ID: 968546703

View in Genome Browser
Species Human (GRCh38)
Location 4:1202639-1202661
Sequence CGCTGGTGGCCCTGCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968546699_968546703 -6 Left 968546699 4:1202622-1202644 CCCAGGCTGTGCTTGCTCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 968546703 4:1202639-1202661 CGCTGGTGGCCCTGCAGTCCTGG 0: 1
1: 0
2: 0
3: 34
4: 274
968546698_968546703 1 Left 968546698 4:1202615-1202637 CCGCTCTCCCAGGCTGTGCTTGC 0: 1
1: 1
2: 10
3: 45
4: 423
Right 968546703 4:1202639-1202661 CGCTGGTGGCCCTGCAGTCCTGG 0: 1
1: 0
2: 0
3: 34
4: 274
968546697_968546703 5 Left 968546697 4:1202611-1202633 CCTGCCGCTCTCCCAGGCTGTGC 0: 1
1: 0
2: 2
3: 58
4: 447
Right 968546703 4:1202639-1202661 CGCTGGTGGCCCTGCAGTCCTGG 0: 1
1: 0
2: 0
3: 34
4: 274
968546701_968546703 -7 Left 968546701 4:1202623-1202645 CCAGGCTGTGCTTGCTCGCTGGT 0: 1
1: 0
2: 5
3: 51
4: 207
Right 968546703 4:1202639-1202661 CGCTGGTGGCCCTGCAGTCCTGG 0: 1
1: 0
2: 0
3: 34
4: 274
968546696_968546703 9 Left 968546696 4:1202607-1202629 CCTGCCTGCCGCTCTCCCAGGCT 0: 1
1: 1
2: 4
3: 67
4: 602
Right 968546703 4:1202639-1202661 CGCTGGTGGCCCTGCAGTCCTGG 0: 1
1: 0
2: 0
3: 34
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968546703 Original CRISPR CGCTGGTGGCCCTGCAGTCC TGG Intronic
900158378 1:1212485-1212507 TGCTGGTGGCCCTGGGGGCCTGG - Intronic
900174356 1:1285264-1285286 CGCTGGAGGCTCTGGAGTCCTGG - Intronic
900202161 1:1413562-1413584 CGGTGGGGGCCGTCCAGTCCCGG + Intergenic
900210231 1:1451943-1451965 CGCTTGGAGCCCTGCGGTCCTGG + Intronic
900265871 1:1756942-1756964 GGCTCGTGGCCCTGGAGGCCGGG - Intronic
900534765 1:3171414-3171436 CGCAGGAGGCTCTGCAGGCCAGG - Intronic
900678387 1:3902351-3902373 CGCAGGTGGCTGCGCAGTCCAGG + Intergenic
901597887 1:10399387-10399409 CGCAGGTGTCCCTGCAGACTCGG - Intronic
903259438 1:22123318-22123340 CCCTGGTGGCCCTGCACCCCAGG - Intronic
903743560 1:25572300-25572322 CGCTGGAGTCCCTGCAGCCTGGG + Intergenic
904855088 1:33491661-33491683 AGCTGGGGCCCCTGCAATCCTGG - Exonic
906525281 1:46489974-46489996 CTCTTGCGGTCCTGCAGTCCCGG + Intergenic
906877698 1:49556887-49556909 CGCGGGTGGGCCTGCAGTGCTGG + Intronic
906960655 1:50417634-50417656 CGCTGCGGGCCCTTCAGTCAGGG + Exonic
907598768 1:55745728-55745750 TGCTGGTGGCCCTACAGCTCTGG + Intergenic
909206064 1:72759277-72759299 CACTGGTGGCTGTGCAGTTCTGG + Intergenic
909878921 1:80848176-80848198 TGCTGGTGGCCCTACAATTCTGG + Intergenic
909904554 1:81178793-81178815 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
916144624 1:161727418-161727440 GGCGGGTGGCCCCGCAGTCGGGG - Exonic
917060618 1:171033285-171033307 CGCTGGTCGCCCTTCACCCCAGG + Intronic
917959010 1:180127874-180127896 TGCTGGGAGCCATGCAGTCCTGG - Intergenic
918457619 1:184739960-184739982 TGCTGGTGGCCCTGCATACATGG + Intronic
918853199 1:189718484-189718506 CGCTGGTGGGCCAGCACTGCTGG + Intergenic
