ID: 968544779

View in Genome Browser
Species Human (GRCh38)
Location 4:1193319-1193341
Sequence CCAGTGATGAAGGGTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 324}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968544779_968544786 -7 Left 968544779 4:1193319-1193341 CCCCACACACCCTTCATCACTGG 0: 1
1: 0
2: 2
3: 34
4: 324
Right 968544786 4:1193335-1193357 TCACTGGGTGTCCCCGTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 87
968544779_968544797 25 Left 968544779 4:1193319-1193341 CCCCACACACCCTTCATCACTGG 0: 1
1: 0
2: 2
3: 34
4: 324
Right 968544797 4:1193367-1193389 CTGGGGGAGTCCAGCACGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 177
968544779_968544793 8 Left 968544779 4:1193319-1193341 CCCCACACACCCTTCATCACTGG 0: 1
1: 0
2: 2
3: 34
4: 324
Right 968544793 4:1193350-1193372 GTCACCGGGTATCTGTCCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 64
968544779_968544798 30 Left 968544779 4:1193319-1193341 CCCCACACACCCTTCATCACTGG 0: 1
1: 0
2: 2
3: 34
4: 324
Right 968544798 4:1193372-1193394 GGAGTCCAGCACGCCAGGCCTGG 0: 1
1: 0
2: 3
3: 16
4: 213
968544779_968544787 -6 Left 968544779 4:1193319-1193341 CCCCACACACCCTTCATCACTGG 0: 1
1: 0
2: 2
3: 34
4: 324
Right 968544787 4:1193336-1193358 CACTGGGTGTCCCCGTCACCGGG 0: 1
1: 0
2: 0
3: 16
4: 140
968544779_968544791 6 Left 968544779 4:1193319-1193341 CCCCACACACCCTTCATCACTGG 0: 1
1: 0
2: 2
3: 34
4: 324
Right 968544791 4:1193348-1193370 CCGTCACCGGGTATCTGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 26
968544779_968544792 7 Left 968544779 4:1193319-1193341 CCCCACACACCCTTCATCACTGG 0: 1
1: 0
2: 2
3: 34
4: 324
Right 968544792 4:1193349-1193371 CGTCACCGGGTATCTGTCCTGGG No data
968544779_968544794 9 Left 968544779 4:1193319-1193341 CCCCACACACCCTTCATCACTGG 0: 1
1: 0
2: 2
3: 34
4: 324
Right 968544794 4:1193351-1193373 TCACCGGGTATCTGTCCTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968544779 Original CRISPR CCAGTGATGAAGGGTGTGTG GGG (reversed) Intronic
900578605 1:3396454-3396476 CCAGAGAGAAAGGGTGAGTGTGG - Intronic
901171024 1:7257378-7257400 CCAGTTATGCAGTGTGTTTGGGG - Intronic
901442843 1:9290052-9290074 CAAGTGATAAAATGTGTGTGGGG + Intergenic
903838933 1:26224804-26224826 CCAGTGATTAAGGGTGTGGGCGG + Intergenic
904277748 1:29395307-29395329 CCACTGGGGAAGAGTGTGTGTGG - Intergenic
904606147 1:31698801-31698823 ACAGTGGTGAAGGCTGGGTGCGG + Intronic
904901241 1:33858760-33858782 CCAGTGATGAACAGTGTTTGAGG - Intronic
905300953 1:36985886-36985908 CCAGCAATGAAGGGTGAGTGTGG + Intronic
906580442 1:46931042-46931064 CCTGTGATGAAGAGCGTGGGAGG - Intronic
906603283 1:47147846-47147868 CCTGTGATGAAGAGCGTGGGAGG + Intronic
906607662 1:47183066-47183088 TCAGGGATGAAGGATGTTTGGGG + Intergenic
906903628 1:49865018-49865040 CCAGTGATGAAGGATGGGTCTGG - Intronic
907626833 1:56038798-56038820 CCGCTGATGGAGGGTGTCTGTGG - Intergenic
907757943 1:57329107-57329129 CCATTGTTGTAGGCTGTGTGAGG - Intronic
908718573 1:67097687-67097709 TCAGTGATGGATGGTCTGTGGGG + Intronic
908870185 1:68601677-68601699 CCAGAGATGAAGGCTCTCTGGGG - Intergenic
910518325 1:88088445-88088467 CCACTGAGGAAGGGTGGGTCAGG + Intergenic
912360748 1:109092985-109093007 TCAGAGAAGAAGGGTGTTTGGGG + Exonic
912607569 1:111008132-111008154 CCAGTGAGGAAGGATGGGTCAGG - Intergenic
913298246 1:117343238-117343260 GCAGTGGTGGAGGGAGTGTGTGG + Intergenic
915568204 1:156728569-156728591 CCAGTGATTCCGAGTGTGTGAGG + Exonic
