ID: 968547905

View in Genome Browser
Species Human (GRCh38)
Location 4:1207979-1208001
Sequence GAGAGGCCCAGGGCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 531}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968547891_968547905 17 Left 968547891 4:1207939-1207961 CCTCCTGGTGCTTGATGCCAAGG 0: 1
1: 1
2: 1
3: 9
4: 133
Right 968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 68
4: 531
968547899_968547905 0 Left 968547899 4:1207956-1207978 CCAAGGGGAGCGGGTCAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 135
Right 968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 68
4: 531
968547887_968547905 24 Left 968547887 4:1207932-1207954 CCCCGTCCCTCCTGGTGCTTGAT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 68
4: 531
968547886_968547905 27 Left 968547886 4:1207929-1207951 CCACCCCGTCCCTCCTGGTGCTT 0: 1
1: 0
2: 0
3: 33
4: 278
Right 968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 68
4: 531
968547889_968547905 22 Left 968547889 4:1207934-1207956 CCGTCCCTCCTGGTGCTTGATGC 0: 1
1: 0
2: 2
3: 14
4: 230
Right 968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 68
4: 531
968547890_968547905 18 Left 968547890 4:1207938-1207960 CCCTCCTGGTGCTTGATGCCAAG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 68
4: 531
968547895_968547905 14 Left 968547895 4:1207942-1207964 CCTGGTGCTTGATGCCAAGGGGA 0: 1
1: 0
2: 1
3: 6
4: 148
Right 968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 68
4: 531
968547888_968547905 23 Left 968547888 4:1207933-1207955 CCCGTCCCTCCTGGTGCTTGATG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 68
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968547905 Original CRISPR GAGAGGCCCAGGGCCAGCCT GGG Intronic
900184393 1:1326083-1326105 GAGTGGCCCAGGCCCTGCTTTGG - Intronic
900210036 1:1450870-1450892 GTGGGGCCCAGGGCCAAGCTTGG + Intronic
900222397 1:1516200-1516222 GTGGGGCCCAGGGCCAAGCTTGG + Intronic
900266975 1:1762305-1762327 GCCAGGGCCAGGGCCAGCCTGGG + Intronic
900363425 1:2300801-2300823 GATGGGCTCAGGGCCATCCTTGG - Intronic
900392148 1:2438384-2438406 GAGGGGCCCAGGGTCAGCCCAGG + Intronic
900394743 1:2448656-2448678 GTGAGCTCCAGGGCCTGCCTCGG - Intronic
900406124 1:2493777-2493799 GGCAGGCCCAGGTCCAGGCTGGG + Intronic
900431488 1:2605107-2605129 GGCAGGCCCAGGGCTAGCCCAGG - Intronic
900462747 1:2809332-2809354 AAGCGGGCCAGGGCCAGCCCGGG - Intergenic
900466280 1:2827012-2827034 GAGAGGCCCAGGGCCAGGCCTGG + Intergenic
900516691 1:3085557-3085579 GAGAGGCCCAGGAGGAGCCGGGG - Intronic
900555349 1:3277515-3277537 GAGAGGGTCGGGGCCAGCCTGGG - Intronic
900643075 1:3696555-3696577 GAGATGCAGAGGGGCAGCCTGGG + Intronic
900712650 1:4124279-4124301 GAGAGGCCGATGGCCACACTGGG + Intergenic
900906437 1:5562897-5562919 CAGAGGCCCAGGTACAGCTTGGG - Intergenic
901006480 1:6174070-6174092 GAGAGGCCCAGGGCATGGGTGGG + Intronic
901056200 1:6449649-6449671 CAGGGGCCCTGGGCCAGCCAAGG + Intronic
901320251 1:8335656-8335678 GGGAGGCTCAGGGGCATCCTGGG - Intronic
901408167 1:9064108-9064130 GTGAGCCACAGTGCCAGCCTGGG + Intronic
901445872 1:9307881-9307903 GAGTGGCACAGGGTAAGCCTGGG - Intronic
901835227 1:11919803-11919825 GGGGGGCCCCGGCCCAGCCTCGG + Exonic
902195675 1:14796241-14796263 GAGAGGACCATGCCCAGCCCTGG - Intronic
902336384 1:15757321-15757343 GAGAGGCTCAAGGCCACACTAGG - Intronic
902691728 1:18114058-18114080 GTGATGACCAGTGCCAGCCTTGG + Intronic
902926180 1:19697227-19697249 GAGAGGCCCAGGGCACTCCCTGG - Intronic
903044051 1:20552812-20552834 GAGATGCCCAGTGCCAGGCAGGG - Exonic
903183067 1:21614796-21614818 GAGGAGCCCGGGGCCAGGCTGGG - Intronic
903406353 1:23100032-23100054 GAGAGGCCCAGATCTGGCCTGGG - Intronic
903557838 1:24206314-24206336 GGGAGACCCAGAGCCAGCCTGGG - Intergenic
903691280 1:25175324-25175346 GAGAGGCACTGGGCCTGTCTCGG - Intergenic
903820048 1:26095016-26095038 GGCAGGGGCAGGGCCAGCCTGGG + Intergenic
904004936 1:27358658-27358680 AAGTGGCATAGGGCCAGCCTGGG - Intronic
904237498 1:29124387-29124409 CAGACGCCAAGGGCCAGCCCGGG + Intergenic
904329186 1:29746748-29746770 GATCTGCCCAGGGCCAGCCCTGG - Intergenic
904330215 1:29753842-29753864 GACAGGCCCAGAGCCACCATGGG - Intergenic
904389623 1:30173717-30173739 GAGAGGCCCAGGCCCTGCCATGG + Intergenic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
905329930 1:37187426-37187448 CAGATGACCTGGGCCAGCCTGGG + Intergenic
905366333 1:37453611-37453633 AAGAGGCCCAGGGTCTTCCTTGG - Intergenic
905417313 1:37812834-37812856 GCGAGGCCCAGAGACAGCCAAGG + Exonic
906057158 1:42926421-42926443 GAGAGGGGAAGGGCCAGTCTGGG - Exonic
906264799 1:44420409-44420431 GAGGGGGCAAGGGCCAGCCCTGG + Intronic
906551003 1:46666424-46666446 GAGAGGGCAAGGGACAGCCTGGG + Intronic
907329221 1:53660449-53660471 GTGTGACCCAGGGCCAGTCTTGG - Intronic
907459147 1:54594802-54594824 GAGAGGCCCAGGGCCACCAGTGG - Intronic
907735034 1:57104024-57104046 GAGAGGCCCAGGACCCTCCAGGG - Intronic
909400122 1:75218708-75218730 CAGAGCCCCAGGGCAAGCTTTGG + Exonic
911055005 1:93701691-93701713 GAGAGGCCCAGGGGCAGGCCTGG - Intronic
912705218 1:111906600-111906622 GAGAGAACCAGGTCCAGCCTAGG - Intronic
912823199 1:112883649-112883671 GAGAGGCCCGGAGCCATCCTGGG - Intergenic
913960699 1:143336386-143336408 GGGAGGCCCATGGCCAGTCTCGG - Intergenic
914055053 1:144161958-144161980 GGGAGGCCCATGGCCAGTCTCGG - Intergenic
914124093 1:144804403-144804425 GGGAGGCCCATGGCCAGTCTCGG + Intergenic
914675412 1:149904185-149904207 GAGGAGCCCTAGGCCAGCCTGGG - Exonic
914899300 1:151703385-151703407 GAGAGGGCCGGGGCCAGTCGTGG + Exonic
