ID: 968550082

View in Genome Browser
Species Human (GRCh38)
Location 4:1217590-1217612
Sequence CACCGGCAGCCCGACTTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968550082_968550095 27 Left 968550082 4:1217590-1217612 CCCCGGAAGTCGGGCTGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 968550095 4:1217640-1217662 GCGCCGGCCACGCCTGACACGGG 0: 1
1: 0
2: 0
3: 4
4: 63
968550082_968550088 1 Left 968550082 4:1217590-1217612 CCCCGGAAGTCGGGCTGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 968550088 4:1217614-1217636 CGAAAACCAGCTAAAGCCGCGGG 0: 1
1: 0
2: 1
3: 0
4: 39
968550082_968550089 5 Left 968550082 4:1217590-1217612 CCCCGGAAGTCGGGCTGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 968550089 4:1217618-1217640 AACCAGCTAAAGCCGCGGGCCGG No data
968550082_968550087 0 Left 968550082 4:1217590-1217612 CCCCGGAAGTCGGGCTGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 968550087 4:1217613-1217635 GCGAAAACCAGCTAAAGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 35
968550082_968550094 26 Left 968550082 4:1217590-1217612 CCCCGGAAGTCGGGCTGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 968550094 4:1217639-1217661 GGCGCCGGCCACGCCTGACACGG No data
968550082_968550091 11 Left 968550082 4:1217590-1217612 CCCCGGAAGTCGGGCTGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968550082 Original CRISPR CACCGGCAGCCCGACTTCCG GGG (reversed) Intronic
905116024 1:35641534-35641556 CGCCTGCAGCACGACTTCCACGG + Exonic
912492533 1:110070173-110070195 CAGCGCCAACCCGGCTTCCGTGG + Intronic
913109115 1:115642059-115642081 CGCCGGCCGCCCGAGCTCCGCGG - Exonic
921384961 1:214559274-214559296 CCCCTGCAGCCCGGCTTCTGAGG + Intergenic
1070773953 10:79099246-79099268 CACCAGCACACCGACTCCCGGGG - Intronic
1090392531 11:126398418-126398440 CTCCGGCAGCCCTGCTTCCCTGG + Intronic
1093464944 12:19439762-19439784 CCCCGGCAGCCCGGGTTCGGCGG + Exonic
1093547892 12:20369396-20369418 CCACGGCAGCCCGAGTCCCGCGG - Exonic
1104986558 12:132600834-132600856 CACCGGCAGCCCCTCTGCCATGG + Intergenic
1107681880 13:42860411-42860433 AACCAGCAGCCCAAATTCCGGGG - Intergenic
1121089270 14:91170045-91170067 CACCGGCAGCCTGGCTTCGCTGG + Exonic
1123880635 15:24675625-24675647 CACCGGCAGCGGGGCTTCCGGGG + Intergenic
1131493530 15:92882942-92882964 CCGCGGCAGCCCCACTCCCGCGG - Intergenic
1138595269 16:58026229-58026251 GACCGGGAGCCCGAGGTCCGCGG + Exonic
1142011064 16:87714404-87714426 CACCGCCAGCCCCACATCCATGG + Intronic
1151834595 17:76574481-76574503 CAGCGGCACCCCCACTTCCGTGG - Exonic
1160895743 19:1401157-1401179 CACCTGCAGCCCCACTTCCCAGG + Intronic
1161545638 19:4878481-4878503 CCCCGCCAGCCCGGCTTCCTTGG + Intergenic
1165101445 19:33440930-33440952 CATGGGCAGCCTGACTTCCCAGG + Intronic
1165756992 19:38299373-38299395 CACCAGCAGCCATCCTTCCGAGG - Intronic
