ID: 968545142

View in Genome Browser
Species Human (GRCh38)
Location 4:1194452-1194474
Sequence TTTCTTCCCACTCCCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 383}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968545142_968545151 12 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545151 4:1194487-1194509 GCCGCGGTAGCGCAGGCCGCAGG 0: 1
1: 0
2: 4
3: 15
4: 129
968545142_968545148 -4 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545148 4:1194471-1194493 GAAACGGGGAAGCCGGGCCGCGG No data
968545142_968545153 16 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545153 4:1194491-1194513 CGGTAGCGCAGGCCGCAGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 138
968545142_968545149 5 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
968545142_968545156 26 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545156 4:1194501-1194523 GGCCGCAGGCAGGGCTGTGTGGG 0: 1
1: 0
2: 2
3: 47
4: 411
968545142_968545147 -10 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545147 4:1194465-1194487 TGGGAAGAAACGGGGAAGCCGGG 0: 1
1: 0
2: 1
3: 30
4: 313
968545142_968545155 25 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545155 4:1194500-1194522 AGGCCGCAGGCAGGGCTGTGTGG No data
968545142_968545154 17 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545154 4:1194492-1194514 GGTAGCGCAGGCCGCAGGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968545142 Original CRISPR TTTCTTCCCACTCCCCCTGC AGG (reversed) Intronic