920049887 1:203157511-203157533 TGCTGGTGGTCCTACAGTGCTGG + Intronic
920883142 1:209898986-209899008 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
921692268 1:218164933-218164955 CGCTGCGCGCCCTCCAGTCCCGG + Intergenic
922805725 1:228387792-228387814 CTCAGGTGGCCCTGGTGTCCTGG + Intergenic
923323515 1:232859791-232859813 CCCTGGTGCAGCTGCAGTCCAGG - Intergenic
1064782144 10:18853873-18853895 CGATGGTGTGCCTGTAGTCCTGG + Intergenic
1065589686 10:27252022-27252044 CACTGCAGGCCCTGGAGTCCTGG - Intergenic
1066132688 10:32409577-32409599 CACTGGTGGCCCTAGAGTTCTGG - Intergenic
1066544234 10:36482184-36482206 CGCTGGTGGGCTGGCAGTGCTGG + Intergenic
1067275279 10:44828371-44828393 CGCTGGAGGCCCTGAAGATCAGG - Intergenic
1069573596 10:69509020-69509042 GGCTGGAGGCCTTGTAGTCCTGG + Intergenic
1070384202 10:75909417-75909439 CTCTGATGTCCCTGCAGCCCTGG + Intronic
1070395766 10:76010166-76010188 AGCTGGTGGCCTTACTGTCCCGG + Intronic
1071527399 10:86366461-86366483 CGCTGGTCCCGGTGCAGTCCCGG + Exonic
1072089655 10:92115121-92115143 CGGTGGTGGCCCGGCGGTCCCGG - Intronic
1074996330 10:118760333-118760355 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
1075450858 10:122551235-122551257 CCCTGGGGGCCCTGAAGCCCTGG - Intergenic
1075587291 10:123667054-123667076 TGCTGGTGGACCTGCACCCCAGG + Exonic
1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG + Intronic
1080107491 11:28525986-28526008 CGCTGGTGGGCCAGCACTGCTGG + Intergenic
1081345801 11:41984289-41984311 CGCTTGTGGCCCTGTATTCAAGG - Intergenic
1083284257 11:61647824-61647846 TGCTGCTGCCCCTTCAGTCCAGG + Intergenic
1087407304 11:97745804-97745826 CGCTGGTGGGCCAGCACTGCTGG + Intergenic
1088698800 11:112393194-112393216 CGCTCCTGTCCCTCCAGTCCAGG - Intergenic
1089215239 11:116830875-116830897 CCCAGGTGGCCCAGCAGGCCAGG + Exonic
1089493803 11:118898761-118898783 CGCTGGACGCCCTGCTGGCCTGG + Exonic
1089621282 11:119723858-119723880 TGCTGCTGGCTCTGCAGACCTGG + Intronic
1089666877 11:120026073-120026095 CGCTGGTGGGCCAGCACTGCTGG - Intergenic
1089678392 11:120105810-120105832 CCCTGGTGGCCATGCAGTCATGG - Intergenic
1090392550 11:126398519-126398541 CACTGGTAGCTCTGCAGTTCTGG + Intronic
1091226030 11:133956867-133956889 CGCCGGTGCTCCTGCAGCCCGGG + Exonic
1091714375 12:2766644-2766666 CCCTGGTGGCCCTGCAGGAAAGG + Intergenic
1092241668 12:6839682-6839704 CGCTGCCGGACCTGCAGCCCTGG + Exonic
1092786566 12:12032269-12032291 TCCTGGTGACCCTGCAATCCTGG + Intergenic
1093381579 12:18500320-18500342 CGCTGGTGGGCCGGCACTGCTGG - Intronic
1094390589 12:29945687-29945709 CGATGGTGAACCTGGAGTCCTGG - Intergenic
1094485735 12:30925280-30925302 CCGTGGTGTCCCTGCAGCCCGGG + Intergenic
1095587421 12:43864068-43864090 CGCTGGTGGGCCAGCACTGCTGG - Intronic
1096656961 12:53097955-53097977 GGCGGATGGCACTGCAGTCCTGG - Exonic
1097017913 12:56000329-56000351 CGCTGGTGGGCCGGCACTGCTGG + Intronic
