ID: 968545141

View in Genome Browser
Species Human (GRCh38)
Location 4:1194451-1194473
Sequence TTCTTCCCACTCCCCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 372}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968545141_968545154 18 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545154 4:1194492-1194514 GGTAGCGCAGGCCGCAGGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 180
968545141_968545156 27 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545156 4:1194501-1194523 GGCCGCAGGCAGGGCTGTGTGGG 0: 1
1: 0
2: 2
3: 47
4: 411
968545141_968545153 17 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545153 4:1194491-1194513 CGGTAGCGCAGGCCGCAGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 138
968545141_968545149 6 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
968545141_968545147 -9 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545147 4:1194465-1194487 TGGGAAGAAACGGGGAAGCCGGG 0: 1
1: 0
2: 1
3: 30
4: 313
968545141_968545151 13 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545151 4:1194487-1194509 GCCGCGGTAGCGCAGGCCGCAGG 0: 1
1: 0
2: 4
3: 15
4: 129
968545141_968545148 -3 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545148 4:1194471-1194493 GAAACGGGGAAGCCGGGCCGCGG No data
968545141_968545146 -10 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545146 4:1194464-1194486 GTGGGAAGAAACGGGGAAGCCGG 0: 1
1: 0
2: 1
3: 48
4: 598
968545141_968545155 26 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545155 4:1194500-1194522 AGGCCGCAGGCAGGGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968545141 Original CRISPR TTCTTCCCACTCCCCCTGCA GGG (reversed) Intronic