915838015 1:159193428-159193450 CCAGTGATGATGGGCTTCTGTGG - Exonic
915932301 1:160068283-160068305 CCACCGATGGAGGGTGGGTGGGG - Intronic
917062559 1:171056403-171056425 CCAGTGAGGAAGGATGAGTCAGG - Intronic
917356433 1:174131191-174131213 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
917582365 1:176391812-176391834 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
918168737 1:181975223-181975245 CCAGTGAGGAAGGATGGGTCAGG - Intergenic
918243630 1:182640929-182640951 TCAGGGATGAGGGGTGTGGGTGG - Intergenic
918573573 1:186027580-186027602 ACAGTTATGGAGGCTGTGTGAGG + Intronic
920208460 1:204310911-204310933 CCGGTGATGATGCGGGTGTGGGG + Intronic
920286613 1:204884170-204884192 TCAGGGGTGAGGGGTGTGTGTGG + Intronic
921159970 1:212465687-212465709 CCAGTGAGGAAGGAGGAGTGGGG - Intergenic
923371543 1:233319021-233319043 TCAGTGAGGAGGGTTGTGTGAGG - Intergenic
1062951955 10:1510737-1510759 CCAGTGAAGAAGGGACTGTAGGG - Intronic
1063020623 10:2123617-2123639 CCAGAGATGATGGTTCTGTGTGG - Intergenic
1063054079 10:2484422-2484444 GCTGTGATGAAGGGACTGTGTGG + Intergenic
1063477339 10:6340642-6340664 GCAGAGATGAAGGGAGTGGGTGG + Intergenic
1069370940 10:67747043-67747065 CCAGTGAGGAGGGATGTGTCAGG - Intergenic
1069726539 10:70583631-70583653 CCCGTGCTGAGGGGTGTCTGGGG - Intergenic
1069885027 10:71618331-71618353 CCTGTGATGCAGGGTGTGTCAGG - Intronic
1070154348 10:73824453-73824475 CCCGTGATGAACGCTGTGGGCGG - Intronic
1071404479 10:85317075-85317097 CCAGTGCTGGAGGCTGGGTGGGG + Intergenic
1071440118 10:85682699-85682721 CCATTGGAGAAGGGTGTCTGAGG - Intronic
1072247642 10:93557399-93557421 CCATTGCTGGAGGGTGGGTGTGG + Intergenic
1072415860 10:95246236-95246258 CCAGGGAAGAAGCGGGTGTGAGG + Intronic
1072789221 10:98305492-98305514 CCAGTGAAGGTGGGTGTGTTAGG + Intergenic
1073489956 10:103846576-103846598 CCAGAGATGATAGCTGTGTGAGG - Intronic
1074559053 10:114519026-114519048 ACAGGGAGGCAGGGTGTGTGGGG - Intronic
1074785814 10:116838464-116838486 CCACTGATGATGTGTGTGTTTGG - Intergenic
1074987437 10:118670491-118670513 CCAGTGAAGCAGGGTGGGAGCGG + Intergenic
1075205462 10:120444046-120444068 TGAGTGATGAGTGGTGTGTGGGG + Intergenic
1075400859 10:122160518-122160540 GCAGAGAAGAAGTGTGTGTGTGG + Intronic
1076575146 10:131460910-131460932 CCACTGCTGATGGATGTGTGTGG + Intergenic
1077112460 11:867908-867930 CCAGGGGTGAGGGTTGTGTGGGG + Exonic
1077774681 11:5258261-5258283 CCAGTGAGGATGTGTGTTTGGGG - Intronic
1077828098 11:5832021-5832043 CCAGTGAGGATGTGTGTTTGGGG + Intronic
1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG + Intronic
1079359200 11:19756470-19756492 GCAGTCATGAAGGGTGACTGAGG + Intronic
1079761801 11:24338613-24338635 CCAGTGTTTAAAGGTGGGTGTGG - Intergenic
1080130885 11:28793035-28793057 CCAGTGAGGAAGGATGTGTCAGG + Intergenic
1080164885 11:29224691-29224713 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
1080300145 11:30775153-30775175 CCACGGAGGAGGGGTGTGTGGGG + Intergenic
1081808880 11:45904375-45904397 CAAGTGAAGGAGGGTGGGTGAGG - Intronic
1083279047 11:61614118-61614140 CCAGTGAGGAAGGGGTTGTTGGG + Intergenic
1083641286 11:64146696-64146718 TGGGTGATGGAGGGTGTGTGTGG - Intronic
1083709098 11:64536717-64536739 CCAGGGATGAGGATTGTGTGGGG + Intergenic
1084083985 11:66846341-66846363 AAAGTGAGGAAGGGAGTGTGTGG - Exonic
1084979743 11:72822737-72822759 CCAGTGATGAGGGTTCTGTGTGG - Intronic
1088913965 11:114212932-114212954 CCAGTGATGAAGGTTGAGGGAGG - Intronic
1090632088 11:128658128-128658150 GGAGTGAGGGAGGGTGTGTGGGG - Intergenic
