ID: 968545149

View in Genome Browser
Species Human (GRCh38)
Location 4:1194480-1194502
Sequence AAGCCGGGCCGCGGTAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968545142_968545149 5 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
968545141_968545149 6 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
968545134_968545149 27 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968545149 Original CRISPR AAGCCGGGCCGCGGTAGCGC AGG Intronic