1167151857 19:47714634-47714656 CACAGGCAGCCTGACCTCAGAGG - Intronic
1168687419 19:58357313-58357335 CACCGGCAGCCCGGCTCCTCTGG + Exonic
933235469 2:79859505-79859527 CACCTGCAGCCTGAGCTCCGAGG + Intronic
936084064 2:109454526-109454548 CGCCGGCTGCCTGACTTCTGTGG + Intronic
936156034 2:110048064-110048086 GACCGCCAGCCCCACTTCCCAGG + Intergenic
936188654 2:110323364-110323386 GACCGCCAGCCCCACTTCCCAGG - Intergenic
937905820 2:127052326-127052348 AGCCGGCAGCCTGCCTTCCGGGG - Exonic
944210208 2:197198935-197198957 CAGCGCCAGCCCGACATCGGCGG + Intronic
1171278119 20:23875827-23875849 AACCAGCAGCCCAACTTCTGGGG + Intergenic
1177281417 21:18987247-18987269 CAGAGACAGCCAGACTTCCGGGG + Intergenic
1179361573 21:40714256-40714278 CAGGGCCAGCCCCACTTCCGTGG - Intronic
1179393074 21:41011336-41011358 CACAGGCAGTCCTGCTTCCGGGG + Intergenic
1179776789 21:43669435-43669457 AACGGGCAGCCCCACTTCCGAGG - Intronic
1179824682 21:43957443-43957465 CACCGCCAGCCTGACTGCCAGGG + Intronic
1180837258 22:18936138-18936160 CACCGGCGGCCGCACTGCCGTGG + Exonic
1182029908 22:27150459-27150481 CAACGGCAACCAGACTTCCTGGG + Intergenic
1184417414 22:44360386-44360408 CACCGGCTGCCAGACTTAAGTGG - Intergenic
1203287351 22_KI270734v1_random:161437-161459 CACCGGCGGCCGCACTGCCGTGG + Intergenic
950660947 3:14466729-14466751 CACTGGCAGCACATCTTCCGTGG + Intronic
959539769 3:107524946-107524968 GAACGGCAGCCCGGCGTCCGCGG - Intronic
964771320 3:160226282-160226304 CACTGGCAGCACGACCTCCCCGG - Exonic
968550082 4:1217590-1217612 CACCGGCAGCCCGACTTCCGGGG - Intronic
973079304 4:45970380-45970402 CACTGGCAGCCCTACCTCCCTGG - Intergenic
991428085 5:66512358-66512380 CACAGGCAGCCTGACTTCAGAGG + Intergenic
995650074 5:114361056-114361078 CTCCGGCAGCCCGAATCCGGAGG - Exonic
1002278861 5:178119496-178119518 CACTGGCTGCCCAACTTCCCTGG - Intronic
1007391662 6:41552979-41553001 CACCTGCAGCCCCACATCCTCGG + Intronic
1019180652 6:170185759-170185781 CATCGGTAGCCCGGCCTCCGTGG - Intergenic
1019891637 7:3951814-3951836 CATCAGCAACCCGACGTCCGCGG + Exonic
1021985894 7:26098185-26098207 CACTGGCAGCCCCACGTCCCAGG + Intergenic
1024676997 7:51646033-51646055 CACCGCCAGCCCATCTTCAGAGG - Intergenic
1031267030 7:119594007-119594029 AACCGGAAGCCTGACATCCGTGG + Intergenic
1052833619 9:33234508-33234530 CACCAGCAGCCTGACTCCCAGGG - Intronic
1056176038 9:84036934-84036956 CACTGCCAGCTCCACTTCCGGGG + Intergenic
1058671810 9:107366589-107366611 CACTGGCAGCCAGCCTTCCCTGG - Intergenic
1061014193 9:127972534-127972556 CACCGGCAGCCCTGCTTCACAGG + Intronic
1062209996 9:135358363-135358385 CCCCGGCAGCCCCACCTCCTAGG - Intergenic
1062343086 9:136102414-136102436 CCCCGGCAGCCAGACCTCAGAGG - Intergenic
1062460100 9:136659414-136659436 CTCCTGCAGCCCGGCTCCCGCGG + Exonic
1187497359 X:19806934-19806956 CTCTGGCAGCCTGACTTCCCAGG - Intronic