1092452178 12:8612966-8612988 CCAGTGAAGATGGGTGGGTGGGG + Intergenic
1093413665 12:18895962-18895984 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
1096774538 12:53955962-53955984 CCAGTCCTGAAGGATGTGAGAGG + Intronic
1097239371 12:57564523-57564545 CCAGTGGATGAGGGTGTGTGAGG + Intronic
1098439673 12:70504491-70504513 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
1098560475 12:71866185-71866207 TCAGTGATGAAGGGAATCTGTGG + Intronic
1100478942 12:94959522-94959544 CCACTAATGAGGGTTGTGTGGGG - Intronic
1102490609 12:113287776-113287798 CCAGTGAAGAAGGGTGGCAGGGG - Intronic
1103624478 12:122207379-122207401 CCAGCGCTGAAGGGTGGGTTGGG + Exonic
1106378370 13:29211729-29211751 CCAGTGAGGATGTGTGTTTGGGG + Intronic
1106392365 13:29346944-29346966 CCAGTGAGGATGTGTGTTTGGGG + Intronic
1108197875 13:48013293-48013315 GCAGTGAAGAAGGCTGGGTGTGG + Intergenic
1108431017 13:50353773-50353795 CCATTGATGAATCATGTGTGTGG - Intronic
1108436876 13:50409638-50409660 CCAGGGATGAAGGCTATCTGGGG - Intronic
1109294428 13:60512939-60512961 CCAGTGGTGAACTCTGTGTGGGG + Intronic
1111830725 13:93325746-93325768 AGAGTGATGGAGGGTGTGGGTGG + Intronic
1112011347 13:95296390-95296412 TTAGAGAGGAAGGGTGTGTGAGG - Intronic
1116658248 14:47676075-47676097 CCGGGGAGGAAGGCTGTGTGTGG + Intergenic
1117091810 14:52258699-52258721 CCAGGGATAATGGGTGAGTGGGG + Intergenic
1118759786 14:68873220-68873242 CCAGTGATGGAGGAGGTGGGTGG + Intergenic
1120750368 14:88191882-88191904 CCAATGATAAAGGCTGTGTTAGG - Intronic
1123966728 15:25467024-25467046 TCAGAGATGCAGGATGTGTGAGG + Intergenic
1124243951 15:28054471-28054493 CCAGTCAAGATGGGTGTGGGAGG - Intronic
1125103411 15:35942458-35942480 TAAGTGATTAATGGTGTGTGAGG - Intergenic
1125111336 15:36038398-36038420 GCGGTGATGAAGGGTGTGGGAGG + Intergenic
1126284585 15:46996541-46996563 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
1126429056 15:48561098-48561120 CCAGTGATGAGTGGTCTGTCAGG + Intronic
1127687702 15:61364847-61364869 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
1129868623 15:78927021-78927043 CAAGTGTGGGAGGGTGTGTGAGG - Intronic
1131553768 15:93379488-93379510 CCAGGGGTGCAGGGTGTGGGTGG + Intergenic
1132345314 15:101104683-101104705 CGACTCATGAAGGGTTTGTGTGG - Intergenic
1132576238 16:665725-665747 GCAGTGAGGATGGGAGTGTGCGG + Exonic
1133211178 16:4264137-4264159 CCATTGATGAAGGCAGTCTGGGG + Intronic
1134824806 16:17275856-17275878 CCACTGTGGCAGGGTGTGTGTGG - Intronic
1136910755 16:34142491-34142513 CCAGGCATGCAGGGCGTGTGGGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138656114 16:58492414-58492436 CAGGAGATGAAGGGTGTGGGAGG - Intronic
1139633941 16:68246671-68246693 CCAGAGAGGAAGTCTGTGTGGGG + Intronic
1139748573 16:69094339-69094361 CCAGTGAAGGTGTGTGTGTGTGG - Intergenic
1139994019 16:70963143-70963165 ACAGTCATGAAGAGAGTGTGAGG - Intronic
1141280052 16:82623263-82623285 CCAGTGATTAGGCGTGTCTGGGG - Intergenic
1141942309 16:87285355-87285377 CCAGTGAGGACGGGTGGGAGAGG - Intronic
1142676135 17:1514523-1514545 CCAGTGCTGCCGGGTGTGGGTGG - Intronic
1142911582 17:3097938-3097960 CCAGTGAGGAAGAGTGGGTCAGG - Intergenic
1143517894 17:7429173-7429195 CCAGAGCTGAAGGGAGTGGGAGG - Intergenic
1144368256 17:14566191-14566213 CCAGCAATGAAAGGTGTATGGGG - Intergenic
1144835635 17:18155286-18155308 GCAGAGATGAAGGGCGTGTGAGG - Intronic
1147004089 17:37387734-37387756 ACAGTGAAGAAGGCTGTGTGCGG - Intronic
