962447 AAACTTACCTGAGGGGGAACTGG + Intergenic
924798248 1:247308586-247308608 AGTCTTTCCAGAGGAGGAAATGG + Exonic
1063907619 10:10797308-10797330 AGACTTCCCTGAGAAGGAAGAGG - Intergenic
1067479247 10:46584626-46584648 GGACCTTCCCCAGGAGGAAAGGG - Intronic
1067493066 10:46731906-46731928 AGACTTTCATAAGGTGGAACAGG + Intergenic
1067601597 10:47608501-47608523 AGACTTTCATAAGGTGGAACAGG - Intergenic
1067615492 10:47757175-47757197 GGACCTTCCCCAGGAGGAAAGGG + Intergenic
1069521272 10:69123882-69123904 AAACTTTCACAAAGAGGAACTGG + Exonic
1070303725 10:75225145-75225167 TGACTGGCCTGAGGAGGAACTGG + Intronic
1071460404 10:85888343-85888365 AGACTAGCACGTGGAGGAACAGG + Intronic
1071653122 10:87416082-87416104 AGACTTTCATAAGGTGGAACAGG - Intergenic
1078063990 11:8066079-8066101 AGAGTTGGCCGAGGAGGAAGGGG + Intronic
1078737585 11:14034754-14034776 AGATTTTACAGATGAGGAACTGG - Intronic
1080822678 11:35822107-35822129 AGAAGTTCTTGAGGAGGAACTGG - Intergenic
1081439557 11:43065276-43065298 ATACATTCCCTAGGAGGGACAGG + Intergenic
1081567341 11:44268207-44268229 AGACTTCCTGGAGGAGGGACAGG + Intronic
1081701787 11:45157034-45157056 AGACTTTGCCCTGGAGGCACGGG + Intronic
1081847824 11:46253362-46253384 AGACATCCCAAAGGAGGAACAGG - Intergenic
1087024736 11:93638501-93638523 AGACTGGCTCGAGGTGGAACTGG + Intergenic
1091877419 12:3947383-3947405 AGGCTTTCCCGAGGAAGTAATGG - Intergenic
1092771806 12:11903721-11903743 AGACTTTTACTAGGAGGAAGAGG - Intergenic
1096135932 12:49200551-49200573 AGACTCTCTGGTGGAGGAACTGG - Intronic
1096763638 12:53864811-53864833 AGACTTTCCAGAGGAGGAAGAGG - Intergenic
1100049580 12:90430982-90431004 AGACATTCCTGAAGAGGAAAAGG - Intergenic
1103065886 12:117897075-117897097 AGACTTGGGCGAAGAGGAACAGG - Intronic
1104264343 12:127217193-127217215 TGACTTTCCAGGGGAGGAAAAGG + Intergenic
1107171411 13:37346704-37346726 AGACTGTCCCAAGGGAGAACAGG + Intergenic
1108779080 13:53805869-53805891 AGGCTTGCCCTTGGAGGAACAGG + Intergenic
1109911532 13:68918442-68918464 AGATTTCCCAGAGGAGGAAATGG - Intergenic
1110945702 13:81412980-81413002 AGCTTTTCCCTAGGAGGAAAAGG + Intergenic
1118328683 14:64799483-64799505 AGATATCCCTGAGGAGGAACAGG - Intronic
1118675119 14:68175842-68175864 AGACTTTACTGATGAGGAAATGG - Intronic
1120871845 14:89344926-89344948 GGACTTTTCCGAAGAGGTACGGG + Intronic
1128248941 15:66151646-66151668 AGACTTCTCCCAGGAAGAACAGG + Intronic
1129520636 15:76183880-76183902 TGTCTTTCACGTGGAGGAACCGG + Intronic
1132024975 15:98397642-98397664 GGACATTCCAGTGGAGGAACGGG - Intergenic
1132706398 16:1245319-1245341 AGCCTTTCCTGAGGAAGAATGGG - Intergenic
