ID: 968550083

View in Genome Browser
Species Human (GRCh38)
Location 4:1217591-1217613
Sequence CCACCGGCAGCCCGACTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968550083_968550088 0 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550088 4:1217614-1217636 CGAAAACCAGCTAAAGCCGCGGG 0: 1
1: 0
2: 1
3: 0
4: 39
968550083_968550091 10 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550083_968550089 4 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550089 4:1217618-1217640 AACCAGCTAAAGCCGCGGGCCGG No data
968550083_968550094 25 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550094 4:1217639-1217661 GGCGCCGGCCACGCCTGACACGG No data
968550083_968550087 -1 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550087 4:1217613-1217635 GCGAAAACCAGCTAAAGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 35
968550083_968550095 26 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550095 4:1217640-1217662 GCGCCGGCCACGCCTGACACGGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968550083 Original CRISPR CCACCGGCAGCCCGACTTCC GGG (reversed) Intronic
900415512 1:2532737-2532759 CCTCCGGCAGGCCGCCATCCTGG - Intergenic
900936167 1:5767496-5767518 CCACAGGCAGCCAGACTTTAAGG + Intergenic
902640304 1:17762645-17762667 CCACCTGCAGCCCAACCCCCTGG - Intronic
905485360 1:38292338-38292360 CCACAGGAAGCCGGGCTTCCAGG + Intergenic
910605566 1:89080072-89080094 CCACAGGCAGCCAGACTTTAAGG - Intergenic
911071286 1:93833681-93833703 CCACAGGCAGTCAGACTTCATGG + Intronic
911317334 1:96370925-96370947 CCACAGGCATCCCCACTCCCAGG - Intergenic
916991654 1:170251086-170251108 CCACCTGCAGCCCCAGTTCACGG + Intergenic
917821188 1:178765870-178765892 CCACAGGCAGCCAGACTTTAAGG + Intronic
1065936180 10:30522535-30522557 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1066331366 10:34427193-34427215 CCACAGGCAGCCAGACTTTCAGG - Intronic
1066642236 10:37566304-37566326 CCACAGGCAGCCAGACTTCAAGG - Intergenic
1070482488 10:76896333-76896355 CCACAGGCAGCCAGACTTTAAGG + Intronic
1070854856 10:79599582-79599604 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1071189325 10:83081710-83081732 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1071986650 10:91058349-91058371 CCACCAGCAGCACTACTTTCAGG + Intergenic
1072303580 10:94085619-94085641 CCAGCGGTTGCCTGACTTCCAGG + Intronic
1072387306 10:94944075-94944097 CCACAGGCAGCCAGACTTCAAGG + Intronic
1073003316 10:100301586-100301608 CCACAGGCAGCCAGACTTTAAGG + Intronic
1073930120 10:108566364-108566386 CCCCCTGCAGCCCGCCTCCCTGG + Intergenic
1076478523 10:130768883-130768905 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1076688581 10:132209245-132209267 CCTCCAGCAGCCAGACTGCCCGG + Intronic
1076881851 10:133243512-133243534 CCATCGGCAGCCTGAGTCCCCGG - Intergenic
1077332928 11:1991241-1991263 CCACCTGCAGGCCGGCTTGCTGG - Intergenic
1080694914 11:34595098-34595120 CCACCGGCAGCTCCATTTGCAGG + Intergenic
1081774096 11:45665807-45665829 CCGCCGGCCGCCCGAAGTCCGGG - Intergenic
1082573024 11:54765522-54765544 CCACAGGCAGCCTGACTTTAAGG - Intergenic
1083657004 11:64234610-64234632 CCACCGGCCGCCCGCCCGCCCGG + Exonic
1083800154 11:65041820-65041842 CCCCCGCCAACCCGCCTTCCAGG + Exonic
1083951654 11:65959879-65959901 CCACCGGCAGCCAGCCTGACAGG + Exonic