1097253692 12:57655941-57655963 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
1098557398 12:71835048-71835070 CTCTGGAGCCCATGCAGTCCTGG - Intergenic
1099413703 12:82361603-82361625 CGCTGGTGGGCCGGCACTGCTGG + Intronic
1100584706 12:95969309-95969331 CGCTGGTGGGCCAGCACTGCTGG - Intergenic
1103508209 12:121455350-121455372 TGTGGGTGGCCCTGCAGTCCAGG - Intronic
1104687975 12:130802243-130802265 CGACGGTGCCCCTGCACTCCAGG - Intronic
1104989659 12:132618634-132618656 CGCAGGTGTCCCGGGAGTCCCGG - Intergenic
1105454225 13:20525713-20525735 CGCTGCTGCCCCTGGAGCCCGGG - Intronic
1105871132 13:24506992-24507014 CGCTGGTGGGCCGGCACTGCTGG + Intronic
1106617055 13:31339852-31339874 CGCTGGTGGGCCAGCACTGCTGG + Intergenic
1109232411 13:59774771-59774793 TGCTGGAGGCCTTGCAGTCCGGG - Exonic
1109721639 13:66283190-66283212 GGCTGGTGGCCTTACAGTTCTGG + Intergenic
1112226512 13:97545451-97545473 CGCTGGTGGGCCAGCACTGCTGG - Intergenic
1113786784 13:113006266-113006288 CACTGCCTGCCCTGCAGTCCTGG + Intronic
1113811388 13:113144495-113144517 CGCTGATGCCCCTGCAGTGTGGG - Intronic
1115993892 14:39175666-39175688 CGCTCTCGGCCCTGCAGGCCCGG + Intronic
1116624025 14:47242618-47242640 CGCTGGTGGGCCAGCACTGCTGG - Intronic
1116656971 14:47665705-47665727 TGCTGGTGGGCCAGCAGTGCTGG - Intronic
1121283438 14:92715771-92715793 GGCTGGTGGCCCTGCAATCTGGG + Intronic
1121304335 14:92896748-92896770 CGCTCATGTCCTTGCAGTCCAGG - Intergenic
1122895844 14:104756532-104756554 GGCAGGTAGCCCGGCAGTCCCGG + Intronic
1122917913 14:104867265-104867287 CGCTTGTGGGACTGCATTCCAGG - Intronic
1122973393 14:105161414-105161436 CCCTGCTGGCCCTGAAGCCCAGG - Intronic
1123060599 14:105592535-105592557 CGATGCTGGCCCTGGAGTCGGGG + Intergenic
1123085077 14:105713506-105713528 CGATGCTGGCCCTGGAGTCGGGG + Intergenic
1124105831 15:26737032-26737054 CGGTGGTGTCCCTGGAGGCCTGG - Intronic
1124372536 15:29111744-29111766 CACTTGTGCCCCTGCAGGCCAGG + Intronic
1124578013 15:30926407-30926429 CACTGGTAACCCTGCAGCCCGGG - Intronic
1125728303 15:41879355-41879377 AGCTGGAGGCCCTGCAGCCAGGG - Exonic
1126639683 15:50812143-50812165 CGCTGGTGGGCCAGCACTGCTGG - Intergenic
1127211586 15:56779792-56779814 CGCTGGTGGGCCAGCACTGCTGG - Intronic
1128367076 15:67012099-67012121 GGCTGGTGGCCTTCCTGTCCAGG - Intergenic
1129255404 15:74331343-74331365 CCCTGGAGGCCCTGCCTTCCTGG + Intronic
1132309616 15:100848032-100848054 CACTGGTGGCCCTGCAAATCGGG - Intergenic
1132679581 16:1134253-1134275 CCTCGGGGGCCCTGCAGTCCTGG - Intergenic
1132731087 16:1362374-1362396 TGCTGGAGGCCCTGTAGTGCTGG + Intronic
1132738849 16:1401048-1401070 GGCTGGGGGACCTGCATTCCTGG - Intronic
1132864765 16:2087915-2087937 ACCTGGTGTCCCTGCAGTGCAGG + Exonic
1133735294 16:8610407-8610429 TCCTGGTGGCCCTGCAATCCTGG - Intergenic
1133809934 16:9154136-9154158 TGCTGGGGGCCCTGGAGTCTAGG - Intergenic
1134529907 16:14975165-14975187 CGGTGGTGGCCTGGCGGTCCCGG - Exonic
