ID: 968550083

View in Genome Browser
Species Human (GRCh38)
Location 4:1217591-1217613
Sequence CCACCGGCAGCCCGACTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968550083_968550094 25 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550094 4:1217639-1217661 GGCGCCGGCCACGCCTGACACGG No data
968550083_968550091 10 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550083_968550087 -1 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550087 4:1217613-1217635 GCGAAAACCAGCTAAAGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 35
968550083_968550089 4 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550089 4:1217618-1217640 AACCAGCTAAAGCCGCGGGCCGG No data
968550083_968550095 26 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550095 4:1217640-1217662 GCGCCGGCCACGCCTGACACGGG 0: 1
1: 0
2: 0
3: 4
4: 63
968550083_968550088 0 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550088 4:1217614-1217636 CGAAAACCAGCTAAAGCCGCGGG 0: 1
1: 0
2: 1
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968550083 Original CRISPR CCACCGGCAGCCCGACTTCC GGG (reversed) Intronic