ID: 968545134

View in Genome Browser
Species Human (GRCh38)
Location 4:1194430-1194452
Sequence GGCACGCCAGCCGCTCCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1616
Summary {0: 1, 1: 0, 2: 1, 3: 81, 4: 1533}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968545134_968545149 27 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
968545134_968545147 12 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545147 4:1194465-1194487 TGGGAAGAAACGGGGAAGCCGGG 0: 1
1: 0
2: 1
3: 30
4: 313
968545134_968545140 -7 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545140 4:1194446-1194468 GCGTGCCCTGCAGGGGGAGTGGG No data
968545134_968545139 -8 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545139 4:1194445-1194467 GGCGTGCCCTGCAGGGGGAGTGG No data
968545134_968545144 3 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545144 4:1194456-1194478 CAGGGGGAGTGGGAAGAAACGGG 0: 1
1: 0
2: 3
3: 68
4: 610
968545134_968545146 11 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545146 4:1194464-1194486 GTGGGAAGAAACGGGGAAGCCGG 0: 1
1: 0
2: 1
3: 48
4: 598
968545134_968545143 2 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545143 4:1194455-1194477 GCAGGGGGAGTGGGAAGAAACGG 0: 1
1: 1
2: 10
3: 148
4: 1290
968545134_968545148 18 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545148 4:1194471-1194493 GAAACGGGGAAGCCGGGCCGCGG No data
968545134_968545145 4 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545145 4:1194457-1194479 AGGGGGAGTGGGAAGAAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968545134 Original CRISPR GGCACGCCAGCCGCTCCATC CGG (reversed) Intronic