ID: 968541304

View in Genome Browser
Species Human (GRCh38)
Location 4:1169705-1169727
Sequence TCTGAAGTCCGCTGTTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541296_968541304 18 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
968541301_968541304 -9 Left 968541301 4:1169691-1169713 CCTCCTCGGGAAAGTCTGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
968541297_968541304 12 Left 968541297 4:1169670-1169692 CCAGGTTGGTGGGCTCCAGTTCC 0: 1
1: 0
2: 1
3: 21
4: 188
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
968541295_968541304 19 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
968541300_968541304 -3 Left 968541300 4:1169685-1169707 CCAGTTCCTCCTCGGGAAAGTCT 0: 1
1: 0
2: 1
3: 8
4: 110
Right 968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541304 Original CRISPR TCTGAAGTCCGCTGTTGTCT GGG Intronic
900229690 1:1550484-1550506 TGTGGTGTCCGCTGGTGTCTGGG - Intronic
903983379 1:27206060-27206082 GTTGATGTCCGCTGTTGGCTAGG + Intergenic
911094957 1:94047606-94047628 TCTGAAGGCAGATGTTGTTTTGG - Intronic
913090490 1:115473567-115473589 TCTGCAGTCCGGTATGGTCTTGG + Intergenic
923128988 1:231058546-231058568 TCTGAAGACAGCTGTTTCCTAGG - Intergenic
924936932 1:248779728-248779750 TCTGAAATCACCTGTTGTCCTGG + Intergenic
1066233297 10:33459473-33459495 TCTGAAGATCTCTGGTGTCTTGG + Intergenic
1068459754 10:57312023-57312045 TCTGAAGTTAGCTGTTGCCATGG - Intergenic
1071336692 10:84606205-84606227 TCTGAAGTCCATAGTTGCCTTGG + Intergenic
1079645442 11:22859468-22859490 TCTGAAGGATGATGTTGTCTTGG + Exonic
1081525309 11:43924242-43924264 TCTGGTGTCCGCAGTGGTCTGGG + Intergenic
1085480482 11:76819094-76819116 TCTGAAGTTTGCTGTTGATTGGG - Intergenic
1100549835 12:95636911-95636933 TCTGATGTCCCTTGTTGCCTTGG - Intergenic
1101482182 12:105108252-105108274 TCTGGAGGACGCTGATGTCTGGG + Intronic
1106596044 13:31138787-31138809 TCTGAAGTCAGCTGCTATCTTGG + Exonic
1111588447 13:90311600-90311622 TATGAAGGCCGATGGTGTCTGGG + Intergenic
1113344064 13:109456722-109456744 TTTGTAGTCTGCTGTAGTCTGGG - Intergenic
1119084302 14:71725803-71725825 TTTGAAGTCTTCTGTTCTCTAGG + Intronic
1125427612 15:39565452-39565474 TCTGAAGACAGCTGTTTGCTTGG + Intergenic
1126405346 15:48317402-48317424 TCTCAAGTCCTCTCTTGCCTGGG - Intergenic
1128545840 15:68566994-68567016 TCTGAGGTTCTCTGTTCTCTGGG + Intergenic
1129582567 15:76828092-76828114 TGTGATGTCCTATGTTGTCTTGG + Intronic
1130967583 15:88708679-88708701 TCTGTTGTCCACTGTTCTCTGGG + Intergenic
1140223892 16:73063909-73063931 TCTGAAGTCCCCTTTTGTTATGG + Intergenic
1140532669 16:75680217-75680239 TCTGAAGTTTGCTGTTGAGTGGG + Intronic
1142211191 16:88809406-88809428 GCTGAAGTCTGGTGTTGTCCTGG + Exonic
1143684175 17:8500657-8500679 TCTGAAAGCCGCTCCTGTCTTGG + Intronic
1145395230 17:22489126-22489148 TCTGAAGTGAGCTGATGCCTCGG + Intergenic
1146839064 17:36136939-36136961 TCTGAACTCTTCTGTTGTCCTGG + Intergenic
1150816291 17:68394836-68394858 TCTGCAGCCAGCTGTTGCCTGGG - Intronic
