ID: 968541301

View in Genome Browser
Species Human (GRCh38)
Location 4:1169691-1169713
Sequence GACTTCAGACTTTCCCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541301_968541308 23 Left 968541301 4:1169691-1169713 CCTCCTCGGGAAAGTCTGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 968541308 4:1169737-1169759 GACTGTCCCACACCCATATCAGG 0: 1
1: 0
2: 1
3: 4
4: 195
968541301_968541303 -10 Left 968541301 4:1169691-1169713 CCTCCTCGGGAAAGTCTGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541301_968541305 -8 Left 968541301 4:1169691-1169713 CCTCCTCGGGAAAGTCTGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data
968541301_968541304 -9 Left 968541301 4:1169691-1169713 CCTCCTCGGGAAAGTCTGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541301 Original CRISPR GACTTCAGACTTTCCCGAGG AGG (reversed) Intronic
902147803 1:14418309-14418331 GGCTTGAGACTTTCCTGGGGAGG - Intergenic
902613385 1:17610110-17610132 GAATTCAGGCTTTCCAGCGGTGG + Intronic
906213393 1:44024685-44024707 GGCTTCAGCCTTTCCCCAGGAGG + Intronic
908229430 1:62088941-62088963 GTTTCCACACTTTCCCGAGGAGG + Intronic
913969523 1:143404010-143404032 GCCTTCAGTCTTTCCCAGGGAGG - Intergenic
914063900 1:144229609-144229631 GCCTTCAGTCTTTCCCAGGGAGG - Intergenic
914115250 1:144736745-144736767 GCCTTCAGTCTTTCCCAGGGAGG + Intergenic
914755966 1:150561774-150561796 GACGACAGAGTTGCCCGAGGCGG + Intergenic
1068769987 10:60810181-60810203 GCTTCCAGACTTTCCCCAGGAGG + Intergenic
1068808547 10:61228208-61228230 GAGTTCAGACTCTCCTCAGGTGG - Intergenic
1068995581 10:63199107-63199129 GCCTTAAGACTTTCACCAGGAGG + Intronic
1071346899 10:84701766-84701788 GTCTTCAGTCTTTCCCGTGAGGG - Intergenic
1071600234 10:86955405-86955427 GTCCTCAGACTTCCCTGAGGTGG - Intronic
1078740402 11:14060624-14060646 GAGATCAGAATTTCCAGAGGTGG - Intronic
1085202523 11:74710305-74710327 GGCTGAAGACTTTCCAGAGGAGG + Intronic
1087558168 11:99749009-99749031 TAATTCAGTCTTTCCAGAGGTGG + Intronic
1088255615 11:107900809-107900831 GGCTTCCGACTTTCCACAGGAGG - Intronic
1088386603 11:109265044-109265066 CTCTTCAGACTGTCCCAAGGTGG - Intergenic
1094017524 12:25880893-25880915 GACTAAAGACCTTCCAGAGGAGG + Intergenic
1117041663 14:51774260-51774282 TACTTCATAATTTCCAGAGGGGG + Intergenic
1124973179 15:34510146-34510168 GAATTCTGACTATCCCAAGGTGG - Intergenic
1125892476 15:43276723-43276745 GAGCTCAGCCTTTCCTGAGGAGG + Intronic
1128238610 15:66084536-66084558 GACTTCAGCCTCTCCAGTGGGGG - Intronic
1130474456 15:84251782-84251804 GAATTCTGACTATCCCTAGGTGG + Intergenic
1130481871 15:84365830-84365852 GAATTCTGACTATCCCTAGGTGG + Intergenic
1133545837 16:6805751-6805773 CACTTCAGACTTTACAGTGGAGG - Intronic
1134441348 16:14301510-14301532 GACTCCAGCCATTCCAGAGGAGG + Intergenic
1142230125 16:88896205-88896227 GGCCTCAGACTTTCCCTACGGGG + Intronic
1142980284 17:3667650-3667672 GACCTGAGTCTTTCCTGAGGTGG + Intronic
1144044964 17:11447222-11447244 GTCTTCACAGTTTTCCGAGGAGG + Intronic