1147213429 17:38885507-38885529 GCAGGGAGGAAGGGTGGGTGGGG + Intronic
1147444674 17:40467541-40467563 CCAGAGAGCAAGGGGGTGTGAGG - Intergenic
1147970209 17:44215352-44215374 ACAGTGAGGATGGGTGTATGGGG + Intronic
1148576567 17:48716102-48716124 TTAGTGATGATGGGTGGGTGGGG - Intergenic
1150584471 17:66505007-66505029 CAAGTGAAGAAGGGTATCTGCGG - Intronic
1150633065 17:66893823-66893845 CCTGAGTTGATGGGTGTGTGGGG + Intergenic
1150893548 17:69183569-69183591 CCAGTGAGGATGTGTGTTTGGGG - Intronic
1151402198 17:73863076-73863098 CCAGTGATGGAAGGTGAGTACGG + Intergenic
1151706818 17:75773599-75773621 CCTTTGCTGAGGGGTGTGTGAGG - Intergenic
1151999520 17:77636765-77636787 ACAGAGATGAAGGCTGTGTGAGG - Intergenic
1152343400 17:79737634-79737656 CCAGTGGGGAGGTGTGTGTGTGG - Intronic
1156778485 18:40822050-40822072 CCAGTGAGGAAGGATGAGTCTGG - Intergenic
1157484510 18:48077463-48077485 GGAGTGAGGAAGGGCGTGTGGGG + Intronic
1158865999 18:61638237-61638259 CCAGTACTGAAGGGAGGGTGTGG - Intergenic
1161895056 19:7073983-7074005 AAAGTGGTCAAGGGTGTGTGTGG - Intronic
1163122535 19:15226550-15226572 TCAGTGAAGAAAGTTGTGTGTGG - Intergenic
1163886127 19:19966319-19966341 CCAGTGAGGAGGGATGGGTGAGG + Intergenic
1163888340 19:19989159-19989181 CCAGTGAGGAGGGATGGGTGAGG - Intergenic
1165104056 19:33458385-33458407 CAAGTGATGTATGGTGTGTGTGG + Intronic
1166271536 19:41717460-41717482 CTGGTGATGAAGGGTTTGGGTGG - Exonic
1167279808 19:48560288-48560310 CCTGTGCTGAAGGCTGTGTGGGG + Intronic
1167837337 19:52085079-52085101 CCACTGTTGCAGGGTGTGTGGGG - Intronic
1167860183 19:52276919-52276941 CCACTGCTGCAGTGTGTGTGTGG + Intronic
1167925502 19:52818206-52818228 CCACTGCTGCAGCGTGTGTGTGG - Intronic
1167929749 19:52854518-52854540 CCACTGCTGCAGCGTGTGTGTGG - Intronic
1167933829 19:52890502-52890524 CCACTGCTGCAGCGTGTGTGTGG - Intronic
1167995390 19:53397746-53397768 CCACTGCTGCAGCGTGTGTGTGG + Intronic
1168001152 19:53447000-53447022 CCACTGTTGCAGCGTGTGTGTGG + Intronic
1168005524 19:53483553-53483575 CCACTGCTGCAGCGTGTGTGTGG + Intronic
1168318488 19:55494558-55494580 TCCGGGATGGAGGGTGTGTGTGG + Intronic
925651320 2:6092494-6092516 CCAGTCCTGAAGGCTTTGTGTGG + Intergenic
926702179 2:15811000-15811022 CCCTTGATGGAGGGTGTGAGGGG + Intergenic
927488497 2:23505239-23505261 CCTGTGATGCAGGGTGTCAGAGG + Intronic
927946621 2:27138586-27138608 CCATTGATGAGGGATGTGTGGGG + Exonic
928249223 2:29660217-29660239 CCAGTCAAGAAGCGTGTCTGTGG - Intronic
928312698 2:30223642-30223664 GCTGTTATGAAGGGAGTGTGGGG + Intergenic
929539133 2:42806489-42806511 CCAGTGTTGATGAGAGTGTGGGG - Intergenic
929932457 2:46269475-46269497 TCAGTGGTGTAGGGTGTGTGAGG - Intergenic
931147677 2:59537257-59537279 CCAGTGGTTAAGGGTGTTAGAGG - Intergenic
931345946 2:61446503-61446525 CCAGTGATGTAGGCTGGGCGTGG + Intronic
931618806 2:64189488-64189510 GCAGAGATGAAGGCTGTGGGTGG - Intergenic
931813719 2:65879770-65879792 GGAGTGAAGAAGGATGTGTGTGG + Intergenic
932013478 2:68000865-68000887 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
932775075 2:74523537-74523559 CCTGAGAAGAAGGGTGGGTGGGG + Exonic
934532877 2:95106597-95106619 CTAGTGATGAGGGGTGACTGGGG - Intronic
934541226 2:95176609-95176631 CCAGTGTTCCAGGGAGTGTGGGG + Intronic
934622864 2:95826172-95826194 CCAGTGAGGAGGGATGGGTGAGG + Intergenic
935095962 2:99944533-99944555 CCAGTGATGAATGGAGAATGGGG + Intronic
935508253 2:103934670-103934692 CCAGTGATGGAGGGAGGGAGAGG + Intergenic
936849080 2:116873945-116873967 CCAGTGAAGAAGGGTGAGTCAGG + Intergenic