1084204087 11:67581370-67581392 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1085649044 11:78250659-78250681 CCACAGGTAGCCGTACTTCCTGG - Intronic
1087654821 11:100909619-100909641 CCACCGGCATCCAGCCTTCTAGG + Intronic
1088494800 11:110422016-110422038 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1091105415 11:132914665-132914687 CCACAGGCAGTTCGACATCCTGG - Intronic
1202815911 11_KI270721v1_random:46417-46439 CCACCTGCAGGCCGGCTTGCTGG - Intergenic
1091386818 12:101227-101249 CCACCTGCAGCCCTAGCTCCAGG + Intronic
1094088939 12:26626533-26626555 CAACCGCCAGCAAGACTTCCTGG + Intronic
1094377154 12:29802185-29802207 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1094860587 12:34461737-34461759 CCACAGGCAGCCAGACTTGAAGG + Intergenic
1097641747 12:62191255-62191277 CTACCTGCAGCCCCGCTTCCCGG + Exonic
1101855850 12:108442106-108442128 CCACTGGCAGCCAGTCCTCCAGG + Intergenic
1103166619 12:118775174-118775196 CCACAGGCAGCTCCACTCCCAGG + Intergenic
1106341166 13:28828239-28828261 CCACAGGCAGCCAGACTTTAAGG + Intronic
1106390898 13:29335057-29335079 CCACAGGCAGCCAGACTTTAAGG - Intronic
1112436706 13:99395719-99395741 CCACCGAGAGTCCCACTTCCTGG - Intergenic
1114092557 14:19302524-19302546 CCACCCGAAGCCCGCCATCCCGG - Intergenic
1116237499 14:42297641-42297663 CCACGGGCAGCCAGACTTTAAGG + Intergenic
1121322193 14:92998414-92998436 CCACCGGCAGCCCAGGCTCCAGG + Intronic
1122277894 14:100604556-100604578 CCACCGCCACCCCCACTTCAAGG - Intergenic
1123880634 15:24675624-24675646 CCACCGGCAGCGGGGCTTCCGGG + Intergenic
1123923177 15:25085060-25085082 CCACAGGCAGCCCCTCTTACTGG - Intergenic
1126724081 15:51613031-51613053 CCACAGGCAGCCAGACTTTAAGG + Intronic
1129251745 15:74312967-74312989 CCAGAGGCAGCCAGCCTTCCAGG - Intronic
1131176292 15:90211639-90211661 CCAGCAGCAGCCCCACCTCCAGG - Intronic
1131510179 15:93045366-93045388 CAACCAGCAGATCGACTTCCAGG - Exonic
1132142015 15:99404414-99404436 GCACCAGCAGCCAGATTTCCTGG + Intergenic
1133296049 16:4752860-4752882 CCATGGGAAGCCCGTCTTCCTGG + Exonic
1135407260 16:22207076-22207098 CCTGCGTCAGCCCGAATTCCCGG + Intronic
1136466157 16:30445415-30445437 CTGCCGGCAGGCCGGCTTCCTGG + Exonic
1137299131 16:47129913-47129935 CCACCCCCAACCCCACTTCCTGG - Intronic
1138189964 16:55006785-55006807 CTACCCTCAGCCCCACTTCCAGG - Intergenic
1139406855 16:66725854-66725876 CCACCAGCACCAGGACTTCCAGG + Exonic
1141627152 16:85267246-85267268 CCACTGCCACCCCCACTTCCTGG - Intergenic
1142290336 16:89191348-89191370 CCACTTGCAGCCAGTCTTCCGGG - Exonic
1143165934 17:4897330-4897352 CCCCCTGCAGCCAGGCTTCCCGG + Exonic
1143936132 17:10485626-10485648 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1144923143 17:18781265-18781287 CCTACGCCAGCCCTACTTCCGGG - Exonic
1147882236 17:43661378-43661400 CCACCAGAAACCAGACTTCCTGG - Exonic
1147915549 17:43883202-43883224 CCTCCAGGAGCCCCACTTCCAGG - Exonic
1149994756 17:61400565-61400587 CGGCCGGCAGCCCTACCTCCCGG - Exonic
1150807721 17:68332297-68332319 CCACAGGCAGCCAGACTTTAAGG + Intronic
1151625682 17:75274165-75274187 CCACAGGCAGCCGTTCTTCCTGG - Intronic
1152571820 17:81124346-81124368 CCACCGTCAGCCCCTCTGCCTGG + Intronic
1152649153 17:81483953-81483975 CCTTCCGCAGCCCGAATTCCAGG + Intergenic
1153001962 18:463967-463989 CCACCCCCAGCCCGAGCTCCAGG + Intronic
1156282234 18:35650723-35650745 CCACAGGCAGCCAGACTTTAAGG + Intronic
1159280114 18:66274294-66274316 CCACTGGCAGCCAGACTTTAAGG - Intergenic
