ID: 968541303

View in Genome Browser
Species Human (GRCh38)
Location 4:1169704-1169726
Sequence GTCTGAAGTCCGCTGTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541295_968541303 18 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541297_968541303 11 Left 968541297 4:1169670-1169692 CCAGGTTGGTGGGCTCCAGTTCC 0: 1
1: 0
2: 1
3: 21
4: 188
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541301_968541303 -10 Left 968541301 4:1169691-1169713 CCTCCTCGGGAAAGTCTGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541300_968541303 -4 Left 968541300 4:1169685-1169707 CCAGTTCCTCCTCGGGAAAGTCT 0: 1
1: 0
2: 1
3: 8
4: 110
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541296_968541303 17 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541303 Original CRISPR GTCTGAAGTCCGCTGTTGTC TGG Intronic
900835298 1:4998705-4998727 GCCTGAAGTCAGGTGCTGTCAGG - Intergenic
901817145 1:11800774-11800796 CTCTGGTGCCCGCTGTTGTCAGG - Intronic
905038624 1:34933506-34933528 GTCTGCAGTCAGCTGTGGACAGG - Intergenic
909598426 1:77433433-77433455 GTCTGAAGTCAGCTTTGGTTTGG - Intronic
915798868 1:158766868-158766890 GTCTGAAGGAGGCTGTTGACAGG - Intergenic
1063661735 10:8038921-8038943 GTCTGAAGTCCACTGTGCTGAGG + Intergenic
1068402718 10:56551186-56551208 TTCTGTAATCCGCTGTTGTTTGG + Intergenic
1076456192 10:130598916-130598938 GTCTGCATTCTGCTGTTGTTGGG + Intergenic
1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG + Exonic
1094143158 12:27201626-27201648 GTCTAAAGTCCGGTGTAGTACGG + Intergenic
1101710983 12:107265994-107266016 GTCTGTATTCTGCAGTTGTCAGG - Intergenic
1103049953 12:117770437-117770459 GTCTGAAATCGGGTGTTGGCAGG - Intronic
1110060438 13:71032918-71032940 GCCTGACCTCCCCTGTTGTCAGG - Intergenic
1111588446 13:90311599-90311621 GTATGAAGGCCGATGGTGTCTGG + Intergenic
1113054094 13:106249110-106249132 GGCTGGAGTCCGCTTTTGCCAGG - Intergenic
1117503044 14:56373745-56373767 GTCTGAAGACCACTGTTGGGAGG + Intergenic
1128418234 15:67466370-67466392 GTATGAAGCCCACTGTTGTAAGG - Intronic
1128545839 15:68566993-68567015 GTCTGAGGTTCTCTGTTCTCTGG + Intergenic
1141574172 16:84953577-84953599 GTCTGATTTCCACTGTGGTCAGG - Intergenic
1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG + Intronic
1163100424 19:15092529-15092551 GACTGAACTCTGCTGCTGTCTGG + Intergenic
1165191785 19:34069759-34069781 GTCTGAAGTCCTGTGTTGTTTGG - Intergenic
1166610607 19:44190673-44190695 GTCTGAAGTCTGCCTTTGTTTGG - Intergenic
925224928 2:2175561-2175583 GTCTGAGGTGGGCTTTTGTCAGG - Intronic
926488182 2:13489741-13489763 GTCTGAAATCTGCTGTGGTTTGG - Intergenic
927317820 2:21706121-21706143 GTATCAAGTCAGCTGTGGTCTGG - Intergenic
928757505 2:34545104-34545126 GTCTGATGACCTCTGTTGTAGGG + Intergenic
936396788 2:112137788-112137810 GTCTGAAGTCCCCTGCCATCAGG - Intergenic
1169802428 20:9523768-9523790 GTCTGAAGCCAGATGTAGTCCGG + Intronic
1172714458 20:36952242-36952264 GTCTGAAGTCCCCTCCTGTGTGG - Intergenic
1172978087 20:38921130-38921152 GTGTGAAGTCGGCTCCTGTCAGG - Exonic
1173564201 20:44027665-44027687 GGCTGAAGTCAACTGGTGTCTGG - Intronic
1179385523 21:40938316-40938338 GTCTGAAGTCAGGGGTTGGCAGG + Intergenic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1185017604 22:48353759-48353781 GTCTGGAGGCCCCTGGTGTCTGG - Intergenic
950686859 3:14624775-14624797 GTCTGAAGTCAGCAGTTTTGGGG + Intergenic
953818123 3:46179295-46179317 ATGTGAATTCTGCTGTTGTCAGG + Intronic
958068475 3:88577269-88577291 GTCTGAATTCTGCTGTTTTCTGG - Intergenic
965742498 3:171890432-171890454 GTCTGAACTCAGCTGATGCCTGG - Intronic
966046395 3:175556024-175556046 CTCTGGAGTCTGCTGTTCTCTGG - Intronic
966293511 3:178388676-178388698 GACTGAGTTCCGCTTTTGTCTGG + Intergenic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
973971776 4:56220254-56220276 GACTGAAGTCCTTTGTTTTCTGG + Intronic
974751452 4:66146448-66146470 GTCTGAAGTTCGCTGTTGAATGG + Intergenic
977994180 4:103482719-103482741 TTTTGAATTCCTCTGTTGTCTGG - Intergenic
995245950 5:109936032-109936054 TTCTGAAGTGCTCTGTTGCCAGG - Intergenic
998565257 5:143210882-143210904 GTCTGAAGGGCACTGTTGACAGG + Intronic
999289010 5:150411479-150411501 GTGTGATGTCAGCTGTTGCCAGG - Intronic
1003314910 6:5003628-5003650 GTCTGGAGGGAGCTGTTGTCAGG - Intronic
1007235406 6:40387813-40387835 CTCTGAAGCAAGCTGTTGTCAGG + Intergenic
1020513578 7:9089802-9089824 GTCTGCAGGCCTCTGTTGTGAGG - Intergenic
1022226438 7:28368438-28368460 GTCTGAAGTGCTCTGTGGTCTGG + Intronic
1022308587 7:29174024-29174046 GTGTGAACTCCGCTTGTGTCTGG - Intronic
1022522039 7:31014738-31014760 GGGTGAAGTCCACTGTGGTCTGG + Intergenic
1024985856 7:55192597-55192619 GACTGAAATCCCCTGTTGCCGGG + Intronic
1035283116 7:157789543-157789565 GGCTGAATTCCCTTGTTGTCAGG - Intronic
1036212733 8:6855276-6855298 GTCTGAAATCTGGTGTTGGCCGG + Intergenic
1055980239 9:81993707-81993729 GTCTGCCATCCTCTGTTGTCCGG - Exonic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1185674251 X:1835945-1835967 ATCTGAAGTCCGCTCTTACCAGG + Intergenic
1193270977 X:79530318-79530340 GTCTGAAGTCCGCTGGAGACAGG - Intergenic
1200056210 X:153462711-153462733 GTCTGCTGTCCCCTGCTGTCTGG - Intronic