937098960 2:119254097-119254119 CCAGTGATGGGGGCAGTGTGGGG + Intronic
938139591 2:128784740-128784762 CCAGGGCTGAGGGGTGTGAGGGG + Intergenic
939391129 2:141570817-141570839 CCAGTGAGGAAGGATGGGTCCGG - Intronic
939866737 2:147481444-147481466 CCAGTAATGAATGATGTGGGAGG - Intergenic
940511731 2:154624035-154624057 CCAGTGCTCAAGTATGTGTGTGG - Intergenic
941876268 2:170436732-170436754 GAAGTGGTGAAGGGTGTGTGGGG + Intronic
943348626 2:186771645-186771667 CCAGTGAGGATGTGTGTTTGGGG - Intergenic
943520332 2:188941708-188941730 GTAGTGATGACGGGTGGGTGGGG + Intergenic
944385122 2:199155222-199155244 CCAGTGAGGAAGGATGGGTCAGG - Intergenic
945196492 2:207242002-207242024 ACAGTGAGAAAGGGTATGTGGGG + Intergenic
947309859 2:228789619-228789641 CAACTGATCAAGGGTTTGTGGGG + Intergenic
947480086 2:230491396-230491418 CCAGTGAGGAAGGATGAGTCAGG + Intronic
947574737 2:231264059-231264081 CCTCTGATGAAAGGTGTGTTGGG + Intronic
947730774 2:232429709-232429731 TAAGTCATGAAAGGTGTGTGCGG + Intergenic
947889471 2:233604348-233604370 CCACTGATGAAGACTGTGTTGGG - Intergenic
1169235555 20:3927110-3927132 TCAGTGGTGAAGAGTGTGTCAGG - Intronic
1170547203 20:17444672-17444694 CCAGTGATGAATGGGAGGTGTGG + Intronic
1172647189 20:36478035-36478057 CCAGTGTTGATGGGCCTGTGAGG + Intronic
1173564031 20:44026694-44026716 TAATTGATGAAGGGGGTGTGGGG - Intronic
1174837659 20:53873515-53873537 GCACTGATGCAGAGTGTGTGTGG - Intergenic
1176270111 20:64231923-64231945 CCAGTCATGCAGGGGCTGTGAGG + Intronic
1178420207 21:32437322-32437344 GCAGTGGGGAAGGGTGTGAGAGG - Intronic
1179587723 21:42384270-42384292 CTAGTGATAAAGGATGTGTAAGG + Intronic
1180867119 22:19126070-19126092 CCAGAGCTGAAAGGTGAGTGAGG + Intergenic
1180959895 22:19757774-19757796 CCAGTGAGGAGTGCTGTGTGGGG - Intronic
1183958961 22:41399445-41399467 ACTGTGATGAAGGGGGTGTCTGG - Intergenic
1184296169 22:43526909-43526931 CCAGTGAGCACAGGTGTGTGGGG - Intergenic
1184408196 22:44312074-44312096 CCAGTGAGGAAGGGGTTCTGGGG - Intronic
1185257800 22:49845797-49845819 CCACTGATGATGGCAGTGTGGGG - Intergenic
949177429 3:1082081-1082103 CCAGTGGTGAATGGTTTGTCTGG + Intergenic
949619716 3:5796737-5796759 CCAGTGCTGCAGAGTGTGAGAGG - Intergenic
950542013 3:13618425-13618447 CCAGTGATGGGGGATTTGTGAGG + Intronic
952503780 3:33989190-33989212 CCAGTGAGGAAGGATGGGTCCGG + Intergenic
953714481 3:45306139-45306161 GCAGAGATGAAGGCTGAGTGGGG - Intergenic
953744663 3:45565115-45565137 CCAGTGAGGAAGGCTGTCTCTGG - Intronic
955642955 3:61106288-61106310 CCAGTTATGATTTGTGTGTGTGG + Intronic
957268855 3:78003166-78003188 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
957584330 3:82114609-82114631 CCAGTGAGGAAGGATGTGTCAGG + Intergenic
957630074 3:82707132-82707154 CCAGTGAGAAAGGATGTGTCAGG + Intergenic
957696820 3:83649888-83649910 CCAGTGAGGAAGGTTGGGTTAGG + Intergenic
958787536 3:98613682-98613704 CCAGTGAGGATGTGTGTTTGGGG + Intergenic
959418361 3:106104282-106104304 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
959528776 3:107408414-107408436 TCAGTGGTGAAGGCTGGGTGAGG - Intergenic
960233457 3:115255045-115255067 CCAGTGAGGAAGGATGTGTCAGG - Intergenic
960465649 3:117994100-117994122 CCATTGATAAAGGGTCTCTGAGG - Intergenic
960516435 3:118607699-118607721 CCAGTGAGGATGTGTGTTTGGGG - Intergenic
961002816 3:123385321-123385343 CCAGTGCTGTAGTCTGTGTGTGG + Intronic
961477154 3:127154646-127154668 AGTGTGATGAAGTGTGTGTGGGG + Intergenic
961544668 3:127624074-127624096 CCAGGGGAGAAGGGTGTCTGTGG + Intergenic