1159684399 18:71400091-71400113 CCTCCTACAGCCCTACTTCCAGG + Intergenic
1160249266 18:77186690-77186712 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1161451105 19:4345863-4345885 CCAGCCACAGCCCGACTTCTTGG - Exonic
1162140045 19:8580340-8580362 CCAGGGGCACCCCGACATCCAGG - Exonic
1162799976 19:13104951-13104973 CCAGCGGCAGCCCCAGGTCCAGG + Exonic
1165263095 19:34637283-34637305 CCCCAGGCAGCCCCACTACCTGG - Intronic
1165300509 19:34965425-34965447 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1165927388 19:39335519-39335541 CCTCCGGCAGTCTGACTCCCTGG - Exonic
1166331201 19:42079035-42079057 CCACCGGCAGACGCACCTCCGGG + Exonic
1166912575 19:46170542-46170564 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1167517390 19:49930988-49931010 CCACTGGAAGCCCGCCCTCCAGG - Exonic
1167863607 19:52305943-52305965 CAACTGGCAGCCTGACTTGCTGG + Intronic
925005744 2:441763-441785 CTCCCGACAGCCCAACTTCCAGG + Intergenic
926205362 2:10831483-10831505 CACCCGGCAGCCCCACATCCTGG + Intronic
927209997 2:20633290-20633312 CCAGCCTCAGCCCCACTTCCTGG - Intronic
927625350 2:24711082-24711104 CCACTGCCAGACCCACTTCCAGG + Exonic
928708339 2:33976613-33976635 CCACAGGCAGCCAGACTTTAAGG - Intergenic
931578464 2:63746452-63746474 CCACAGGCAGCCAGACTTTAAGG - Intronic
934758394 2:96840041-96840063 CACCCGGCACCCCGACTGCCTGG - Exonic
935018286 2:99205457-99205479 CCACAGGCAGCCAGACTTTAAGG - Intronic
937236182 2:120433089-120433111 CCACAGGCTGCCCTCCTTCCAGG - Intergenic
937349651 2:121152903-121152925 CCACCTGCCGCCCTCCTTCCAGG + Intergenic
937794648 2:126002662-126002684 CCACAGGCAGCCAGACTTTAAGG - Intergenic
937905821 2:127052327-127052349 CAGCCGGCAGCCTGCCTTCCGGG - Exonic
938773768 2:134523225-134523247 CCACCTGCAGACCCACTCCCAGG - Intronic
941111043 2:161418770-161418792 CAGCCTGCAGCCCGCCTTCCAGG - Intronic
947276524 2:228397763-228397785 CCACAGGCAGCCAGACTTTAAGG + Intergenic
947626293 2:231621302-231621324 CCACCCCTACCCCGACTTCCTGG + Intergenic
948012837 2:234663750-234663772 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1171256589 20:23693250-23693272 CAACCAGCAGCCCGAGTTCCCGG - Intergenic
1172151570 20:32794267-32794289 CAAACTGCAGCCTGACTTCCTGG - Intronic
1176914607 21:14610113-14610135 CCACAGGCAGCCAGACTTTAAGG - Intronic
1177281416 21:18987246-18987268 CCAGAGACAGCCAGACTTCCGGG + Intergenic
1179824681 21:43957442-43957464 GCACCGCCAGCCTGACTGCCAGG + Intronic
1179940483 21:44636580-44636602 CCACAGTCAGCCCCACTGCCCGG - Intronic
1180488172 22:15820042-15820064 CCACCCGAAGCCCGCCATCCCGG + Intergenic
1180956274 22:19742811-19742833 ACAGCGGCAGCCTGGCTTCCAGG - Intergenic
1181112584 22:20610646-20610668 CCCCCGGCAGCCCAACCTCCAGG - Intergenic
1182029907 22:27150458-27150480 ACAACGGCAACCAGACTTCCTGG + Intergenic
1183255502 22:36759070-36759092 CCTCCTGCAGCCCCAGTTCCTGG - Intronic
1184681016 22:46072083-46072105 CCACCGCCCGCCCGACGGCCCGG + Intronic
1185294739 22:50047525-50047547 CCACCTGCAGCCCCACATCGGGG - Intronic
949787862 3:7761545-7761567 CCACAGGCAGCCAGACTTTAAGG - Intergenic
954153997 3:48674660-48674682 CCACCGGCTACCCGACCTGCAGG - Exonic
954295894 3:49674337-49674359 CCCCCGGAAGCCTCACTTCCGGG + Exonic
954807407 3:53228585-53228607 CCACCTGCAGCCAGTCTACCTGG - Intronic
955978089 3:64497484-64497506 CCACCTCCAGCCTGAGTTCCAGG + Intergenic