915118809 1:153616057-153616079 CATAGGCCCAGGCCCCGCCTGGG + Intronic
917790924 1:178498258-178498280 GAGACCCCCAGGCCCAGTCTAGG + Intergenic
918181358 1:182087988-182088010 GTCTGGTCCAGGGCCAGCCTGGG - Intergenic
919126798 1:193404696-193404718 ATGAGTCACAGGGCCAGCCTAGG + Intergenic
919861313 1:201740807-201740829 GAGAGTCCCAGGGCCAGCTGTGG - Intronic
920027027 1:203006544-203006566 GAGAGACCCAAGGTCAGCCGAGG - Intergenic
920506394 1:206518294-206518316 GCGAGGCCCAGGGCCCTCCCCGG + Intronic
920516310 1:206586953-206586975 GAGAATCCCAGGGCAAACCTGGG + Exonic
920536767 1:206742565-206742587 GAGGAGTCCGGGGCCAGCCTAGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
921897503 1:220415650-220415672 CAGGGGCTCAAGGCCAGCCTGGG + Intergenic
923483104 1:234403168-234403190 GAGGGAGCCAGGGCCAGGCTTGG - Intronic
924472101 1:244351633-244351655 GAGAGACCAGGGGCCAGGCTGGG - Intergenic
1062824183 10:556368-556390 GCGGGGCCCAGGACAAGCCTGGG - Intronic
1063243507 10:4194853-4194875 GAGAGGCCCTTGGCCAGCTATGG + Intergenic
1064094213 10:12411135-12411157 GGGAGTACCTGGGCCAGCCTGGG + Intronic
1066058770 10:31704337-31704359 GGTAGGCACAGAGCCAGCCTGGG + Intergenic
1066984645 10:42454339-42454361 GTGTGCCCCAGGGCCAGCCCTGG - Intergenic
1067087288 10:43249664-43249686 GGAAGCCCCAGGGCCAGCCAGGG - Intronic
1067091107 10:43266308-43266330 GAGAGGTCCAGGGCCATGCCAGG - Intronic
1067877362 10:50018326-50018348 GGGAGGCCCAGGACCAGACAGGG - Intergenic
1067942367 10:50667761-50667783 GACAAGCCCAGGCCCAGCTTGGG - Intergenic
1069604941 10:69733024-69733046 TTGAGGCCCAGGGCCGGCATCGG - Intergenic
1069605413 10:69735847-69735869 GGGAGTCCCAGGGACAGCCATGG - Intergenic
1069923788 10:71834067-71834089 CAGAGGCCCAGAGGCAGCATGGG + Intronic
1070132686 10:73666001-73666023 GGGAGGCCCAGGACCAGACATGG + Intergenic
1070523566 10:77275816-77275838 GGGAGGCCCAGCCCCAGCCAAGG + Intronic
1070599526 10:77856134-77856156 TAGAAGCCCAAGACCAGCCTGGG + Intronic
1070600708 10:77864487-77864509 GAAAGACCCAGGCCCTGCCTGGG + Intronic
1070863611 10:79692719-79692741 GACAAGCCCAGGCCCAGCATGGG - Intergenic
1071600250 10:86955487-86955509 CAGAGCCCCAGGGCTAGGCTGGG - Intronic
1072664982 10:97386034-97386056 GAGGGGTCCAGGGCCAGCCGTGG - Intronic
1073154500 10:101335713-101335735 CAGAAGCTCAAGGCCAGCCTGGG + Intergenic
1073250435 10:102117726-102117748 GAGGGGGCCAGGGCCTGTCTGGG - Intronic
1073312794 10:102556181-102556203 GAGATGCCCACAGCCAGCCATGG + Intronic
1073439833 10:103545869-103545891 GAGTGGCCCAGAGCCTGGCTGGG + Intronic
1073510976 10:104042196-104042218 AAGAGGACCAGGGGCAGACTTGG - Intronic
1073792541 10:106955020-106955042 CAGTGGCGCTGGGCCAGCCTAGG + Intronic
1074821825 10:117185475-117185497 GCCAGGCCCAAGGCCAGCATTGG - Intergenic
1075644269 10:124087270-124087292 GATAGATCCAGGGCCACCCTGGG + Intronic
1075821696 10:125318683-125318705 GGGAGGCTGAGGCCCAGCCTGGG - Intergenic
1076013095 10:127006277-127006299 CAGAGGCCCAGGGCCAGCACAGG - Intronic
1076572851 10:131443958-131443980 AAGAGACCCAGGGCCAGCAAAGG + Intergenic
1076696518 10:132249834-132249856 GGGAGGTCCTGGCCCAGCCTGGG - Intronic
1076727337 10:132419745-132419767 GAGAGGCCCAGGACCAGCTCCGG - Intergenic
1076817496 10:132922028-132922050 GGGAGGCCCCGGGGCAGCCTGGG + Intronic
1076899207 10:133328832-133328854 GTGAGGGCCTGGGCCAGCGTGGG - Intronic
1076924643 10:133476171-133476193 GAAAGGCACAGACCCAGCCTCGG - Intergenic
1077020810 11:416465-416487 GAGGCGACCAGGGCCAGGCTTGG - Intronic
1077081051 11:724907-724929 GAGCGGTCTAGGGCCAGGCTGGG + Intronic
1077413223 11:2413109-2413131 GCGAGGCACAGGGCCAGGCAGGG - Intronic
1077541318 11:3147802-3147824 GGGAGGAACAGGACCAGCCTCGG + Intronic
1079077710 11:17394248-17394270 GAGGGGCCCAGGACCAACCGTGG + Exonic
1079125300 11:17714460-17714482 CAGAGCCACAGGCCCAGCCTGGG + Intergenic
1079399207 11:20092308-20092330 GAGAGGCCCATGGACTGCCTCGG - Exonic
1081673968 11:44957507-44957529 GGGAGGCCCTGGGTCAGCCCTGG - Intergenic
1082044024 11:47710268-47710290 GAGAGGCCAGGGAGCAGCCTTGG - Intronic
1083175801 11:60949573-60949595 GAGATGGCCAGGGCTGGCCTGGG + Intronic
1083295912 11:61715576-61715598 GAGGGGGCGAGGCCCAGCCTGGG + Intronic
1083461583 11:62816487-62816509 CAGAAGCTCAGGACCAGCCTAGG - Intronic
1083878053 11:65535086-65535108 GACAGGGCCAGGCCCAGGCTGGG + Intronic
1083898257 11:65631134-65631156 CTGTGGCTCAGGGCCAGCCTGGG - Intronic
1084116214 11:67044524-67044546 GAGGGGTCCAGGGAAAGCCTTGG - Intronic
1084223073 11:67696808-67696830 GAGGTGCCCAGGTGCAGCCTGGG - Intergenic
1084264642 11:67998524-67998546 GAGGGGTCCAGGCACAGCCTTGG + Intronic
1084296527 11:68216019-68216041 GAGAGGCCCAGGGTGGGCCAGGG + Intergenic
1084418674 11:69049363-69049385 AAGAGGCCCTCGCCCAGCCTTGG + Intronic
1084553454 11:69862711-69862733 GAGTGGCCCTGGGCCACCCAAGG - Intergenic
1084648460 11:70474301-70474323 GGGACGCCCATGGCCACCCTGGG - Intronic
1084974635 11:72790088-72790110 GAGAAACCCAGGGCCGGTCTGGG - Intronic
1085042440 11:73334596-73334618 GAGGGGGCCAGAGCCTGCCTCGG - Intronic
1085315946 11:75545031-75545053 GGGAGAGCCAGGGCCACCCTGGG + Intergenic
1085685331 11:78616656-78616678 CAGAGGTTCAGGACCAGCCTGGG - Intergenic
1088595016 11:111434986-111435008 GAGAGTCCCAGGGCCAGGTGAGG - Intronic
1089556757 11:119319444-119319466 GAGGGGCCCAGGTCCACCATGGG - Intronic
1090252880 11:125263638-125263660 GAGCTGCCGAGGGCCAGACTGGG + Intronic
1090668756 11:128931411-128931433 CAGAGGTTCAAGGCCAGCCTGGG + Intergenic
1090815928 11:130295544-130295566 GTGAGTCCCAGGGGCAGGCTGGG - Intronic