962691947 3:137907714-137907736 CCAGTGAGGAAGGATGGGTCAGG - Intergenic
962966051 3:140355559-140355581 TCAGGGATGAAGGGTTAGTGTGG + Intronic
967914291 3:194566837-194566859 GCAGGGATGGAGGCTGTGTGTGG - Intergenic
967987463 3:195106425-195106447 CCAGTGAGAGAGGGTGTGTGCGG - Intronic
968544779 4:1193319-1193341 CCAGTGATGAAGGGTGTGTGGGG - Intronic
969241699 4:5902988-5903010 CCAGGGAGGAAGGGTGGCTGGGG - Intronic
969862710 4:10050424-10050446 CCAGAGGTGAGTGGTGTGTGTGG - Intronic
969930719 4:10628252-10628274 CCAGTGAGGGAGTTTGTGTGAGG - Intronic
970287955 4:14539413-14539435 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
970508158 4:16754148-16754170 ACAGTGATTAAGAATGTGTGGGG - Intronic
970645889 4:18119936-18119958 CCACTGTTGAAGGCAGTGTGGGG + Intergenic
971349415 4:25843110-25843132 GCAGTGGGGAAGGGTGTGCGTGG + Intronic
972249789 4:37287555-37287577 CCAGTGTGGAAGGATGTGTCAGG - Intronic
973219045 4:47704774-47704796 TCAGTGGTGGAGGGTGTGGGAGG + Intronic
973584678 4:52377969-52377991 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
974086179 4:57263831-57263853 CCAGAGGTGGAGGATGTGTGTGG - Intergenic
975826565 4:78326008-78326030 CTGGAGATGCAGGGTGTGTGTGG + Intronic
977645805 4:99410304-99410326 GGAGTGATGAGGGGTGTGTGAGG + Intergenic
978357661 4:107893987-107894009 CCAGTGCTGAAGGCTATGTAGGG - Intronic
982837919 4:160146119-160146141 CCAGTGAAGAAGGGCATGTGTGG + Intergenic
984166389 4:176307683-176307705 CAAGTGACAGAGGGTGTGTGAGG - Intergenic
985734004 5:1566698-1566720 TGGGTGATGCAGGGTGTGTGTGG + Intergenic
986140667 5:5026642-5026664 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
987399829 5:17463729-17463751 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
987906802 5:24088266-24088288 CCTGGGATGAAGGGACTGTGGGG + Intronic
989033046 5:37139339-37139361 GCAGTGATGAATTGTGTGAGAGG - Exonic
989212163 5:38866734-38866756 CCAGAGAGGGAGTGTGTGTGGGG - Intronic
989230967 5:39086184-39086206 CCAGAGCTGAAGTGTGAGTGAGG + Intergenic
989339286 5:40355405-40355427 GAAGTGGTGAGGGGTGTGTGGGG - Intergenic
990139078 5:52682416-52682438 CCAGTGAGGAAGGATGGGTTAGG + Intergenic
991305847 5:65175107-65175129 CCACTGGTGAGGGGGGTGTGGGG - Intronic
991626748 5:68610801-68610823 CCACTGCTGAAGGCTGTGAGTGG - Intergenic
991986611 5:72293878-72293900 TCTGTGATGAAGGGTGTATTTGG - Intronic
992472985 5:77076639-77076661 CAAGTTCTGAAGGGTGGGTGAGG - Exonic
993044986 5:82856729-82856751 CCCGTCATGAAGGGAGTCTGAGG - Intergenic
993264687 5:85709895-85709917 GCAGTGGTGATGGGTGGGTGGGG - Intergenic
993807920 5:92436220-92436242 CCAGTGAGGAAGGATGGGTCAGG - Intergenic
995594203 5:113730963-113730985 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
995649661 5:114356018-114356040 CCAGTGAGGAAATGTCTGTGAGG + Intergenic
995666192 5:114544925-114544947 CCAGTGAAGAAGGATGGGTCAGG - Intergenic
995960142 5:117829647-117829669 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
996514382 5:124353711-124353733 CCACTGATGAGGGTTCTGTGGGG + Intergenic
997096946 5:130923964-130923986 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
997194773 5:131971622-131971644 CCAGTCTTGGTGGGTGTGTGCGG - Exonic
997414046 5:133711447-133711469 CCAGGGATGGAGGGTGTGAGGGG + Intergenic
997724842 5:136111978-136112000 CCAGTGTTGGGGGGTGGGTGGGG + Intergenic
997869071 5:137490852-137490874 CCAGTCTGGAAGGCTGTGTGAGG - Intronic
999259128 5:150227391-150227413 ACAGTGATTTAGGGTGTATGTGG - Intronic