957756229 3:84491917-84491939 CCACAGGCAGCCAGACTTTAAGG - Intergenic
958684179 3:97371669-97371691 CCACAGGCAGCCAGACTTTAAGG - Intronic
961061759 3:123834507-123834529 CCACCTGCACCCCCACCTCCAGG - Intronic
964514652 3:157494622-157494644 CCACCTGCATCCCTACTCCCTGG - Intronic
964840115 3:160984355-160984377 CCACAGGCAGCCAGACTTTAAGG + Intronic
964908118 3:161743726-161743748 CCACAGGCAGCCAGACTTTAAGG - Intergenic
966743478 3:183254326-183254348 TCCCCGGCTTCCCGACTTCCCGG - Intronic
968550083 4:1217591-1217613 CCACCGGCAGCCCGACTTCCGGG - Intronic
978505664 4:109453563-109453585 CCACAGGCAGCCAGACTTTAAGG + Intronic
980762095 4:137248029-137248051 CCACAGGCAGGACCACTTCCAGG + Intergenic
981782910 4:148445658-148445680 CCGCCGGCCGCCCGCCTGCCGGG - Intergenic
984906001 4:184626268-184626290 CCACAGGCAGCCAGACTTTAAGG + Intergenic
985676551 5:1234456-1234478 CTATCTGCAGCCCGAGTTCCTGG + Intronic
987571961 5:19675571-19675593 CCACAGGCAGCCAGACTTTAAGG + Intronic
988245539 5:28675612-28675634 CCACAGGCAGCCAGACTTTAAGG + Intergenic
989771495 5:45151893-45151915 CCACAGGCAGCCAGACTTTAAGG - Intergenic
990300449 5:54444647-54444669 CCACAGGCAGCCAGACTTTAAGG - Intergenic
993411260 5:87576254-87576276 CCACAGGCAGCCAGACTTTAAGG - Intergenic
997750121 5:136336305-136336327 TCACCGGCAGCCCTAATACCTGG + Intronic
997866530 5:137468733-137468755 CCGCCTTCAGCCCCACTTCCAGG + Intronic
999308663 5:150537283-150537305 CCACAGGCAGCCAGACTTTAAGG - Intronic
1000382644 5:160642859-160642881 CCATAGGCAGCCCGACTAGCTGG + Intronic
1006902886 6:37514381-37514403 CTACAGGCAGCCCCACCTCCTGG - Intergenic
1006929004 6:37676297-37676319 CCACTGCCATCCCCACTTCCTGG - Intronic
1007371273 6:41428175-41428197 CCTCCGGAAGGCCGGCTTCCCGG - Intergenic
1007614955 6:43174343-43174365 CCGCCCGCAGCCCGCCTGCCTGG + Intronic
1010221426 6:73451999-73452021 CTGCCGGGATCCCGACTTCCTGG + Exonic
1011124782 6:83995580-83995602 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1013927778 6:115493806-115493828 CCACAGGCAGCCAGACTTTCAGG + Intergenic
1015206474 6:130645130-130645152 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1015366260 6:132401162-132401184 CCACGGGCGGCCCTACCTCCAGG - Exonic
1017827927 6:158096077-158096099 CCAGAGGCAGCCCCACTTCTTGG + Exonic
1018276894 6:162142315-162142337 CATCCGGCAGTCAGACTTCCTGG + Intronic
1019520932 7:1460143-1460165 CCCTCGGCAGCCCGGCCTCCCGG + Intergenic
1019989693 7:4682749-4682771 CCACCTGCAGCTCAGCTTCCAGG + Exonic
1020005432 7:4781546-4781568 CCACGGGCATCTCGCCTTCCAGG + Exonic
1020275758 7:6623606-6623628 CCACCCGGAGCAGGACTTCCTGG - Exonic
1020615770 7:10458733-10458755 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1021668635 7:23013536-23013558 CCACCGGCCGCCCCTCTGCCGGG - Intronic
1022686799 7:32604485-32604507 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1023523869 7:41078307-41078329 CTAGCGGCAGTCCGAGTTCCTGG - Intergenic
1024213049 7:47223446-47223468 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1024403054 7:48946947-48946969 CCACAGGCAGCCAGACTTTTAGG + Intergenic
1024891994 7:54213568-54213590 CCACAGGCAGCCAGACTTCAAGG + Intergenic
1024946093 7:54808895-54808917 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1025813383 7:64889263-64889285 CTGCCGGGAGCCCGACCTCCCGG - Intronic
1025819348 7:64947752-64947774 CCGCCGGGAGCCCGACTTCCTGG + Intergenic