1136394403 16:29985304-29985326 AGCTGCTGGCCCTGGAGTCACGG + Exonic
1139866438 16:70065789-70065811 CGGTGGTGGCCCGGCGGTCCCGG + Intergenic
1141475457 16:84270191-84270213 AGCAGCTGGCCCTGGAGTCCTGG - Intergenic
1141543424 16:84745188-84745210 CTCTGGCTGCCCTGCAGTCCTGG - Exonic
1142212781 16:88816359-88816381 GGCTGGTGGCCCTGGGCTCCTGG + Intronic
1143625227 17:8106062-8106084 GGGTGGTGGCCCTGCAGGCTTGG + Intronic
1144501009 17:15786659-15786681 CGCGGATGGCCCCGCAGCCCTGG + Intergenic
1145163176 17:20589334-20589356 CGCGGATGGCCCCGCAGCCCTGG + Intergenic
1146720450 17:35119888-35119910 CGCAGATGGCGCTGCAGGCCAGG - Intronic
1146740458 17:35279100-35279122 CGCTGGTGGGCTGGCAGTTCTGG + Intergenic
1148744086 17:49908750-49908772 CCCTGGTGGCCCTGGCCTCCAGG - Intergenic
1148808623 17:50277038-50277060 CCCTGGGTGCCCTGCAGACCTGG + Intronic
1148896760 17:50843405-50843427 GACTGGGGGCCCTGCTGTCCCGG - Intergenic
1150134191 17:62686619-62686641 TGCTAGTGGCCCTGCCCTCCAGG - Intronic
1150301247 17:64048988-64049010 CTCAGGTGGCCCTGCAGAGCTGG - Intronic
1150650436 17:67006415-67006437 AGCAGGTGGGGCTGCAGTCCTGG - Intronic
1151567454 17:74907227-74907249 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
1152031615 17:77846596-77846618 AGGTGCTGGCCCTGAAGTCCTGG + Intergenic
1153202111 18:2656572-2656594 CGGTTGCGGCCCTGCAGTCTAGG + Intronic
1153236589 18:2994426-2994448 CACTGGTGGCCATGGAGGCCGGG + Intronic
1154047131 18:10916469-10916491 CGCTGGCGGCCCAGGAGTGCTGG + Intronic
1154356744 18:13627423-13627445 CGCTGGGGACCCTTCAGTGCCGG + Intronic
1155108798 18:22693516-22693538 AGCTTCTGGTCCTGCAGTCCAGG + Intergenic
1158922931 18:62214488-62214510 AGCTGGTAGCTCTGCAGTTCTGG + Intronic
1159586896 18:70289705-70289727 CGCTGGTGGAGGTGCAGGCCGGG + Intronic
1161218459 19:3106479-3106501 CTCTGGTGGCCCTGAGGTGCTGG - Intronic
1161409219 19:4107571-4107593 TGCTGGTGCACCTGTAGTCCCGG + Intronic
1161567997 19:5013975-5013997 AGCCCGTGGCCCGGCAGTCCAGG + Intronic
1164615736 19:29665816-29665838 CGCTGAGACCCCTGCAGTCCCGG - Intronic
1165999079 19:39866976-39866998 CACGGGTGGCCCAGCAGTTCCGG + Exonic
1166703600 19:44896153-44896175 CACTGGTGGCCCTGGGCTCCAGG - Intronic
1167435985 19:49478976-49478998 AGCTGGTGGCGCTGAAGCCCTGG + Exonic
1168311797 19:55464444-55464466 TGCTGCGGGCCCTGCAGCCCCGG - Intergenic
926167612 2:10531248-10531270 CCATGGTGGCTCTGCACTCCAGG - Intergenic
930023672 2:47016698-47016720 AGCTGGTGGCTCTGTAGTCCAGG - Intronic
932216600 2:69970132-69970154 CACTGGCGACCCAGCAGTCCAGG - Intergenic
932239943 2:70148480-70148502 CGCTGGTGGGCCAGCACTGCTGG - Intergenic
932894971 2:75630737-75630759 AGATGGTGCCACTGCAGTCCAGG + Intergenic
933864730 2:86505825-86505847 CTCTGGAGGCCATGCAGTCCCGG - Exonic
934915863 2:98300587-98300609 CCCTGCTGGCCCTGCAGACTTGG + Intronic
936644088 2:114348961-114348983 TGCTGGTGGCCCTACAGTTCTGG + Intergenic