1000388397 5:160697826-160697848 CTAGTGATGAGGGCTGAGTGTGG - Intronic
1001088424 5:168718853-168718875 CCAGAGATGTTGGGTGTTTGCGG - Intronic
1002427961 5:179186850-179186872 GTAGTGAAGAATGGTGTGTGTGG - Intronic
1002857665 6:1052462-1052484 CCAGTGACCAAGGATGTGTGGGG - Intergenic
1003311858 6:4975639-4975661 CCAGGGAGGAAGGGTGGGAGGGG - Intergenic
1003520723 6:6856427-6856449 ATAGTGATGATGGGTGGGTGGGG + Intergenic
1003687093 6:8315070-8315092 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
1003833760 6:10044239-10044261 ACAGGGAAGAAGGGTGTGAGGGG - Intronic
1004760116 6:18656786-18656808 CCAGTGAGGAAGGATGTGTCAGG - Intergenic
1005170623 6:22980714-22980736 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
1005842130 6:29750595-29750617 CCATTGTAGAAGAGTGTGTGAGG + Intergenic
1010152233 6:72746464-72746486 CTAGTGATCAAGGGTGAGTCAGG + Intronic
1010747895 6:79584765-79584787 CCAGTGTTGATGAGAGTGTGGGG + Intergenic
1011050129 6:83137773-83137795 AGAGTCATGAAGAGTGTGTGTGG - Exonic
1011201793 6:84845027-84845049 CCAGTGAGACAGTGTGTGTGTGG + Intergenic
1011944190 6:92880679-92880701 CCAGTGAGGAAGGATGAGTTAGG - Intergenic
1014084775 6:117330235-117330257 CCACTGAGGAAGGATGGGTGAGG - Intronic
1015141613 6:129940594-129940616 TCAGTGAAGAGGGGAGTGTGGGG + Intergenic
1015358199 6:132305279-132305301 CCAGTGAGGAAGGATGGGTCAGG - Intronic
1016332241 6:142965657-142965679 ACAGTGATGATGGGGGTTTGGGG - Intergenic
1017632947 6:156416480-156416502 CCAGGCATGAAGGGTGGGAGGGG + Intergenic
1018656404 6:166041354-166041376 CCAGAGAGGAAGAGTGTGTCTGG - Intergenic
1019467137 7:1196108-1196130 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467174 7:1196218-1196240 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467233 7:1196398-1196420 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467258 7:1196470-1196492 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467282 7:1196542-1196564 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467362 7:1196759-1196781 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467375 7:1196793-1196815 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1020633781 7:10672130-10672152 CCACTGACGAAGGATGTGTCAGG + Intergenic
1027601701 7:80247815-80247837 CCAGTAATCTTGGGTGTGTGAGG - Intergenic
1029514558 7:101017422-101017444 CCAGTGATGCAGGGTCGGAGGGG + Intronic
1032181755 7:129685437-129685459 CCAGAGATGGAGGGTGTTTAGGG - Intronic
1032429541 7:131849623-131849645 CAAGTGAAGAAGGGTGTGGAGGG - Intergenic
1032508783 7:132455640-132455662 CCAGAAAGAAAGGGTGTGTGTGG - Intronic
1033004959 7:137551622-137551644 CTAGTGATTAAGTGTCTGTGGGG - Intronic
1033941321 7:146658731-146658753 CCAGTGATGAGGTAAGTGTGTGG + Intronic
1035115028 7:156517171-156517193 GCTGTCATGAAGGTTGTGTGAGG + Intergenic
1035115088 7:156517462-156517484 CCCGTGAGGGAGGCTGTGTGAGG + Intergenic
1035115202 7:156518029-156518051 CCCGTGAGGAAGGCTGTGTGAGG + Intergenic
1035368831 7:158365720-158365742 CCAGGGATGCTGTGTGTGTGTGG - Intronic
1035368840 7:158365787-158365809 CCAGGGATGCTGTGTGTGTGTGG - Intronic
1035368848 7:158365850-158365872 CCAGGGATGCTGTGTGTGTGTGG - Intronic
1035491700 7:159284934-159284956 CCAGTGAGGAGGGATGTGTCAGG - Intergenic
1036958539 8:13217344-13217366 CAATTCATGAAGGATGTGTGTGG + Intronic
1037897577 8:22668494-22668516 CCACAGTGGAAGGGTGTGTGCGG + Intronic
1038240320 8:25802062-25802084 CCACTGATGCTGGGTGTGGGTGG + Intergenic