1091044710 11:132315383-132315405 GAGAGGCCCAGGGCCCTGCCTGG - Intronic
1091169837 11:133510168-133510190 GGGTGGTCCAGGGGCAGCCTGGG - Intronic
1092112148 12:5971366-5971388 GAGAAGCCCAGGGCCCTCCCAGG - Intronic
1093641170 12:21528032-21528054 GGGAGCCGCAGCGCCAGCCTGGG - Intronic
1094118006 12:26938334-26938356 GAGAGGCCGAGCGAAAGCCTGGG + Intergenic
1094379879 12:29831258-29831280 AAGAGGCCCAGGTACAGCTTGGG - Intergenic
1094607331 12:31959741-31959763 CGGAGGCCCAGGGCCGGCCCCGG - Intronic
1096460635 12:51819990-51820012 GAGAGAAACAGGGCCAGCATGGG + Intergenic
1096540920 12:52306634-52306656 GATGGGGCCAGGGCCAGACTAGG - Intronic
1096577213 12:52560337-52560359 GAGAGGATGAGGGGCAGCCTGGG - Intergenic
1097151212 12:56981209-56981231 CACAGGCCCTTGGCCAGCCTTGG + Intergenic
1098359474 12:69640912-69640934 CAGGAGCTCAGGGCCAGCCTGGG + Intergenic
1099413751 12:82361822-82361844 GAGAGAGCCAGCTCCAGCCTCGG + Intronic
1099838450 12:87937088-87937110 GGAAGGCCCAGGGCCCGCCTAGG - Intergenic
1100480418 12:94972653-94972675 CAGAAGCTCAGGACCAGCCTGGG + Intronic
1101720349 12:107345531-107345553 GAGAAGCCCAGGGACAGGGTTGG + Intronic
1101749381 12:107570869-107570891 CAGAGGCCCAGAGGAAGCCTGGG - Intronic
1101966607 12:109286561-109286583 GGTTGGCCCAGGGCCAGCCCTGG + Intronic
1101970149 12:109307291-109307313 GACAGGACCAGGGCTGGCCTGGG - Intronic
1102942200 12:116953299-116953321 CAGAGGCTCAGGGCCAGGCTGGG + Intronic
1103340124 12:120216654-120216676 GGAAGGCCCAGGGGGAGCCTGGG - Intronic
1103568006 12:121826783-121826805 GACAGGACCAGGGCTGGCCTGGG + Intronic
1103702301 12:122854186-122854208 GAGTGGCCCAGGGCAACCCCTGG + Intronic
1103740098 12:123085256-123085278 GAGAAGCCCAGGTCCTGCCCAGG - Intronic
1103802283 12:123546431-123546453 GTGAGGCCCAGGGGCAGAATAGG + Intergenic
1103950946 12:124550717-124550739 GAGCCACCCAGGGCCAGGCTGGG - Intronic
1104581934 12:130017099-130017121 GACCGGCCCACGGCCTGCCTTGG - Intergenic
1104764504 12:131317854-131317876 GAGAGGCCCCTCCCCAGCCTGGG + Intergenic
1104862022 12:131928967-131928989 GAGAGGAGCGGGGCCAGCGTGGG + Intergenic
1104866759 12:131960662-131960684 CAGAGGTCCAGGGCCTGCCCTGG + Exonic
1105002590 12:132700951-132700973 CTGGTGCCCAGGGCCAGCCTTGG + Intronic
1105432862 13:20352729-20352751 GGAAGGCCCAGGACCAGCCTGGG - Intergenic
1105914672 13:24902067-24902089 GAGAGCCTCAGTGCCAGCCTAGG - Intronic
1106559063 13:30833250-30833272 GAGACCCTCTGGGCCAGCCTTGG + Intergenic
1108140115 13:47411592-47411614 GAGGGGGCCTGGGCCAGCTTAGG + Intergenic
1108253378 13:48588678-48588700 GAGAGGCTAAGGGACAGACTGGG - Intergenic
1109072190 13:57784170-57784192 AAGAAGCCCAGGACCAGGCTGGG - Intergenic
1109503618 13:63270241-63270263 AAGAGGCCCAGGTACAGCTTGGG - Intergenic
1110451019 13:75637030-75637052 GAGACGCCCCGGGCGAGCCAGGG - Intronic
1111934972 13:94549105-94549127 GCCAGACCCAGGGCCGGCCTCGG + Intergenic
1113346573 13:109483555-109483577 AAGTGACGCAGGGCCAGCCTGGG + Intergenic
1113375440 13:109761129-109761151 GAGAGGACCGGGGCCTCCCTGGG - Intronic
1113452458 13:110420940-110420962 GAGAGGGCCAGGAAGAGCCTGGG - Intronic
1113543901 13:111131564-111131586 AGAAGGCCAAGGGCCAGCCTTGG + Intronic
1113774216 13:112933510-112933532 GAGAGGCCCCAGGACAGCCCTGG + Intronic
1118906525 14:70027537-70027559 GAGAGGCCCAGGAGCAGTGTGGG + Intronic
1118985993 14:70755250-70755272 GGGAGGGCCAGGGCATGCCTAGG - Intronic
1119483601 14:74974678-74974700 TACAGGCCCAGGGGCAGCCTGGG - Intergenic
1119731723 14:76955535-76955557 GAGAGGGCCAGGGCCTGCGTGGG - Intergenic
1119731854 14:76956340-76956362 GAAATGCCCAGGGCCGGCCCAGG - Intergenic
1121697535 14:95926028-95926050 GTGAGCCCCAAGCCCAGCCTTGG + Intergenic
1121832394 14:97063509-97063531 CCCAGGCCCAGGGCCAGGCTGGG - Intergenic
1122054592 14:99085282-99085304 GTGAGGCCCAGGGACAGTGTAGG + Intergenic
1122158882 14:99768558-99768580 GACAGGCCCAGGGCCAGGAGTGG + Intronic
1122204031 14:100139433-100139455 GAGAGGGCCAGGGCCTGGCGAGG + Intronic
1122273370 14:100578264-100578286 GAGAGGGGGAGGCCCAGCCTAGG - Intronic
1122325896 14:100880486-100880508 CAGAGACCCAGCGCCAGCCCTGG - Intergenic
1122412767 14:101534414-101534436 TAGAGGCCCCGGCCCAGCCTGGG - Intergenic
1122482462 14:102055833-102055855 GCGGGGCCCAGGGCCAGGCGGGG - Intergenic
1122503734 14:102218733-102218755 GAGAGGAACGGGGCAAGCCTTGG - Intronic
1122903399 14:104791234-104791256 GAGAGGAACAGGGCCAGGGTCGG + Intronic
1122969800 14:105147927-105147949 TGGAGACCCAGGGCCAGCCCAGG - Intronic
1123009458 14:105340769-105340791 GAGATGCCCCTGGCCAGCCCTGG - Intronic
1123105231 14:105838187-105838209 GTGGGGCCCAAGGCAAGCCTAGG + Intergenic
1123784043 15:23650905-23650927 GAGAGCCCCAGGAACAGCCTGGG - Intergenic
1125886720 15:43234982-43235004 GAGAGACCCAGGTCCAACCCAGG - Intronic
1126581263 15:50244594-50244616 GACAGGCTCAGGGCCAGACATGG - Intronic
1127616219 15:60688772-60688794 GAGAGACCCAGGGGCTGACTTGG + Intronic
1128800588 15:70494457-70494479 CAGAGGCTCAGGGGGAGCCTTGG + Intergenic
1128983635 15:72203494-72203516 GAGTGGCCTGGGCCCAGCCTGGG - Intronic
1129138104 15:73572513-73572535 AGGAGGCCCAAGGGCAGCCTTGG - Intronic
1129185723 15:73905106-73905128 GAGAGGCTCAGGGCCCACTTAGG + Intergenic
1129227843 15:74180180-74180202 GCTAGGCCCGGGGCCAGCCGCGG - Exonic
1129228546 15:74183810-74183832 GGGAGGCCCAGGCCAAGGCTGGG + Intronic
1129331899 15:74832139-74832161 GAGAGACACAGGCCCAGCCCTGG + Intergenic
1129692812 15:77723495-77723517 GAGAGGCGCAGGTAAAGCCTGGG - Intronic
1129906640 15:79192270-79192292 GAGAGGCCCAGTGCTAGGCAAGG - Intergenic