937789426 2:125943110-125943132 CGCAGGTGGGCCGGCAGTGCTGG + Intergenic
938726022 2:134109531-134109553 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
938986512 2:136581543-136581565 TCCTGGTGACCCTGCAATCCTGG + Intergenic
939869063 2:147507083-147507105 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
941309793 2:163913788-163913810 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
947506792 2:230713462-230713484 CGCCCGGGGGCCTGCAGTCCAGG + Intronic
947919172 2:233854528-233854550 CGCGCGAGGCCCTGCAGTCCGGG - Exonic
948611378 2:239169366-239169388 TGCTGGTGACGCTGCAGTGCAGG - Intronic
948834593 2:240620051-240620073 AGAGGGTGGCCCTGCTGTCCAGG + Intronic
1169342141 20:4804780-4804802 CGATGGTGGCTCAGCAGTCAAGG + Intronic
1169488384 20:6052308-6052330 CGCTGCGGGCGCTGCAGCCCCGG - Exonic
1170333682 20:15244431-15244453 CCCTGGTATCCCTGCTGTCCAGG - Intronic
1171398696 20:24857719-24857741 CGAGGGAGGCCCTGCAGCCCTGG + Intergenic
1172224656 20:33297344-33297366 CCCAGGTGGCCCTGCAGGCTGGG + Intronic
1172630191 20:36373269-36373291 TCCTGGTGGCCCTGAGGTCCTGG - Intronic
1172884563 20:38222518-38222540 CGCTGGAGGCCCAGTAGGCCGGG + Exonic
1173605245 20:44326936-44326958 CGCGCGGGGCCCCGCAGTCCCGG - Intergenic
1174177363 20:48653402-48653424 CGATGGTGCCCCTGAGGTCCTGG - Exonic
1174448823 20:50607919-50607941 CGCTCATGGGCATGCAGTCCAGG + Intronic
1174498855 20:50969474-50969496 CTCTGGTGGACCTGCAGACTGGG - Intergenic
1174518867 20:51114448-51114470 CGCTGGGGACCCTGCAGCGCAGG + Intergenic
1175177393 20:57120450-57120472 CCCTGGTGGCATTGCTGTCCTGG + Intergenic
1175495941 20:59414191-59414213 CGCTACTGGCCCTACAGGCCAGG - Intergenic
1175943315 20:62547737-62547759 GGCTGGTGCCCCTGCAGACCTGG - Intergenic
1175957529 20:62618922-62618944 CCCTGGTGGTCCTCCAGCCCTGG - Intergenic
1178666245 21:34549555-34549577 TGCTGGTGACCCTCCAGTCCAGG + Intronic
1178700348 21:34828029-34828051 CACTGGTGGCTCTGCAGTTCTGG - Intronic
1180159864 21:45994208-45994230 CGTTGGTGTCCCTGGAGACCCGG + Exonic
1180833792 22:18919769-18919791 AGCTGGAGCCCCTGCTGTCCCGG - Exonic
1181007548 22:20021166-20021188 CGCTAGTGGCCCGGCCGGCCTGG + Intronic
1181066034 22:20306472-20306494 AGCTGGAGCCCCTGCTGTCCCGG + Intergenic
1182021073 22:27081939-27081961 ATCTGGTGGCCCTACCGTCCAGG + Intergenic
1182298999 22:29327608-29327630 CCCTGGGGTCCCTGCAGCCCGGG + Intergenic
1182537916 22:31019795-31019817 CGCTGGTAGCACTACAGTTCTGG + Intergenic
1183555611 22:38524371-38524393 CACCGGTGGCCCTCCAGCCCAGG + Intronic
1183715193 22:39529311-39529333 AGCTGGTGGGCCGGAAGTCCTGG - Exonic
1185013253 22:48328196-48328218 GGCAGGTGGCCCCTCAGTCCAGG - Intergenic
1203283878 22_KI270734v1_random:145067-145089 AGCTGGAGCCCCTGCTGTCCCGG - Intergenic
950286824 3:11751611-11751633 CGCTGGTGGCCCTCCAGGGTTGG - Intergenic
950854491 3:16092321-16092343 AGCTGGGAGCCCAGCAGTCCTGG + Intergenic
952744533 3:36764542-36764564 CGCTCCTGGCCCTGGAGGCCGGG + Intergenic