1039089438 8:33812715-33812737 CCAGTGAAGATGGGGGTGAGAGG + Intergenic
1039402241 8:37279642-37279664 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
1039611618 8:38923759-38923781 CAGATGTTGAAGGGTGTGTGAGG + Intronic
1040959778 8:53019326-53019348 CCAGTGAGGAAGGGTGTGTCAGG - Intergenic
1042189117 8:66167695-66167717 TGAGTGATTAAGGGGGTGTGTGG - Intronic
1042225746 8:66513158-66513180 CCAGTGATGATGGAGGTGTGAGG + Intronic
1042333163 8:67604061-67604083 CTGGTGATGGAGGTTGTGTGGGG + Intronic
1044043362 8:87398646-87398668 GCAGTGATGAAAGGCATGTGTGG - Intronic
1044109689 8:88256705-88256727 CCCCTGATGGATGGTGTGTGTGG - Intronic
1044927458 8:97221726-97221748 ACAATGAAGAAGGCTGTGTGAGG + Intergenic
1048030540 8:130627684-130627706 CCAGTGCTGAAGGGTGCAGGAGG + Intergenic
1048220052 8:132532777-132532799 CCAGTGATGAAAGGAATGAGAGG - Intergenic
1048808366 8:138262291-138262313 CCAGTGATGGAGGCTGGGTTTGG - Intronic
1050231473 9:3530048-3530070 GCAGTTCTGAAGAGTGTGTGTGG + Intergenic
1051167478 9:14279703-14279725 CCAGAGATGAAGAGTGTGAAAGG - Intronic
1051618004 9:19024726-19024748 CAAGTGATGTAGGATGTGAGGGG - Intronic
1052546655 9:29889009-29889031 CCAGTGAAGAAGGATGGGTCAGG - Intergenic
1053395290 9:37768179-37768201 CCCTTTATGAAGAGTGTGTGAGG + Exonic
1054850503 9:69842364-69842386 CCAGTTCTGAGGGGTTTGTGTGG - Intronic
1055507772 9:76965441-76965463 ACAGTGCTGAAGGCTGGGTGCGG - Intergenic
1056666734 9:88587391-88587413 CCAGGGCTGCAGGGTGTGTTTGG + Intergenic
1057130155 9:92649195-92649217 CCAGGCATGCAGGGTGGGTGGGG + Intronic
1057426041 9:94950576-94950598 CCATTGTTGCAGGGTGAGTGAGG + Intronic
1058426917 9:104883331-104883353 GCAGTGATGATGGGTGGGGGAGG - Intronic
1058857208 9:109074575-109074597 ACAGAGATGAGGGGTGGGTGTGG - Intronic
1058868485 9:109182903-109182925 CGAGTGATGAAGGCTCTGCGGGG - Intronic
1059361441 9:113744932-113744954 CCAGTGACTATGGGTGTCTGTGG + Intergenic
1061736896 9:132667652-132667674 GCAGTGATGACAGGTGTCTGCGG - Intronic
1061872005 9:133525956-133525978 CAAGGAATGATGGGTGTGTGTGG + Intronic
1062241365 9:135540862-135540884 CCAGCCATGAAGGGTGCGTGTGG + Intergenic
1203364059 Un_KI270442v1:242692-242714 CCAGGCGTGCAGGGTGTGTGGGG - Intergenic
1187720913 X:22149973-22149995 CCAGTGATGAGGGGGGCTTGGGG - Intronic
1188092169 X:25977170-25977192 CCAGTGAGGAAGGATGTGTCAGG - Intergenic
1188425770 X:30045001-30045023 CCTGTGATGATGGGTGTATCAGG - Intergenic
1189286989 X:39858647-39858669 CCATAGATGAATGGGGTGTGGGG + Intergenic
1190322754 X:49188158-49188180 GGAGTGGGGAAGGGTGTGTGTGG + Exonic
1190946327 X:55097504-55097526 CCAGTCATGAAGGCTGTGAGTGG - Intronic
1191923630 X:66284684-66284706 CCAGTGAGGAAGAATGTGAGGGG + Intergenic
1193073626 X:77332749-77332771 CCAGTGAGGAGGAGTGTGTCAGG + Intergenic
1193216957 X:78875285-78875307 CCAGTGAAGAAGGATGGGTTGGG - Intergenic
1194601181 X:95923667-95923689 CCAGTGAGGATGTGTGTTTGGGG - Intergenic
1195979349 X:110561151-110561173 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
1196054484 X:111340287-111340309 CCAGTGAGGAAGGATGAGTCAGG - Intronic
1196928315 X:120656022-120656044 ACAGTGAGGAAGAGTGTTTGCGG - Intergenic
1196966801 X:121065116-121065138 CCAGTGATGATGTGTGTTTGGGG + Intergenic
1197195287 X:123693705-123693727 CCTGTGATGTAGGCTCTGTGAGG - Intronic
1199308226 X:146292611-146292633 CCAGTGAGGAAGGATGGGTCAGG + Intergenic
1200320177 X:155180238-155180260 CCAGAGATGAAGGGTGGGGAGGG - Intergenic
1202092536 Y:21208943-21208965 CCAGTGAAGAAAGATGTGTCAGG - Intergenic