1130882425 15:88066743-88066765 GACAGGAACAGTGCCAGCCTGGG + Intronic
1131149374 15:90037279-90037301 GAAAGTCCCTGGTCCAGCCTGGG + Intronic
1131182475 15:90249897-90249919 GAGAGGGAAAGGGCCAGCGTAGG + Intronic
1132504155 16:298358-298380 GAGGGGCCCCCGGCCACCCTGGG - Intronic
1132626826 16:895236-895258 GGGAGCCCCAGCTCCAGCCTCGG + Intronic
1132648539 16:1010141-1010163 GAGAGGCACAGAGGCAGCCCAGG - Intergenic
1132696177 16:1202943-1202965 CAGAGGCCCAGGCCCCGCATAGG - Intronic
1132814285 16:1818443-1818465 GAGTGACCCAGGGCCACACTCGG - Intronic
1132831592 16:1930764-1930786 GGGAGGCTCAGGCTCAGCCTGGG - Intergenic
1132865925 16:2092697-2092719 GAGAAGCCCAGGTCTAGCCGTGG - Intronic
1132997334 16:2830159-2830181 GGAAGGCCCAGGGCCGGCCTTGG - Exonic
1133017192 16:2949479-2949501 GGGTGGCCCAGGTCCATCCTGGG + Exonic
1133124939 16:3640759-3640781 GAGTGGTACAGCGCCAGCCTGGG + Intronic
1133272263 16:4616062-4616084 GGCAGGCCCAGAGCCAGGCTAGG - Intergenic
1133282701 16:4676229-4676251 GAGAGGCCGACAGACAGCCTGGG - Intronic
1134024966 16:10946475-10946497 AAGAGGCCCAGGACAAGTCTGGG + Intronic
1134045587 16:11098667-11098689 GGGAGGCCCATTGGCAGCCTGGG - Intronic
1134100427 16:11448014-11448036 TTGGTGCCCAGGGCCAGCCTCGG - Exonic
1134846531 16:17445527-17445549 GAGAGGCCCCGGGCTCACCTGGG + Intronic
1134865857 16:17606137-17606159 GAGGGGAAGAGGGCCAGCCTAGG - Intergenic
1135018849 16:18946898-18946920 GAGAGTCACAGGGCCAGCCAGGG + Intergenic
1135530515 16:23249077-23249099 CAGGAGCCCAGGACCAGCCTAGG + Intergenic
1135783623 16:25328171-25328193 GAGAGGTTCAAGACCAGCCTGGG - Intergenic
1136180435 16:28548277-28548299 GAGACGACCAGGACCAGCCCTGG - Intergenic
1136538941 16:30917678-30917700 GAGAAGCTCAGGGTCAGCCTTGG - Intergenic
1137594713 16:49716028-49716050 AAGAGGCACAGGGCCAGGCAGGG + Intronic
1138496696 16:57413276-57413298 GAGAGGCTGAGGCCCAGCCAGGG - Intronic
1140979758 16:80096191-80096213 GAGAAGCCCAGGGGAAGACTCGG - Intergenic
1141170241 16:81686382-81686404 GGAAGGCCCAGGTGCAGCCTGGG - Intronic
1141401341 16:83749817-83749839 GAGAAGCCCCTGTCCAGCCTGGG + Intronic
1141621007 16:85236386-85236408 CAGAGGCCCAGACCCAGCCAGGG - Intergenic
1142115237 16:88352937-88352959 CAGAGAGCCAGGCCCAGCCTGGG + Intergenic
1142133527 16:88441580-88441602 GGGAGGCCCAGCGCCCACCTGGG - Intergenic
1142239294 16:88937882-88937904 CAGGGGCCTGGGGCCAGCCTGGG + Intronic
1142249917 16:88986505-88986527 GAGAGGCCCGGGGTGAGCCGTGG - Intergenic
1142283606 16:89161736-89161758 CTAAGGCCCTGGGCCAGCCTGGG - Intergenic
1142285955 16:89171634-89171656 GACGGGCCGAGGGCCGGCCTGGG - Intergenic
1142287912 16:89178951-89178973 GAAAGCCCCTGGGCCAGCCAGGG - Intronic
1142471847 17:169062-169084 GAGAGGCCCAGGGCGGGGCAGGG - Intronic
1142622915 17:1176236-1176258 AAGAGGCACAGGGCCAGGTTGGG + Intronic
1142681901 17:1554936-1554958 GAGAGGCACAGGGACAGCTTGGG - Intronic
1142803083 17:2357129-2357151 GGGAGCCCCAGGGCTAGTCTGGG + Intronic
1142811625 17:2398136-2398158 GGCAGGCCCAGGGTAAGCCTTGG + Intronic
1143027040 17:3947055-3947077 GAGAGGCTCAAGTTCAGCCTTGG - Intronic
1144058023 17:11558930-11558952 GAGGGGCACAGGGCCAGGGTTGG - Exonic
1144743261 17:17596127-17596149 GAGAGGCCCATGGCGAGCATGGG - Intergenic
1144753979 17:17668478-17668500 GAGAGGGTCAGGACCAGCTTGGG - Intergenic
1145112378 17:20175031-20175053 CAGAGGCCCCTGGACAGCCTGGG + Intronic
1145233287 17:21190615-21190637 CAAAGGCACAGGGCCAGCCCGGG - Intronic
1145942027 17:28747581-28747603 CAGAGCCCCAGGGACAGCCTGGG + Intronic
1146000650 17:29128368-29128390 AAGAGGCCCAGGGCCTGTCCCGG - Intronic
1146276896 17:31522050-31522072 GTGAGGCCCAGGCCCAGCTGGGG + Intronic
1146349585 17:32083747-32083769 GAGGGCCCCAGGGGCAGCCGAGG + Intergenic
1146890250 17:36502088-36502110 GAGGGGCCCAGGGTAAGGCTGGG + Intronic
1147923191 17:43931255-43931277 GAGGAGCCCAGGGTCAGGCTAGG + Intergenic
1148340469 17:46870503-46870525 GAGGAGCCCAGGGCCAGGCTAGG + Intronic
1148489503 17:48014084-48014106 CAGAGGCCCTGAGCCAGCCAGGG - Intergenic
1151208966 17:72529470-72529492 GGGAGGCCCAGGGGTAGCCCTGG + Intergenic
1151388222 17:73768356-73768378 GAGATGGCCAGGGCTGGCCTTGG + Intergenic
1151890284 17:76947441-76947463 GAGAGCCTCACAGCCAGCCTGGG + Intronic
1152023300 17:77793138-77793160 CAGAGACCCAGTGCCAGCCTGGG + Intergenic
1152031455 17:77845929-77845951 GAGAGGCCCAGTCCCACCCAGGG - Intergenic
1152760071 17:82103187-82103209 GAGGGGCCCAGGGCCAGGGCTGG - Intronic
1153437025 18:5078562-5078584 GAGAGACACAGGGCAAGACTGGG - Intergenic
1153603331 18:6805031-6805053 CAGAGGTTCAAGGCCAGCCTGGG - Intronic
1154201436 18:12303194-12303216 GAGAGTCCCAGGGAGTGCCTGGG - Intergenic
1154218112 18:12430178-12430200 GCGAGGCCCATGGCCACCCCTGG - Intronic
1154251800 18:12750983-12751005 GGGAGGCCCAAGGCCAGCACTGG - Intergenic
1155166675 18:23237548-23237570 GAGAGGACCAGGCCCATCCCTGG + Intronic
1155179388 18:23330944-23330966 AAAAGGCCCACGGGCAGCCTGGG + Intronic
1155182054 18:23356400-23356422 TAGATGCTCAGGGCCAGCTTGGG - Intronic
1155500089 18:26479365-26479387 GAAAGGCCCAGGCCCTGTCTCGG + Intronic
1155524089 18:26699022-26699044 GGGAGCCTCAGGGGCAGCCTTGG - Intergenic
1156507996 18:37610897-37610919 GCTAGGACCAGGGCCAGGCTTGG - Intergenic
1157529276 18:48408426-48408448 GACAGGCACCGGGCCAGGCTCGG + Intronic
1157855910 18:51105496-51105518 TAGAAGTTCAGGGCCAGCCTGGG - Intergenic
1158589609 18:58768537-58768559 GGGAGACCCAAGGCCAGGCTGGG - Intergenic
1158604507 18:58883470-58883492 GAGAGGGCCAGGGTCAGGGTCGG + Intronic
1160255339 18:77243597-77243619 AACAGGGGCAGGGCCAGCCTGGG - Intergenic
