ID: 968541303

View in Genome Browser
Species Human (GRCh38)
Location 4:1169704-1169726
Sequence GTCTGAAGTCCGCTGTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541295_968541303 18 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541300_968541303 -4 Left 968541300 4:1169685-1169707 CCAGTTCCTCCTCGGGAAAGTCT 0: 1
1: 0
2: 1
3: 8
4: 110
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541296_968541303 17 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541297_968541303 11 Left 968541297 4:1169670-1169692 CCAGGTTGGTGGGCTCCAGTTCC 0: 1
1: 0
2: 1
3: 21
4: 188
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56
968541301_968541303 -10 Left 968541301 4:1169691-1169713 CCTCCTCGGGAAAGTCTGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541303 Original CRISPR GTCTGAAGTCCGCTGTTGTC TGG Intronic