1136513041 16:30750842-30750864 AGGCTTTCCCATGGAGGAAGTGG + Intronic
1140464241 16:75166799-75166821 GGACTTTACCCAGGAGGAATGGG + Exonic
1142940899 17:3379229-3379251 AGACTGTCCTCAGGAGAAACTGG + Intergenic
1143988938 17:10940325-10940347 AAATTTTCTTGAGGAGGAACAGG - Intergenic
1147481779 17:40772034-40772056 AGGCTGTCCGGTGGAGGAACAGG - Exonic
1148144542 17:45354666-45354688 GGACATTCCTGAGGAGGGACAGG + Intergenic
1148549272 17:48541151-48541173 AGACTTTCCCCTGGACCAACAGG - Intronic
1149697863 17:58630591-58630613 AAAATTTCCTGAGAAGGAACTGG + Intronic
1151612203 17:75183299-75183321 AGACTTACTAGAGGAGGAAGGGG + Intergenic
1152727132 17:81952936-81952958 AGACTGTCTGGAGGAGGAGCCGG - Exonic
1153984339 18:10339705-10339727 AGAGCTTCCTGAGGAGGCACCGG - Intergenic
1156668476 18:39437574-39437596 ACAATTTCCCGATGAGGCACCGG - Intergenic
1157260587 18:46173319-46173341 AGCGTTTCCCAAGGAGGAGCAGG - Intergenic
1157517573 18:48321636-48321658 AGACTTTCCCTAGGTGAAAATGG + Intronic
1160498959 18:79393191-79393213 TGATTTTCCCGAGCAGGAAGTGG + Intergenic
1160701439 19:509282-509304 AGAATCTCCCAAGGAGGAAAAGG + Intronic
1162235061 19:9302453-9302475 GGACTTTACCCAGGAGGAATGGG - Exonic
1164779684 19:30882420-30882442 AGACTTTCCTTTGAAGGAACTGG - Intergenic
1168676971 19:58285746-58285768 GGACTTTACCCAGGAGGAATGGG + Exonic
925128572 2:1478442-1478464 AGCCTTGTCCGAGGAGGCACAGG + Intronic
926747574 2:16171615-16171637 AGACTTTCCCAAGGATGCTCAGG + Intergenic
928406680 2:31020422-31020444 TGACTTTCCTGAGGGGGACCAGG - Intronic
928923460 2:36551439-36551461 AGACTTTACCGAGCACGATCAGG + Intronic
929269449 2:39957695-39957717 AGAGTTTACAGAAGAGGAACTGG - Intergenic
930099469 2:47591760-47591782 AGACTGTCAAGTGGAGGAACAGG - Intergenic
931480480 2:62634064-62634086 AAACCTTCCAGAGGAAGAACAGG + Intergenic
931808177 2:65828091-65828113 AGACTTGCCCAAAGATGAACAGG - Intergenic
931959323 2:67464790-67464812 AGACTTTAGGGAGGAGAAACAGG - Intergenic
933773983 2:85760838-85760860 CGACTTTCCAGATGAGGAAACGG + Intronic
939200863 2:139031907-139031929 ACTCTTTCCCCAGGAGGAAGTGG + Intergenic
947633975 2:231670996-231671018 AGACTATCCCAGGAAGGAACTGG + Intergenic
947866605 2:233402145-233402167 AGGCTTCCCTGAGGAGGAAACGG - Intronic
1170523847 20:17216910-17216932 AGACTTGCACCAGGAGGAACTGG - Intergenic
1170868611 20:20183875-20183897 AGAATTTCAGGGGGAGGAACGGG - Intronic
1175257785 20:57657429-57657451 CCACTTTCCAGAGGAGAAACTGG - Intronic
1175507271 20:59494826-59494848 AGAGTTCCCAGAGGAGGAAGGGG - Intergenic
1182771546 22:32800438-32800460 CCACTTTCCAGATGAGGAACCGG - Intronic