1031513858 7:122679122-122679144 CCACAGGCAGCCAGACTTTAAGG - Intronic
1032723475 7:134569969-134569991 CCACAGGCAGCCAGACTTTAAGG - Intronic
1033677121 7:143553584-143553606 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1033694714 7:143775853-143775875 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1035556340 8:569868-569890 ACACAGGCAGCACCACTTCCAGG + Intergenic
1035687681 8:1537648-1537670 CCACAGGCATCACGAGTTCCAGG - Intronic
1037204218 8:16294637-16294659 CCACAGGCAGCCAGACTTTAAGG - Intronic
1038152597 8:24956143-24956165 GCACCAGCAGCTCGGCTTCCAGG + Exonic
1038575629 8:28701561-28701583 CTGCCGGCCGCCCGCCTTCCAGG - Exonic
1039111422 8:34044214-34044236 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1040091593 8:43404363-43404385 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1040679095 8:49787417-49787439 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1042355636 8:67824510-67824532 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1045148728 8:99378267-99378289 CCACAGGCAGCCAGACTTTAAGG + Intronic
1046868905 8:119182162-119182184 CCACAGGCAGCCAGACTTTAAGG + Intronic
1047994900 8:130325000-130325022 TCACCGGCAGCCCTGCTTGCAGG + Intronic
1049844186 8:144792183-144792205 CCCCCGCCAGCCCGGCTTTCCGG + Intronic
1050606682 9:7309094-7309116 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1051833764 9:21311244-21311266 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1052833620 9:33234509-33234531 CCACCAGCAGCCTGACTCCCAGG - Intronic
1053087620 9:35239838-35239860 CCACAGGCAGCCAGACTTCAAGG + Intronic
1058357868 9:104105321-104105343 CCACCGTCTGCCCGCTTTCCAGG + Intronic
1058549021 9:106093513-106093535 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1059268999 9:113060748-113060770 CCACCGGGGGCCCGGGTTCCTGG + Intergenic
1059270135 9:113066197-113066219 CCACCGGGGGCCCGGGTTCCTGG + Intergenic
1059272402 9:113077091-113077113 CCACCGGGGGCCCGGGTTCCTGG + Intergenic
1059273537 9:113082533-113082555 CCACCGGGGGCCCGGGTTCCTGG + Intergenic
1059274673 9:113087979-113088001 CCACCGGGGGCCCGGGTTCCTGG + Intergenic
1060555431 9:124505138-124505160 CCAGCCGCAGCCCGGCTCCCCGG + Intronic
1061119823 9:128635803-128635825 CCACCCCCAGCCTGACTTCCTGG + Intronic
1062452059 9:136619993-136620015 CCATGGGCAGCCAGCCTTCCGGG - Intergenic
1203787970 EBV:138334-138356 CAACCGGCAGCTCCTCTTCCGGG - Intergenic
1186515699 X:10164881-10164903 CCACCGGCAGCCTGACAGCTTGG - Intronic
1186994583 X:15106154-15106176 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1187644707 X:21334668-21334690 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1188776561 X:34226776-34226798 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1188822800 X:34796407-34796429 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1188823536 X:34802773-34802795 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1192177057 X:68892765-68892787 CCACCGCCTGCCCGCCTGCCCGG - Intergenic
1192589278 X:72346518-72346540 CCTCTGGCAGCCTGACATCCGGG - Intronic
1194022844 X:88715150-88715172 CCACAGGCAGCCAGACTTTAAGG + Intergenic
1195838284 X:109144056-109144078 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1199337696 X:146639930-146639952 CCACAGGCAGCCAGACTTTAAGG - Intergenic
1199360811 X:146916038-146916060 CCACAGGCAGCCAGACTTTAAGG + Intergenic