954422033 3:50423888-50423910 GGCAGGAGGCCCTGCAGCCCAGG + Intronic
956438831 3:69260449-69260471 CGCAGGTGGGCCAGCAGTGCTGG - Intronic
957419660 3:79951556-79951578 CGCTGGTGGGCCAGCACTGCTGG + Intergenic
957995113 3:87679273-87679295 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
959460793 3:106623211-106623233 CCCTTGTGGCTCTGCAGTTCTGG + Intergenic
961165829 3:124763280-124763302 GGCTGGGGGCCCAGCATTCCTGG + Exonic
961384796 3:126517459-126517481 GGCTGGAGCCCCTGGAGTCCAGG + Intronic
963041133 3:141070918-141070940 GGCTGGTGACCGTGCAGCCCAGG + Intronic
964877527 3:161385165-161385187 CACAGGTGGCCATGCATTCCTGG + Intergenic
966108197 3:176362408-176362430 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
966988538 3:185204611-185204633 GGCTTGTGTCCGTGCAGTCCAGG - Exonic
967891852 3:194369449-194369471 GGCTGGTGGTCCTGGTGTCCAGG + Intronic
968232651 3:197012685-197012707 CCCCCGTGGCCCTGCAGTCAGGG - Intronic
968546703 4:1202639-1202661 CGCTGGTGGCCCTGCAGTCCTGG + Intronic
968583551 4:1405789-1405811 CGATGCAGGCCCTGCAGTCCGGG + Intronic
968626730 4:1629242-1629264 CTCTGTGGGCCCTGGAGTCCTGG - Intronic
968712667 4:2130374-2130396 TGCTGGGGGCCCTGCTGTGCAGG - Intronic
968745450 4:2357507-2357529 AGCTGGTGGCTCTGCTGACCTGG - Intronic
970073779 4:12195039-12195061 TGCTGGTGGCTCTACCGTCCTGG + Intergenic
971027619 4:22604097-22604119 CGGTGGGGGCCATCCAGTCCCGG - Intergenic
971852106 4:31996564-31996586 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
971853129 4:32010176-32010198 TGCTGGTCGCCCTGCCGCCCGGG - Intergenic
972505772 4:39718686-39718708 CGCTGGTGGGCCAGCACTGCTGG + Intronic
977651363 4:99473279-99473301 TGCTGGTGGCTCTACAGTTCTGG + Intergenic
978207188 4:106092586-106092608 CGCTGGTGGGCCAGCACTGCTGG + Intronic
978748576 4:112222608-112222630 TGCTGGTGGGCCAGCAGTGCTGG - Intergenic
978998034 4:115179603-115179625 CGCCGGTGGGCCGGCAGTGCTGG + Intergenic
979224201 4:118265733-118265755 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
980815563 4:137942246-137942268 CGCTGGTGGGCCGGCAGTGCTGG - Intergenic
982919106 4:161251778-161251800 CTCTGGTGTTCCTGCAGTCATGG - Intergenic
983843167 4:172482057-172482079 CGCAGGTGGCCCAGCAGTGCTGG + Intronic
986333787 5:6737787-6737809 CGCCGGGGGCCATGCATTCCAGG - Intronic
986462084 5:7982853-7982875 TGATGGTGCCCCTGCACTCCAGG + Intergenic
986464280 5:8005925-8005947 TGCTGGTAGCTCTGCAGTTCAGG - Intergenic
986672831 5:10158243-10158265 GGCTGGTGGTTCTGCAGGCCAGG + Intergenic
987283741 5:16436358-16436380 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
987443862 5:17991958-17991980 AGCTGCTGGCCCAGCAGTCCTGG + Intergenic
988915885 5:35893052-35893074 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
991454448 5:66787625-66787647 AGCTGGTGGCCCTGCAGCACAGG - Intronic
992128406 5:73666372-73666394 AGCTGGTGGCCCTACAGTTCTGG + Intronic