1160488934 18:79320473-79320495 GAGAGGCCCAGGGCCAGGCCAGG + Intronic
1160662437 19:307311-307333 GCGAAGTCCACGGCCAGCCTTGG + Exonic
1160916116 19:1497464-1497486 GCAGGGCCCAGGGCCAGCGTCGG + Exonic
1160926873 19:1550670-1550692 GACACGCCCAGGGACAGCCCAGG + Intergenic
1160975815 19:1791928-1791950 GAGAGTCCCAGGGCCCCCTTGGG + Intronic
1160982495 19:1822793-1822815 GAGAGCCTTAGGGCCAGCCCCGG - Intronic
1161260987 19:3337606-3337628 GTGAGGGCCAGGGCCAGGCTCGG - Intergenic
1161588569 19:5118439-5118461 GAGAGGCCCCTGGCCAGGCCAGG + Intronic
1161617849 19:5282083-5282105 CAGAGGTCAAGGGACAGCCTTGG + Intronic
1161682285 19:5686383-5686405 GAGAGGCCCACGGGCAGCTCTGG + Intronic
1161698778 19:5784095-5784117 GAGGGGCCCAGCCCAAGCCTGGG + Exonic
1161794083 19:6376411-6376433 GAGAGGCCTGGGGACAGCCAAGG + Intronic
1161995240 19:7707658-7707680 GAGCAGCCCAGGCCCAGCCTGGG + Intergenic
1162565912 19:11445856-11445878 GAGAGGCACACGGGGAGCCTAGG + Intronic
1162957623 19:14107868-14107890 GAGAGGAACAGGGCCAGCTGGGG - Intronic
1163290354 19:16375832-16375854 GAGAAGGCCATGGCCAGCCCAGG + Intronic
1163645444 19:18486521-18486543 GAGGGCCTCAGGGGCAGCCTTGG - Intronic
1166039015 19:40191318-40191340 CAGAGCCCCGCGGCCAGCCTCGG - Intergenic
1166185358 19:41135791-41135813 CAAAGTCCCAGAGCCAGCCTAGG + Intergenic
1166709534 19:44927790-44927812 GGCAGGCCCAGCCCCAGCCTAGG + Intergenic
1166731015 19:45059092-45059114 GGCAAGCCCAGTGCCAGCCTAGG + Intronic
1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG + Intronic
1167456083 19:49597256-49597278 GGGTGGCCCAGCGCCAGCCTTGG - Exonic
1167466044 19:49651596-49651618 AAGAGGGACAGCGCCAGCCTGGG - Exonic
1168347798 19:55659359-55659381 GGGATCCCCTGGGCCAGCCTGGG + Intronic
1168573246 19:57487887-57487909 GAAAGGGCCCGGGCCACCCTGGG - Exonic
1168574664 19:57500027-57500049 GAAAGGGCCCGGGCCACCCTGGG - Exonic
1202694535 1_KI270712v1_random:114633-114655 GGGAGGCCCATGGCCAGTCTCGG - Intergenic
925618066 2:5762707-5762729 CAGAGGCTCAGGGCCCACCTAGG - Intergenic
926171393 2:10555085-10555107 CAGTGGGCCAGGCCCAGCCTGGG + Intergenic
926219400 2:10925071-10925093 CTGAGGCCCTGGGCCAGGCTGGG - Intergenic
926270991 2:11365768-11365790 GGCAGGCCCAGGACCGGCCTTGG - Intergenic
926355669 2:12038786-12038808 GGGAGGGCTAGGGCCTGCCTGGG + Intergenic
927391392 2:22599362-22599384 TAGAAGCCAAGAGCCAGCCTCGG - Intergenic
927435260 2:23060941-23060963 CAGAGGGCCTGGGCCAACCTTGG + Intergenic
927944872 2:27129595-27129617 GAGATGCCCACGGCCAGCAGTGG - Exonic
929801931 2:45111827-45111849 GATAGGCCCAGGGCGACACTAGG + Intergenic
929906246 2:46049043-46049065 TAGAGTCCCAGGGCCTTCCTTGG + Intronic
930892726 2:56409789-56409811 GAGAGGCCACGGCCTAGCCTTGG + Intergenic
931570887 2:63668206-63668228 GAGATGGCCAGGGACAGCCAGGG - Intronic
931749074 2:65315116-65315138 GAGAGGCCCTGGGTGAGCCAGGG - Intronic
932215154 2:69961663-69961685 GGGAGCCCAGGGGCCAGCCTAGG - Exonic
932347751 2:71006801-71006823 GAGAGCCTCAGGGCAAGGCTGGG + Intergenic
932405082 2:71507280-71507302 CAGAGGCCCAAGGGCAGCCCAGG + Intronic
932408534 2:71530459-71530481 GAAATCCCCAGGGCCAGCCAAGG - Intronic
932586897 2:73036148-73036170 CAGATGAGCAGGGCCAGCCTGGG + Intronic
932694997 2:73948541-73948563 TGCAGCCCCAGGGCCAGCCTTGG - Intronic
933586555 2:84185723-84185745 GAGAGGTCCAGGAACTGCCTAGG - Intergenic
933775004 2:85766531-85766553 GGGAGACGCAGGGCCAGCCAGGG - Intronic
934058327 2:88271011-88271033 GAGAAGCCCAAGGGCAGGCTGGG + Intergenic
934559427 2:95304982-95305004 CAGGTCCCCAGGGCCAGCCTAGG + Intronic
935026953 2:99286113-99286135 GTGAGGCCCTGAGCCACCCTGGG + Intronic
935523974 2:104143344-104143366 AAGAGACCCAGGGCCAGCAAAGG + Intergenic
936016966 2:108966752-108966774 CAGAGGCCAAGTGCCAGCCCTGG + Intronic
936095772 2:109529222-109529244 CAGAGGCCCAAGACCAGACTGGG - Intergenic
936146662 2:109984925-109984947 CAGAGGCCCAGGGACAGCAGTGG - Intergenic
936198030 2:110386554-110386576 CAGAGGCCCAGGGACAGCAGTGG + Intergenic
936951558 2:117982823-117982845 GTGAGTCCCAGGGCCAGCAGGGG + Intronic
937245004 2:120486816-120486838 GACAGGCCCAGGCCAAGCCTAGG - Intergenic
937915966 2:127098867-127098889 GATTGGCCCAGGCCCAGCCGAGG - Intronic
937984921 2:127634134-127634156 GTGAGGCCCGGGGCCTGGCTAGG - Intronic
938555097 2:132416828-132416850 GAGAGGCCCAGGAGGCGCCTGGG - Exonic
939858458 2:147389429-147389451 GAGAGGCCAAGTGCAAGGCTTGG - Intergenic
941095954 2:161239243-161239265 GAAAGGGCTAGGGCCAGCCAGGG + Intergenic
943724719 2:191241536-191241558 CAGGGGCTCAAGGCCAGCCTGGG + Intergenic
945940511 2:215944838-215944860 GAGAGGCTCAGGGGCAGAATGGG - Exonic
946187806 2:217991066-217991088 GAGAGGCACAGAGTCAGCCCTGG + Intronic
947518610 2:230828047-230828069 GCTGGGCCCAGGGCCAGGCTCGG + Intergenic
947746185 2:232508464-232508486 GAGGGTCCCAGGGCCCACCTGGG - Intergenic
947972860 2:234338543-234338565 CAGAGTGCCTGGGCCAGCCTGGG - Intergenic
948426089 2:237887229-237887251 GAGATGCCATGGCCCAGCCTGGG - Intronic
948637872 2:239351721-239351743 GAGAGGCTCAGGGTCTGTCTGGG - Intronic
948836377 2:240628044-240628066 CAGAAGTCCAGGGCCAGCCTTGG - Intronic
948868987 2:240788928-240788950 GACAGGCTCAGGGTCAGCTTTGG + Intronic
948903844 2:240968632-240968654 GGGCGGCCCTGGCCCAGCCTTGG + Intronic
949040174 2:241844302-241844324 CACAGGCCCGGGGCCAGCCGGGG + Intergenic
1168969337 20:1920074-1920096 GAGAGGCCCAGGGCCAAAAGTGG - Intronic
1169033748 20:2433000-2433022 GAGAGTCCAAGGGTCAGCCAGGG - Intergenic
1169426330 20:5500270-5500292 AAGAGACCTAGGGCCTGCCTTGG + Intergenic