1146012004 17:29203111-29203133 GACATCAGACTTTCTAGAGCTGG + Intergenic
1157755340 18:50212423-50212445 GACTTCTTGCTTTCCCCAGGGGG + Intergenic
1159245159 18:65796355-65796377 CACTCCTGACTTTCCCAAGGTGG + Intronic
1163420094 19:17209526-17209548 GACCTCAGACGTCCCCGGGGCGG + Intronic
925331032 2:3059216-3059238 GACTTCAGTCTTTCCTGGGAGGG + Intergenic
930729011 2:54709659-54709681 GACTTCAGACCTTCCCCGGATGG - Intergenic
933318393 2:80742158-80742180 GACTTCCCACTTTTCCGTGGAGG - Intergenic
934174214 2:89564925-89564947 GCCTTCAGTCTTTCCCAGGGAGG - Intergenic
934284530 2:91639274-91639296 GCCTTCAGTCTTTCCCAGGGAGG - Intergenic
937855881 2:126671762-126671784 GACCTCACACTTTGGCGAGGTGG + Intronic
941499367 2:166250773-166250795 GACTTCAGACTTTACCCTAGAGG + Intronic
945117985 2:206428091-206428113 GATTTCAGACTCTCCCTAGCTGG + Intergenic
1169057336 20:2634539-2634561 GCTTTCAGAATTTCCCCAGGAGG - Intronic
1172592242 20:36125996-36126018 GGCTGCAGACTTTCTCGATGGGG + Intronic
1172633859 20:36396122-36396144 GGCTCCAGCCTTTCCGGAGGTGG - Intronic
1176272382 20:64242652-64242674 GAGTTCAGACATTCTGGAGGGGG + Intergenic
1178321460 21:31609266-31609288 GACTTCAGGCTGACCCCAGGGGG + Intergenic
1179308077 21:40172973-40172995 GACTTCAGCCTTTCCCCATCTGG - Intronic
1179967620 21:44816669-44816691 GACTACAGACCCTCCCGAGAAGG + Intronic
950552567 3:13675520-13675542 GAGTTCAGACTTTCCCTTGCAGG - Intergenic
953458431 3:43062406-43062428 GACTTCAGAAGTTTCCAAGGTGG + Intergenic
961981580 3:131084797-131084819 TAAATCAGACTTTCCAGAGGTGG - Intronic
962088775 3:132220855-132220877 GACTTCAGTCTTTCTGGAGCTGG - Intronic
964130704 3:153282909-153282931 GACTACAGCCTTTCACTAGGAGG - Intergenic
964160645 3:153641083-153641105 GAGCTCAGACTTTCCCTGGGTGG - Intergenic
966391447 3:179456987-179457009 GACTTCAGACTCTACTTAGGAGG + Intergenic
968541301 4:1169691-1169713 GACTTCAGACTTTCCCGAGGAGG - Intronic
981919533 4:150072181-150072203 GAATTCATACTTTCCAGATGAGG - Intergenic
994313797 5:98308487-98308509 CACTTCAGAATTTCCCTGGGGGG + Intergenic
1008264426 6:49406903-49406925 GACTTCTGACTTTCCTGAGCTGG + Intergenic
1011093511 6:83633520-83633542 GAGTTCAGACTTTCCTTGGGCGG + Intronic
1014717816 6:124886635-124886657 CAATTCAGACTTTCCAGGGGAGG + Intergenic
1019353387 7:565780-565802 GACTTCAGACTTGGCCCAGCTGG + Intronic
1022607243 7:31827661-31827683 GACTTCAGACTCTTCAAAGGTGG + Intronic
1026592819 7:71711359-71711381 GACTTCAGAGTCCCCAGAGGAGG + Intronic
1031882989 7:127217918-127217940 GACTTCAGACTGGCCAGAGGCGG - Intronic
1043104398 8:76089836-76089858 GAGCTCAGACTTTCCTTAGGTGG + Intergenic
1043404569 8:79917275-79917297 GATTTGAGACTTTGCAGAGGTGG + Intergenic
1061710795 9:132486432-132486454 GACTTCAGATTTTGCCCGGGAGG + Intronic
1189324362 X:40104057-40104079 GATTTCAGGCTTTCTCGCGGGGG + Intronic
1199764980 X:150934946-150934968 AACTTGAGGCTTTCCCGAGGTGG + Intergenic
1202376535 Y:24243085-24243107 GAATTCTGACTATCCCTAGGTGG - Intergenic
1202494245 Y:25427034-25427056 GAATTCTGACTATCCCTAGGTGG + Intergenic