993320923 5:86466866-86466888 CGCTGGTGGGCCAGCACTGCTGG + Intergenic
995372646 5:111436580-111436602 TGCTGCTGGCCCTGCAGTTGAGG - Intronic
996298545 5:121954123-121954145 CGCGGGTGGGCCGGCAGTGCTGG + Intergenic
998117549 5:139549519-139549541 AGCAGGTGGGCCTGCAGTGCTGG - Intronic
1000891808 5:166810380-166810402 CGCCGGTGGGCCGGCACTCCTGG + Intergenic
1001514096 5:172342903-172342925 GGCTCCTGGGCCTGCAGTCCTGG + Intronic
1001542232 5:172547696-172547718 CCCTGGTGTCCCTGCAGACCTGG - Intergenic
1001843572 5:174901694-174901716 CGCTGGTGGGCCAGCACTGCTGG - Intergenic
1002437791 5:179242788-179242810 CGCTGGTGGCCCATCTATCCTGG - Intronic
1002793216 6:450157-450179 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
1003069682 6:2935984-2936006 CGCCGGTGGGCCAGCAGTGCTGG - Intergenic
1004673864 6:17822911-17822933 GGCTTTTGGCCCTGCAGTGCAGG - Intronic
1006351088 6:33521692-33521714 CGCGGGCGGCCCGGCAGTGCTGG + Intergenic
1006446941 6:34084872-34084894 GGCTGGAGCCCCCGCAGTCCTGG + Intronic
1007925164 6:45644319-45644341 CGTGGGTGGGCCTGCAGTGCTGG + Intronic
1007989381 6:46239435-46239457 CGCTGGTCGCTCAGCAGACCTGG - Intronic
1008844845 6:55950486-55950508 CGCGGGTGGGCCAGCAGTGCTGG - Intergenic
1014559384 6:122872158-122872180 TGCTGGTAGCTCTACAGTCCTGG - Intergenic
1016084195 6:139892761-139892783 AGATGGTGCCCCTGCACTCCAGG + Intergenic
1016608688 6:145964044-145964066 CGCTGGTTGTCCTGGAGCCCGGG - Intronic
1016658145 6:146544024-146544046 CGATGGTGGCCCGGTAGTGCTGG - Exonic
1017656584 6:156634981-156635003 CGTTAGTGGCTCAGCAGTCCTGG - Intergenic
1017839496 6:158209972-158209994 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
1018017822 6:159727630-159727652 CGCTGCTTGCCCTGCCGCCCGGG - Intronic
1019000253 6:168743969-168743991 CGCTGGTGGGCCGGCACTGCTGG + Intergenic
1019072185 6:169356090-169356112 TGCTGGAGGCCCAGCAGTTCTGG + Intergenic
1019272311 7:157111-157133 CACTGGTTGCCCGGCCGTCCAGG - Intergenic
1019324850 7:432998-433020 CTCTGGTGGCCCTGCAGGGAGGG - Intergenic
1019548184 7:1588515-1588537 CGATGGTGGACATCCAGTCCAGG + Intergenic
1019704275 7:2490095-2490117 CCCTGGTGGCCCTGGGGGCCAGG - Intergenic
1019744928 7:2694300-2694322 CGATGGTGGACATCCAGTCCCGG - Intronic
1020077143 7:5265557-5265579 CCCTGGTGTCCCAGCAGTCCTGG - Intergenic
1023920524 7:44626008-44626030 ACCTGGTGGCCCAGCAGTCATGG - Intronic
1025201967 7:56968090-56968112 CCCTGGTGTCCCAGCAGTCCTGG + Intergenic
1025669980 7:63608838-63608860 CCCTGGTGTCCCAGCAGTCCTGG - Intergenic
1026516575 7:71078165-71078187 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
1027882541 7:83859657-83859679 AGCTGGTGCCACTGCACTCCAGG + Intergenic
1029614729 7:101649189-101649211 CACTGGTGTCCCTCCAATCCAGG - Intergenic
1030077028 7:105745721-105745743 GGCAGGAGGCCCTGGAGTCCCGG + Intronic
1030910784 7:115246350-115246372 TGCTGGTGGCCCTACAGTTCTGG + Intergenic
1031253128 7:119413537-119413559 CGCTGGTGGGCCAGCACTGCTGG + Intergenic