1158239904 18:55365529-55365551 TCTGAGGTCCATTGTTGGCTGGG - Intronic
1163149200 19:15401150-15401172 TCGGAAGTCGGCTGTGGTCCAGG + Exonic
1164739845 19:30567677-30567699 TCTGACCTCCGCTGCTGTCGCGG - Intronic
1165191784 19:34069758-34069780 TCTGAAGTCCTGTGTTGTTTGGG - Intergenic
1165611598 19:37158552-37158574 TCTGAATTTAGCTGATGTCTTGG - Intronic
1166129431 19:40737211-40737233 TCTGAGGTCAGCTGGTGGCTTGG + Intronic
928814168 2:35270439-35270461 TTTCAAGTCCTCTGTTGTCCAGG + Intergenic
933239813 2:79907830-79907852 TCTGAAGTCCACTGGAATCTTGG - Intronic
940174115 2:150860059-150860081 TCTGAGGCCCTCTCTTGTCTGGG - Intergenic
940230815 2:151449621-151449643 TCTGAAGTCTTCTCTTTTCTTGG + Intronic
948275741 2:236706523-236706545 TCTGAAATCCGCTGGTGGCCAGG + Intergenic
1169737314 20:8850868-8850890 TCTGAAATAGGCTGCTGTCTCGG - Intronic
1170540587 20:17383465-17383487 TCTGTAGTTCTCTGTTTTCTTGG - Intronic
1170587158 20:17743388-17743410 TCTGAGGTCAGCTGATGTGTTGG - Intergenic
1171372277 20:24669561-24669583 TCTGAAGACCTCCTTTGTCTTGG - Intergenic
1173564200 20:44027664-44027686 GCTGAAGTCAACTGGTGTCTGGG - Intronic
1177551987 21:22635326-22635348 TTTGCAGTCTGCTGTTGCCTAGG + Intergenic
1178822418 21:35987594-35987616 TCTGAAGTACACTGTTTGCTTGG + Intronic
1184918006 22:47586401-47586423 TCTCAAGTCCGGTGTTGACTTGG - Intergenic
955494100 3:59513067-59513089 TCTGTAGTACGGTGTTGCCTGGG - Intergenic
961944689 3:130673538-130673560 TCTGAAGCACGCTGTTTTCATGG - Intronic
963212347 3:142707056-142707078 TCTCAGGTCGGCTGTTCTCTAGG - Intronic
968541304 4:1169705-1169727 TCTGAAGTCCGCTGTTGTCTGGG + Intronic
969697828 4:8745168-8745190 TCCCAAGGCCGCTGGTGTCTGGG - Intergenic
973971777 4:56220255-56220277 ACTGAAGTCCTTTGTTTTCTGGG + Intronic
981534634 4:145786555-145786577 TCTGAAATCCTCTGTAGTCTTGG + Intronic
985890645 5:2712892-2712914 ACTGAAGTCTGATGTTCTCTGGG + Intergenic
1003046000 6:2733391-2733413 TCTGAGGTCTGCTGGTCTCTGGG - Intronic
1005616541 6:27578453-27578475 TGTGAAGTCTCTTGTTGTCTTGG - Intergenic
1020429333 7:8103579-8103601 CCTGAAGTCCCCTGGTGTCCTGG - Intergenic
1022226439 7:28368439-28368461 TCTGAAGTGCTCTGTGGTCTGGG + Intronic
1022308586 7:29174023-29174045 TGTGAACTCCGCTTGTGTCTGGG - Intronic
1022522040 7:31014739-31014761 GGTGAAGTCCACTGTGGTCTGGG + Intergenic
1028435815 7:90802327-90802349 TCTGAATTCAGCTGTTTTATTGG + Intronic
1030143970 7:106333499-106333521 TCTGAAGTTTGCTGTTGAATGGG + Intergenic
1044951149 8:97436623-97436645 TCTAAAGTACACTGTTGGCTGGG + Intergenic
1046978966 8:120315660-120315682 TCTGAAGTCAGTTGTGATCTTGG + Intronic
1047331196 8:123888461-123888483 TCTGAAGTTTGCTGTTGAGTGGG + Intronic
1051930433 9:22378969-22378991 TTTGAAGTTGGATGTTGTCTAGG + Intergenic
1058324942 9:103683739-103683761 TCTGAAGTCAGGAGTTGTTTCGG + Intergenic
1060875285 9:127078671-127078693 TCTGCAGTCAGCTTTTCTCTGGG + Intronic
1188629931 X:32342537-32342559 TCTAAATTCCTCTGGTGTCTTGG + Intronic
1200056209 X:153462710-153462732 TCTGCTGTCCCCTGCTGTCTGGG - Intronic