ID: 968545149

View in Genome Browser
Species Human (GRCh38)
Location 4:1194480-1194502
Sequence AAGCCGGGCCGCGGTAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968545142_968545149 5 Left 968545142 4:1194452-1194474 CCTGCAGGGGGAGTGGGAAGAAA 0: 1
1: 0
2: 5
3: 45
4: 383
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
968545134_968545149 27 Left 968545134 4:1194430-1194452 CCGGATGGAGCGGCTGGCGTGCC 0: 1
1: 0
2: 1
3: 81
4: 1533
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
968545141_968545149 6 Left 968545141 4:1194451-1194473 CCCTGCAGGGGGAGTGGGAAGAA 0: 1
1: 0
2: 3
3: 51
4: 372
Right 968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968545149 Original CRISPR AAGCCGGGCCGCGGTAGCGC AGG Intronic
900261038 1:1729658-1729680 AAGACCGGCTGCGGTAGCTCAGG - Intronic
902505428 1:16936730-16936752 GAGCCGGGCCGAGGCAGCCCTGG + Exonic
904287596 1:29462182-29462204 AAGCCTGGCCGTGGTGGGGCAGG - Intergenic
907541090 1:55215695-55215717 AAGCCGGGTCGCGGCTGCGGAGG - Intergenic
915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919846933 1:201648409-201648431 AAGCCGGGGAGCGATAGGGCGGG - Exonic
923506484 1:234609847-234609869 AAGACGGGCCGCGCGGGCGCGGG + Intergenic
1065093182 10:22253772-22253794 AAGCCGAGCCGCGGGTGGGCAGG - Intergenic
1071858011 10:89645166-89645188 AAGGCGGGCGGCGGGAGCCCCGG - Exonic
1073875282 10:107914993-107915015 AAGTCGGGCCGCGGCGGGGCGGG + Intergenic
1074008941 10:109457043-109457065 AAGTCGGGCCGCGGCGGGGCAGG + Intergenic
1077038475 11:506920-506942 AGGCGGGGCCGAGGTTGCGCTGG - Intronic
1078594291 11:12673979-12674001 AGTCCGGGACGCGGAAGCGCGGG - Intergenic
1080836305 11:35944069-35944091 ACGCCGGGCAGCGGGAGCGGCGG + Exonic
1083667882 11:64285383-64285405 GAGCAGGGCCGCGGGCGCGCCGG + Intronic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1089539172 11:119179728-119179750 AAGCCGGGAGGCGGTGGCTCAGG + Exonic
1091243204 11:134069042-134069064 AAGCCGCGCCGCGCTGCCGCTGG + Exonic
1093773678 12:23047635-23047657 AAGCCGGGAGGTGGTAGAGCTGG + Intergenic
1107779014 13:43879222-43879244 AAGCCGGGCGGCGGGAACGGCGG - Intronic
1114633274 14:24172945-24172967 AAGCGGGGCCGCGGCAGGCCGGG - Exonic
1116835801 14:49768218-49768240 GAGCCGGGCGGCGGCGGCGCGGG - Exonic
1122418571 14:101561643-101561665 AGGCCGTGCCGAGGAAGCGCGGG - Exonic
1128866037 15:71115737-71115759 AAGCCGGGTCGGGGCCGCGCGGG - Intronic
1133522599 16:6573741-6573763 AAGCCCGGCTGCGGGAGAGCTGG + Intronic
1134156926 16:11851581-11851603 AAGCCCGGCCCCGGAAGCGAGGG + Exonic
1142312334 16:89321305-89321327 AAGCCGGGGAGAGGCAGCGCCGG - Intronic
1144171762 17:12665516-12665538 AAGCCCGGCCGGGGAAGCCCCGG + Intergenic
1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG + Intronic
1147600725 17:41743704-41743726 AAGCCAGGCAGAGGTAGGGCAGG + Intergenic
1151544115 17:74781843-74781865 AAGCCGGGCAGGGGTGGGGCTGG - Intronic
1152356838 17:79811620-79811642 AAGACGGGCGGAGGTCGCGCTGG - Intergenic
1152410310 17:80119736-80119758 CAGCCGGGCAGCGGTCGCGTTGG - Intergenic
1153900703 18:9614731-9614753 AAGGCGGGAGGCGGGAGCGCCGG - Intronic
1163365092 19:16871401-16871423 GAGCCGGGCCGGGGTGGGGCCGG + Intronic
1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG + Intronic
926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG + Exonic
932567491 2:72918720-72918742 AAGCCGGGCGGAGGGAGAGCGGG - Intronic
937991423 2:127664374-127664396 CAGCCGGGCCGCCATGGCGCGGG + Exonic
947736541 2:232458161-232458183 AAGGCGGGGCGCGGCAGGGCAGG + Intronic
1168913202 20:1466600-1466622 GGGTCGGGCCGCGGTAGAGCGGG + Intronic
1180098710 21:45574385-45574407 GAGCCGGGCCGGGGTGGGGCAGG - Intergenic
1181652963 22:24271047-24271069 ACGCCCGGGCGCGGCAGCGCGGG - Intronic
1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG + Exonic
1184711169 22:46250301-46250323 TGGCCGGGCCGCGGTGGGGCGGG - Exonic
950677655 3:14564377-14564399 AAGCCAGGCCACGGCAGTGCCGG + Intergenic
954468866 3:50674941-50674963 GAGCCGAGCCGCGGCGGCGCCGG + Intergenic
962322989 3:134406770-134406792 GAGACGCGCCGCGGCAGCGCCGG + Intergenic
962498579 3:135966318-135966340 AAGTCGGGCCGAGGTTGGGCAGG - Intronic
963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG + Intronic
967098266 3:186194677-186194699 AAGCCAGGACTCGGTAGCTCCGG + Intronic
968077407 3:195824117-195824139 AAGCAGGGCCTGGGTGGCGCTGG + Intergenic
968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG + Intronic
968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG + Intronic
972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG + Intergenic
975139190 4:70902653-70902675 ACGCCGGGCCCCGGGAGCGCTGG - Intronic
1007533544 6:42564279-42564301 TCTCCGGGCGGCGGTAGCGCTGG + Exonic
1018834631 6:167473651-167473673 CAGCTGGGCCACGGTAGAGCTGG + Intergenic
1021717709 7:23474320-23474342 AAGCCGGCCCCGGGGAGCGCGGG - Intergenic
1033206154 7:139424827-139424849 AAGCCTGGCAGGGGTAGGGCAGG - Intergenic
1034278922 7:149838441-149838463 ACGTCGGGGGGCGGTAGCGCCGG - Exonic
1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG + Intronic
1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG + Intergenic
1055069323 9:72149929-72149951 AGTCCGGGCTGCGGTAGAGCCGG + Intronic
1057950141 9:99363357-99363379 CAGCCGGGCTGCCGTAGGGCTGG + Intergenic
1060945830 9:127568994-127569016 CAGCCGGGCGGCGGGAGCGGCGG - Exonic
1061560124 9:131396605-131396627 AAGACCGGGCGCGGTAGCTCAGG - Intronic
1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG + Intergenic