1031308514 7:120164248-120164270 CACTGGTGGCTCTACCGTCCTGG + Intergenic
1033839915 7:145360821-145360843 CGCTGGTGGGCCAGCACTGCTGG + Intergenic
1034222608 7:149458308-149458330 CGCTGGGGGCCCTGGAGGCTAGG + Intronic
1035424034 7:158755138-158755160 CGCTGGTGGCAATGCACTCCTGG + Intronic
1035548452 8:501822-501844 CACTGGCGTCCCTGCAGTCATGG + Intronic
1036225132 8:6951546-6951568 TCCTGGTGGCCCTGCAGGCTCGG - Intergenic
1036235914 8:7039386-7039408 TCCTGGTGGCCCTTCAGGCCTGG - Intergenic
1036739495 8:11347832-11347854 CGCTGGAGACTCTGCATTCCCGG + Intergenic
1037425598 8:18751227-18751249 CGCTGGTGGGCCGGCACTGCTGG + Intronic
1038530909 8:28317378-28317400 CCCTGGTGGCCCTGCCCTCCCGG - Intronic
1039311586 8:36322433-36322455 GGCTGGTGGCCCTCAAGGCCAGG - Intergenic
1039618321 8:38974531-38974553 GGCTGGAGGCACTGCAGCCCCGG - Exonic
1041537687 8:58945125-58945147 TGCTGGTGGGCCTGCAGCTCTGG + Intronic
1042169182 8:65975735-65975757 CGCTGGTGGCTCTACAGGTCTGG - Intergenic
1045059903 8:98402575-98402597 CGGAGGGGGCCCTGCTGTCCTGG + Intronic
1045933741 8:107655781-107655803 CGCGGGTGGGCCGGCAGTGCTGG - Intergenic
1046969246 8:120203293-120203315 TTCTGGTGGACCTGCAGTCTTGG - Intronic
1048087861 8:131203382-131203404 CACAGGTGGCCCTGCAGACATGG + Intergenic
1048995951 8:139793884-139793906 GACATGTGGCCCTGCAGTCCTGG - Intronic
1049415405 8:142492694-142492716 AGCTGGGTGCCCTGCAGCCCTGG + Intronic
1049785647 8:144449416-144449438 TGCTGCTGGCCCTGCATTCAGGG - Intergenic
1056926676 9:90840255-90840277 CGCTGCTGCTCCTGCAATCCTGG - Intronic
1057380269 9:94561035-94561057 CACTGGAGGCCATGCTGTCCAGG + Intronic
1057481282 9:95447351-95447373 GGCTGCTGGCCTTGCCGTCCGGG + Exonic
1060522232 9:124300422-124300444 GGCTGCTGGCCCAGCAGACCGGG + Intronic
1061601380 9:131672515-131672537 AACAGGTGGCCCTGCAGTGCTGG + Intronic
1062102736 9:134737052-134737074 TGCTGGTGACGCTACAGTCCTGG + Intronic
1062482012 9:136756910-136756932 CGCTGGTGGGCCAGCACTCCCGG - Intronic
1062555763 9:137112805-137112827 CGCCGCTGCCCCTGCACTCCAGG - Exonic
1062639645 9:137512011-137512033 CGGTAGTGGCCCTGAAGGCCTGG - Intronic
1186063104 X:5731815-5731837 CGCTTGGGGCCCTGCAGTCACGG + Intergenic
1187139057 X:16575628-16575650 CGCTGGTGGGCCGGCACTGCTGG - Intergenic
1190043044 X:47087240-47087262 CATTGTTGGCCCTGCTGTCCTGG + Intronic
1192869652 X:75173783-75173805 CGCTGGTGGGCTGGCACTCCTGG + Intergenic
1195510612 X:105712063-105712085 TGCTTGTGGCCCTACAGTTCTGG + Intronic
1200236097 X:154468442-154468464 CCATGGTGGCCCTGCAGAGCCGG + Exonic
1200711838 Y:6491549-6491571 CGATGGTGCCAATGCAGTCCAGG + Intergenic
1200986834 Y:9309827-9309849 CGATGGTGCCACTGCAGTCTAGG + Intergenic
1201016537 Y:9608520-9608542 CGATGGTGACACTGCAGTCCAGG + Intergenic
1201022098 Y:9670436-9670458 CGATGGTGCCAGTGCAGTCCAGG - Intergenic
1201240801 Y:11955079-11955101 CGCTGGAGGCCCTGCGCCCCTGG - Intergenic