950306603 3:11919643-11919665 TGAAATTCCCCAGGAGGAACAGG + Intergenic
952538467 3:34339478-34339500 AAACTTTCCCAAGAAGTAACAGG - Intergenic
954663353 3:52237710-52237732 AGCCTTTCTCCAGGAGGAGCTGG - Intronic
954733705 3:52686882-52686904 AGACTTTCCCGCAAAGGAACAGG - Intronic
958977251 3:100682266-100682288 AGAGGGTCCCCAGGAGGAACTGG + Intronic
960066498 3:113379422-113379444 AGAATTTCAGGAGGAGGAAGAGG - Exonic
960970031 3:123132803-123132825 GGAGGTTCCCAAGGAGGAACTGG - Intronic
968541300 4:1169685-1169707 AGACTTTCCCGAGGAGGAACTGG - Intronic
968549913 4:1216837-1216859 ACCCTTCCCCGAGGAGGAGCCGG - Intronic
969467695 4:7367427-7367449 CCACTTTACAGAGGAGGAACTGG - Intronic
975353860 4:73376412-73376434 AGCCTTTCCAGAGGAAGAATAGG - Intergenic
978597312 4:110392294-110392316 GGACATTCCCCAGAAGGAACAGG + Intronic
989402119 5:41018926-41018948 AGATTTTCCAGAGGTGGAAGGGG + Exonic
994076383 5:95654959-95654981 AGTCTTAACTGAGGAGGAACGGG + Intronic
994318447 5:98361090-98361112 AGTCTTTCCCTAAGAGGCACTGG + Intergenic
998461148 5:142311165-142311187 AGGCTTTCCTGAGCAGGAAGGGG - Exonic
1001518154 5:172371798-172371820 AGACTTTCCCTAGAAGGAATGGG - Intronic
1001634682 5:173201348-173201370 TGGCTATGCCGAGGAGGAACAGG + Intergenic
1003390352 6:5708027-5708049 AGAATTCCCCCAGGTGGAACAGG + Intronic
1003631190 6:7789341-7789363 AGATTTTCTGGAGGAGGCACAGG - Intronic
1005019622 6:21405162-21405184 AGACTTTCCCAAGGATGTTCTGG - Intergenic
1005218759 6:23562348-23562370 AGACTCTCCGGAGGAGCAAGAGG + Intergenic
1007197442 6:40074908-40074930 AGACTTTCCCAATGAGAAAGTGG - Intergenic
1008024790 6:46623060-46623082 AGACTTTCCCAAGAAGGAAATGG + Intronic
1008741931 6:54619415-54619437 AGACTTTCCCAGGGAGTAAATGG - Intergenic
1014835656 6:126157383-126157405 AGGCTTTCTTGAGGAGGAAAAGG - Intergenic
1032529735 7:132610234-132610256 AGAAATTCCCCAGGAGGAGCAGG - Intronic
1034616300 7:152419903-152419925 AGACTTTACCGAAGAGAAAAAGG - Intronic
1035123484 7:156589963-156589985 AGTCTTTCCAGAGGAGGATGAGG - Intergenic
1037744649 8:21633011-21633033 AGACTTCCCTGAGGAGGACAAGG - Intergenic
1038700063 8:29841536-29841558 AGACTTTCCGGATGTGGAAATGG + Intergenic
1041930743 8:63283930-63283952 AGCCTTTCTCCAGGAGGCACTGG + Intergenic
1049494550 8:142923624-142923646 TGAGATTCCCGAGGAAGAACAGG - Intergenic
1050998929 9:12256489-12256511 ACACTTTCCCCAGGAGGTAGTGG + Intergenic
1051022884 9:12566900-12566922 AGACTTTCCGCATGAGCAACTGG - Intergenic
1185783019 X:2865565-2865587 AGACTTTCCCGTGGAGGGATTGG + Intronic
1194519656 X:94902443-94902465 ACGCTTTCCCGAGGAGTCACTGG + Intergenic