1171463262 20:25310592-25310614 CAGAGGGCTAGGGCCAGGCTGGG + Intronic
1172034049 20:31999526-31999548 GAGTGGGCCTGGGTCAGCCTTGG - Exonic
1172614446 20:36274294-36274316 GAGAGGACCTGGGCCAGGCCAGG - Intergenic
1172617900 20:36301334-36301356 CAGGAGTCCAGGGCCAGCCTGGG - Intergenic
1173119879 20:40278969-40278991 GCGAGACCCAGGCCCAGCCAGGG - Intergenic
1173160143 20:40646486-40646508 CAGGGGCTCAGGGCCAGGCTAGG + Intergenic
1173589112 20:44210547-44210569 GAGAGGCCCAGGCCCGGCCCAGG + Intronic
1175273184 20:57749169-57749191 GCGGGGGCCAGGGCGAGCCTGGG + Intergenic
1175388110 20:58610230-58610252 GAGGGGCCGGGTGCCAGCCTAGG + Intergenic
1175396681 20:58669254-58669276 CCGAGGCTCAGGGCAAGCCTGGG - Intronic
1175777855 20:61664214-61664236 GACAGGCCCAGGGTCTGCCTTGG - Intronic
1175860391 20:62147345-62147367 GCCAGGCCCAGGGCCACCGTGGG - Intronic
1175943293 20:62547604-62547626 GACAGGCCCAGCGCCAGGCATGG - Intergenic
1176058254 20:63160349-63160371 GACTTGCCCAGGGCCAGCCCTGG - Intergenic
1176091027 20:63318696-63318718 GCCAGGCCCAGGGCCATCCCAGG - Intronic
1177384963 21:20396952-20396974 GAGGGGCCCATGGCCAGACCAGG + Intergenic
1178914407 21:36698786-36698808 GAGAGCCACAGGGGCGGCCTCGG + Intergenic
1179000208 21:37450665-37450687 GAGAGTTCCCAGGCCAGCCTGGG + Intronic
1179023575 21:37660366-37660388 GAGAGCCCCGAAGCCAGCCTGGG - Intronic
1179180166 21:39037957-39037979 GAGAGGCCCTGGGTTGGCCTGGG - Intergenic
1179731852 21:43372602-43372624 GAGAGACCCAGGCCTAGCCAGGG + Intergenic
1180002387 21:45001259-45001281 GAGAGGCCGAGAGGCAGCGTGGG + Intergenic
1180052208 21:45336319-45336341 GCCAGCCCCAGGGTCAGCCTGGG + Intergenic
1180053882 21:45347173-45347195 GAGGGGCTCAGAGCCAGCCTGGG - Intergenic
1180169235 21:46049284-46049306 GAGAGGCCCTGGGGCTGTCTGGG - Intergenic
1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG + Intronic
1180967766 22:19799447-19799469 GGAAGGCCCAGGTCCAGGCTGGG - Intronic
1181510612 22:23387149-23387171 GGGAGGCCCAAGACCACCCTTGG + Intergenic
1181591048 22:23884787-23884809 GTGGGGCCCTGGGCCCGCCTGGG - Exonic
1181600822 22:23951009-23951031 AAGAGACCCAGGGCCAGACATGG - Intergenic
1181607690 22:23990317-23990339 AAGAGACCCAGGGCCAGACATGG + Intergenic
1182383779 22:29917436-29917458 TCAAGGCCCAAGGCCAGCCTGGG + Intronic
1182469861 22:30542090-30542112 GTGGGGCCCAGGTCCAGGCTGGG - Intronic
1182696383 22:32201849-32201871 GAGGGGCCGAGGGGCATCCTGGG + Intronic
1183450604 22:37892763-37892785 GAGTGGCCCAGTGCCAGCCAGGG + Intergenic
1183482101 22:38070767-38070789 AGGAGGCCCAGGGCCATGCTGGG - Intronic
1183622749 22:38983972-38983994 GGGAGGCCCAGGGCCATCCTGGG + Intronic
1183629167 22:39022720-39022742 GGGAGGCCCAGGGCCGTCCCGGG + Intronic
1184390385 22:44200256-44200278 GAGAGGTCCACGGGCAGCCAAGG + Intronic
1184656250 22:45943593-45943615 GAGAGGCCCTGGGGCAGCCCCGG - Intronic
1184763289 22:46557803-46557825 GGGAGGACCTGGCCCAGCCTAGG + Intergenic
1185050742 22:48552842-48552864 AGGAGGCCCAGAGCCAGCCCTGG + Intronic
1185091915 22:48780388-48780410 CAGTGACCCAGAGCCAGCCTAGG - Intronic
1185179280 22:49349939-49349961 GAGAGGCCCAGGGCAGGCGGGGG - Intergenic
1185207196 22:49546796-49546818 GTGAGACCCAAGGGCAGCCTGGG + Intronic
1185224192 22:49643767-49643789 GAGAAGCCGAGGGCCTGGCTGGG - Intronic
950106841 3:10393851-10393873 GACAGGCCCAAGGCCAGGATGGG - Intronic
950249071 3:11448859-11448881 GAGACCCCCAGGGCCTGCCTTGG - Intronic
950531404 3:13554154-13554176 GAGAGCCCCAGGCCCACTCTGGG + Intronic
950923235 3:16716085-16716107 TAGAGGCCCAGGACCAGGCCTGG + Intergenic
951258730 3:20481899-20481921 CAGAGGCCCATGGCAAGACTGGG - Intergenic
953717245 3:45326066-45326088 CTCATGCCCAGGGCCAGCCTGGG - Intergenic
954160054 3:48714679-48714701 GAAAGGGCCAGGGCCAGGCTTGG - Intronic
954174296 3:48831569-48831591 CAGAGGCCTAGGACCAGCCTGGG - Intronic
954375295 3:50191386-50191408 GAGAGGCCCTGGCACTGCCTGGG - Intergenic
954579107 3:51693415-51693437 GTCGAGCCCAGGGCCAGCCTGGG - Intronic
956432774 3:69204243-69204265 GAAAGACCCAGGGAAAGCCTTGG + Intronic
958973524 3:100639615-100639637 GAGAGGCCAAGAGCCAGAGTGGG + Intronic
960536782 3:118823860-118823882 GAGAAGTCAAGGGCCTGCCTTGG - Intergenic
961404371 3:126667967-126667989 GAGAGGCCCAGGCCCAGGAACGG + Intergenic
961627595 3:128274562-128274584 GAGTGTCCCAAGGCCACCCTGGG - Intronic
962279268 3:134037948-134037970 GGGAGTCCCAGTGCCAGCCCTGG + Intronic
962809596 3:138949216-138949238 GAGACGCAGAGAGCCAGCCTGGG - Intronic
962866481 3:139451708-139451730 ATGTGGCCCAGGGCCAGCCTTGG - Intergenic
963126601 3:141822375-141822397 GAGAGGCCTAGGAGCAGCCTTGG - Intergenic
964601795 3:158509573-158509595 CAGAGGTTCAAGGCCAGCCTGGG + Intronic
968487592 4:871333-871355 GTGAGGGCCAGCGCCTGCCTTGG - Intronic
968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG + Intronic
968768327 4:2486743-2486765 GAGAGGCTTAGGAACAGCCTGGG + Intronic
968809820 4:2794754-2794776 GACAGGCTCTGGGCCTGCCTTGG + Intronic
968818607 4:2834202-2834224 GGGGGTCCCAGGGCCAGCCCCGG - Exonic
968975910 4:3821967-3821989 TGCAGGCCCAGTGCCAGCCTAGG + Intergenic
969297288 4:6277592-6277614 ACCAGGGCCAGGGCCAGCCTGGG - Exonic
969674040 4:8605162-8605184 GTGTGGCCCAGGGACAGCCAGGG - Intronic
971419621 4:26463719-26463741 GAGAGACCCAGGGCCAGATCAGG - Intergenic
971729682 4:30361347-30361369 TAGAGGAGCAAGGCCAGCCTTGG + Intergenic
971784939 4:31088444-31088466 GAAAGGCCCAGGGAAAGCCAAGG - Intronic
975902878 4:79173862-79173884 TCCAGGTCCAGGGCCAGCCTAGG - Intergenic
977257730 4:94758531-94758553 CGGGGGCCCAGGGCCAGCCCAGG + Intronic
