ID: 968541305

View in Genome Browser
Species Human (GRCh38)
Location 4:1169706-1169728
Sequence CTGAAGTCCGCTGTTGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968541296_968541305 19 Left 968541296 4:1169664-1169686 CCATGGCCAGGTTGGTGGGCTCC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data
968541301_968541305 -8 Left 968541301 4:1169691-1169713 CCTCCTCGGGAAAGTCTGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data
968541300_968541305 -2 Left 968541300 4:1169685-1169707 CCAGTTCCTCCTCGGGAAAGTCT 0: 1
1: 0
2: 1
3: 8
4: 110
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data
968541295_968541305 20 Left 968541295 4:1169663-1169685 CCCATGGCCAGGTTGGTGGGCTC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data
968541297_968541305 13 Left 968541297 4:1169670-1169692 CCAGGTTGGTGGGCTCCAGTTCC 0: 1
1: 0
2: 1
3: 21
4: 188
Right 968541305 4:1169706-1169728 CTGAAGTCCGCTGTTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968541305 Original CRISPR CTGAAGTCCGCTGTTGTCTG GGG Intronic
No off target data available for this crispr