978434454 4:108668256-108668278 GTGAAGCCCATGGCCAGCCAGGG - Intergenic
979755792 4:124338904-124338926 GAGACGCCCAGAGCCAGCGAGGG - Intergenic
985054172 4:186021651-186021673 GTATGGCCCAGGCCCAGCCTGGG + Intergenic
985423577 4:189807246-189807268 GAGAGGCGCAGGCCGAGCCCGGG - Intergenic
985906996 5:2846494-2846516 TAGAAGCCCCTGGCCAGCCTAGG - Intergenic
986664251 5:10086396-10086418 GAAAGTCTCAAGGCCAGCCTTGG - Intergenic
987367340 5:17160784-17160806 CAGAAGCTCAAGGCCAGCCTAGG - Intronic
988437294 5:31191248-31191270 GAAAGGCCCAGGGGCAGGCCCGG - Intergenic
988527736 5:32001320-32001342 GAGAGGCTCAGGGGCCGCCGAGG + Intronic
990585671 5:57208439-57208461 CAGTGGCTCAGGACCAGCCTGGG - Intronic
992500277 5:77335457-77335479 CAGAGGCCCAGGGAAAGCCAGGG + Intronic
992646788 5:78818919-78818941 GAGAGGGCCAGGGCAAGGGTGGG - Intronic
992668198 5:79032458-79032480 GAGAGTCCTATAGCCAGCCTTGG - Intronic
992828209 5:80569933-80569955 GAGAGACCCAGGGCCAGCCGAGG - Intronic
994840912 5:104923956-104923978 AAGAGGCCCAGGTACAGCTTGGG + Intergenic
997206855 5:132055240-132055262 GAGAGGGGAAGGGCCGGCCTGGG - Intergenic
997446370 5:133943254-133943276 GACAGCCCCAGGGCCTGCTTGGG - Intergenic
997507278 5:134427368-134427390 CAGAAGTCCAAGGCCAGCCTAGG + Intergenic
997518017 5:134504637-134504659 GAGACACCCAGGGGCATCCTTGG - Intergenic
997585316 5:135040049-135040071 AAGTGCCCCAGGGCCAGGCTGGG - Intronic
997646359 5:135484735-135484757 GAGAGGCGTAAGGCCAGCCACGG - Intergenic
998334885 5:141362333-141362355 GAGAACCCCAGGTCCAGGCTTGG - Exonic
999262278 5:150245382-150245404 TGGAGGCCCAGGGACTGCCTGGG + Intronic
1000302052 5:159965324-159965346 GGCAGGCTCAGGGCCAGGCTCGG + Intronic
1001191579 5:169637308-169637330 GCGAGGCCCCGGCCCAGCCATGG + Exonic
1001389434 5:171366863-171366885 GAGAGGCCAGTGGCCACCCTGGG - Intergenic
1002082168 5:176743585-176743607 GGGAGGCCAGGGGCCAGCCCCGG - Intergenic
1002191037 5:177477829-177477851 GAGGACCCCAGGACCAGCCTGGG - Intergenic
1002556566 5:180046243-180046265 CAGAACTCCAGGGCCAGCCTCGG + Intronic
1002563752 5:180098993-180099015 CAGAGGCCCTGGGCCTGGCTGGG - Intergenic
1004194193 6:13488645-13488667 CAGAGGTGCGGGGCCAGCCTTGG - Intergenic
1004727869 6:18327993-18328015 GCTTGACCCAGGGCCAGCCTTGG - Intergenic
1004814959 6:19302864-19302886 GAGCAGCCCAGGGACAGTCTGGG - Intergenic
1005334057 6:24775439-24775461 CGGAGGCCCAGCGCCAGGCTAGG - Intronic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1006153012 6:31999236-31999258 CAGAAGCCCAGCCCCAGCCTGGG - Intronic
1006159320 6:32031973-32031995 CAGAAGCCCAGCCCCAGCCTGGG - Intronic
1006192406 6:32217702-32217724 GAGAGTGCCAAGACCAGCCTGGG + Intronic
1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG + Intergenic
1006916909 6:37600643-37600665 GAGAGGCTCAGGGCAAGTCCGGG + Intergenic
1007134319 6:39506949-39506971 GAGAGGCACAGGGCAAGGCATGG - Intronic
1007380636 6:41488248-41488270 GAGAGGCTTGGGGCCAGCCCAGG - Intergenic
1007636030 6:43300345-43300367 GATAGGGGCAGGGCCAGCATGGG + Intronic
1010085083 6:71908088-71908110 CAGGGGCCCAGGACCAGCCTTGG - Intronic
1010148107 6:72695850-72695872 CAGAAGCTCAAGGCCAGCCTGGG + Intronic
1012461672 6:99469689-99469711 CAGAAGCTCAAGGCCAGCCTGGG - Intronic
1012881615 6:104797776-104797798 GAAATGCCCAGGGCCAGGCATGG + Intronic
1013503273 6:110773005-110773027 CAGGGGCTCAAGGCCAGCCTGGG + Intronic
1014884292 6:126760781-126760803 GAGAGCCAGAAGGCCAGCCTTGG + Intergenic
1015117595 6:129666550-129666572 GAGAGGGCCAGGGGCATTCTTGG - Intronic
1017764004 6:157592647-157592669 GAGAGGCCCCAGGCCATCTTGGG - Intronic
1017944120 6:159079552-159079574 GAGAGACCCAGTGCAAGGCTGGG - Intergenic
1018370754 6:163165649-163165671 GAGAGGCGCTGGCCCAGCGTGGG + Intronic
1018608567 6:165624221-165624243 GAGTGTGCCAGGGCCAGCCCAGG - Intronic
1018720186 6:166566301-166566323 GAGATGCCAAGGAGCAGCCTGGG - Intronic
1018810607 6:167295364-167295386 GGGAGGCCGAGGGACAGCCCCGG - Intronic
1019189698 6:170244723-170244745 GTGAGGCCCAGGGACAGCTTGGG - Intergenic
1019497319 7:1346582-1346604 GAGAACCCGGGGGCCAGCCTGGG + Intergenic
1019669610 7:2270416-2270438 CAGGGGTTCAGGGCCAGCCTGGG + Intronic
1019801410 7:3090963-3090985 GAGGGGGCAAGGGCCAGGCTTGG + Intergenic
1020006909 7:4788122-4788144 CAGACGCCCAAGGCCAGGCTGGG - Intronic
1020051892 7:5087111-5087133 CAGAGGTTCAAGGCCAGCCTGGG + Intergenic
1020098656 7:5382322-5382344 CAGAGGCCCAGCCCCAGCCCAGG + Intronic
1021931934 7:25589774-25589796 GACAAGCCCATGGCCACCCTAGG + Intergenic
1022157342 7:27673689-27673711 AAGAGGTCCAGGGCTGGCCTGGG - Intergenic
1022675463 7:32495403-32495425 GAGAGGCCGAGGTGGAGCCTGGG - Intergenic
1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG + Exonic
1023992191 7:45134876-45134898 TGGAGCCCCAGGGCCAGGCTGGG + Intergenic
1024248064 7:47485392-47485414 GAGAGGGCCAGCGCCAGCCACGG + Intronic
1024700008 7:51896678-51896700 GAGAGATCCAGGGACAGACTTGG - Intergenic
1025997289 7:66536009-66536031 GAGAGCCACAGAGCCAGCCCAGG + Intergenic
1026778367 7:73246485-73246507 CAGAAGCTCAAGGCCAGCCTGGG + Intergenic
1026875340 7:73876199-73876221 GAGACCCCCAGCCCCAGCCTTGG - Intergenic
1026968745 7:74455249-74455271 GCCAGGCCCAGGGCCATCCCGGG - Intronic
1027019224 7:74799874-74799896 CAGAAGCTCAAGGCCAGCCTGGG + Intronic
1027068804 7:75146065-75146087 CAGAAGCTCAAGGCCAGCCTGGG - Intronic
1029253359 7:99252394-99252416 GACAGGCCCAGGAGCAGCCGAGG + Intergenic
1030627585 7:111860645-111860667 GAGAGGCTCAGGGCCAGCGTAGG - Intronic
1032051136 7:128651753-128651775 GAGAGGCCCTGGGCCTGTCTAGG - Intergenic
1032189004 7:129752166-129752188 AGGAGGCCCAGGGACAGCCATGG - Intronic
1032268038 7:130381934-130381956 GCCAAGGCCAGGGCCAGCCTGGG + Intronic
1032476425 7:132214410-132214432 GAGAGGCCCAGGGCTGGGCTGGG + Intronic
1032478258 7:132226925-132226947 GTGAGGGACAGGCCCAGCCTGGG - Intronic
1033043167 7:137937025-137937047 AAGAGGCCCAAGGCCTGCCGGGG + Intronic
1034446653 7:151117185-151117207 GAGCGTCACAGGCCCAGCCTGGG + Intronic
1034453513 7:151150938-151150960 CAGAAGCTCAAGGCCAGCCTGGG - Intronic
1034544537 7:151781319-151781341 GTGAGGCCCAAGACCAGCCCCGG - Exonic
1035265033 7:157685593-157685615 GAGGGACCCGGGGCCAGCCGAGG + Intronic
1035739474 8:1915415-1915437 AGGAAGCCCAGAGCCAGCCTGGG + Intronic
1036215784 8:6878533-6878555 GTGAGGGTCTGGGCCAGCCTGGG + Intergenic
1036435817 8:8732185-8732207 GAGAGGCACATGGCCAGCCCGGG - Intergenic
1036698410 8:10994314-10994336 GAGGGGCCTAGAGCCAGGCTGGG - Intronic
1036708466 8:11061940-11061962 GGGAGGAGCAGGGCCAGCCGAGG - Intronic
1036791923 8:11726690-11726712 GGGAGGCCCAGAGCCAGGCAAGG + Intronic
1037703624 8:21296934-21296956 AATAGGCCCAGAGCCATCCTGGG - Intergenic
1039300804 8:36206739-36206761 CAGAAGCTCAAGGCCAGCCTAGG - Intergenic
1039444403 8:37619484-37619506 GAGAAGACCAAAGCCAGCCTTGG + Intergenic
1040676531 8:49757317-49757339 GAGAGGCCCAGGGCCAGAGGTGG - Intergenic
1042692865 8:71522816-71522838 TAGAAGCTCAGGGCCAGCCTGGG - Intronic
1043400196 8:79877073-79877095 GAGAGGACAAGGGCCTGCCTTGG - Intergenic
1043536774 8:81213789-81213811 GTGTTGCCCAAGGCCAGCCTGGG + Intergenic
1044430487 8:92102167-92102189 GCGAAGCCCGGGACCAGCCTCGG + Intronic
1045017247 8:98010307-98010329 GAGAGCCCCAGGGTGAGGCTGGG - Intronic
1045065178 8:98437875-98437897 GGGAAGCCCAGGGACACCCTTGG - Intronic
1045506238 8:102780809-102780831 GTGAGGCCCAGGGCCAGGTCTGG - Intergenic
1047496229 8:125410968-125410990 AGCCGGCCCAGGGCCAGCCTGGG + Intergenic
1049003177 8:139838871-139838893 GAGAGGCCCAGGGCCTCACCTGG + Intronic
1049231950 8:141489112-141489134 GGGAGGCCCAGGCCCAGCAGGGG - Intergenic
1049353642 8:142177309-142177331 CCCAGGCCCAGGGGCAGCCTTGG - Intergenic
1049443026 8:142617791-142617813 GAGATCAGCAGGGCCAGCCTGGG - Intergenic
1049468519 8:142764651-142764673 TAGGGGCCCAGGCCCAGGCTGGG + Exonic
1049509014 8:143018503-143018525 GGGAGGCTCCGGGCCAGCCGCGG + Intronic
1049531941 8:143159417-143159439 GAGGGGCCGAGGGCCGGGCTGGG + Intronic
1049673727 8:143880612-143880634 GAGCAGCCCAGGGGCAGCGTGGG - Intergenic
1049715101 8:144086060-144086082 TAGAGGCCCAGGGACAGCAGTGG - Exonic
1049773443 8:144394169-144394191 CAGAGGCCCAGGGTCAGCCCCGG + Intronic
1050667428 9:7956538-7956560 GAGAAGTTCGGGGCCAGCCTGGG + Intergenic
1051346023 9:16151990-16152012 GAGATTCCCAGGGGCAGCCTAGG - Intergenic
1053240332 9:36489372-36489394 GAGAGGACCAGGCAAAGCCTTGG + Intergenic
1055167882 9:73219175-73219197 AAGAGGCCAAGGGACAGCTTGGG + Intergenic
1056265249 9:84890335-84890357 GACAGGCTCAGAGCCAGACTGGG + Intronic
1057146734 9:92764074-92764096 GAGAGGCCGAGGGTGGGCCTGGG - Intronic
1057740878 9:97710349-97710371 GAAAGGCCCAGAGACACCCTAGG + Intergenic
1060242368 9:121914914-121914936 GAGAGGACCTGGGCCACACTTGG - Intronic
1060839255 9:126781350-126781372 GGGAGGACCAGGGCGAGCCTGGG + Intergenic
1060973782 9:127753564-127753586 GAGAGGCCCAGGGCTGGGCTAGG + Intronic
1061067243 9:128286159-128286181 GAGAGGGGCTGGGGCAGCCTAGG - Intronic
1061255362 9:129452024-129452046 GAGTGGACATGGGCCAGCCTGGG + Intergenic
1061349596 9:130053975-130053997 CGGAGGCCCGCGGCCAGCCTAGG - Exonic
1061427666 9:130510249-130510271 GAAAGGGCCAGGGCCAGGCATGG - Intergenic
1061572096 9:131484232-131484254 GAGATGCCCTGGGCCAGACAGGG - Intronic
1061587870 9:131580048-131580070 TCCAGGCCCAGGGCCAGGCTAGG + Intronic
1061811789 9:133166618-133166640 CAGCAGCTCAGGGCCAGCCTGGG + Intergenic
1061949228 9:133926902-133926924 GGGAGGCCCAGCACCAGCCCTGG + Intronic
1062059270 9:134486260-134486282 CAAAGGCGCTGGGCCAGCCTGGG - Intergenic
1062171061 9:135134976-135134998 CCGAGGCTCAGGGCCAGCATGGG - Intergenic
1062270689 9:135706992-135707014 GACAGGCCCAAGGCCAGGCACGG + Intronic
1062320100 9:135986570-135986592 GAAGCACCCAGGGCCAGCCTGGG + Intergenic
1062391858 9:136337075-136337097 GAGTGGGGCAGGGCCAGCCCAGG + Intronic
1062394981 9:136349185-136349207 GACAGGCACAGGGCCAGCCCAGG - Intronic
1062526260 9:136979165-136979187 GAGAGGTCCAGGGACACCCTCGG + Intronic
1062543750 9:137052847-137052869 CTGAGGCCCACGGCCAGCCTCGG - Intronic
1062549439 9:137079179-137079201 GTGAGGGGCGGGGCCAGCCTCGG - Intronic
1062729707 9:138102075-138102097 GAGACGCCCGAGGCCAGCCCAGG - Intronic
1186177470 X:6940201-6940223 GACAGGCAGAGGGCCAGGCTTGG - Intergenic
1187694328 X:21903386-21903408 GAGGGGTTCAAGGCCAGCCTGGG - Intergenic
1188486068 X:30683878-30683900 GAGAAGCCCAAGGCCTGCTTTGG - Intronic
1190300910 X:49057067-49057089 GTGAGGCCCAGGGCCCAGCTGGG + Intronic
1191840943 X:65513309-65513331 AAGGGGCCCAAGGCCAGGCTTGG + Intronic
1192244156 X:69359241-69359263 GAAAGGTCCAAAGCCAGCCTGGG - Intergenic
1192319349 X:70077060-70077082 GGGATGCCCTGGGCCAGCTTGGG + Intergenic
1195135840 X:101906668-101906690 TGGAGCCACAGGGCCAGCCTGGG - Intronic
1195709080 X:107759865-107759887 AGGAGCCTCAGGGCCAGCCTGGG + Intronic
1199384561 X:147208562-147208584 GGGTGCCCCAGTGCCAGCCTTGG + Intergenic
1199590964 X:149468141-149468163 GAGTGGCTCAGGGCCAGCTGGGG + Intergenic
1200085677 X:153603478-153603500 GAGGGGCTCAGGGGCTGCCTAGG - Intergenic
1200120029 X:153785854-153785876 GAAGGTCCTAGGGCCAGCCTAGG + Exonic