ID: 968550086

View in Genome Browser
Species Human (GRCh38)
Location 4:1217607-1217629
Sequence CTTTAGCTGGTTTTCGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968550086_968550095 10 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550095 4:1217640-1217662 GCGCCGGCCACGCCTGACACGGG 0: 1
1: 0
2: 0
3: 4
4: 63
968550086_968550102 30 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550102 4:1217660-1217682 GGGAGAGCAGCGGCTGTTCGGGG No data
968550086_968550100 28 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550100 4:1217658-1217680 ACGGGAGAGCAGCGGCTGTTCGG No data
968550086_968550101 29 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550101 4:1217659-1217681 CGGGAGAGCAGCGGCTGTTCGGG 0: 1
1: 0
2: 1
3: 8
4: 150
968550086_968550094 9 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550094 4:1217639-1217661 GGCGCCGGCCACGCCTGACACGG No data
968550086_968550091 -6 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550086_968550098 20 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550098 4:1217650-1217672 CGCCTGACACGGGAGAGCAGCGG 0: 1
1: 0
2: 0
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968550086 Original CRISPR CTTTAGCTGGTTTTCGCCAC CGG (reversed) Intronic
900157510 1:1209131-1209153 CTGCAGCTGGTTTTCTCCCCTGG - Intergenic
902265071 1:15257447-15257469 CTTTTGGTGGATTTCGTCACAGG - Intronic
905374715 1:37512279-37512301 CTTCATCTGGTTTTCCCCAATGG - Intronic
908797804 1:67848369-67848391 CTTTTCCTGGTTTTCCCCAGTGG + Intergenic
911924366 1:103809453-103809475 CTTTACCTGATTTTCCCCAAAGG - Intergenic
911973150 1:104462229-104462251 CTTCAGCTGATTTTCCCCACAGG - Intergenic
914758514 1:150579981-150580003 TTTTTGCTGGTTTTCGCCAGAGG + Intergenic
916967118 1:169959675-169959697 CTTTATCTGGTTTTGGAAACTGG + Intronic
918514799 1:185351481-185351503 CATTAGCAGCTTTTCACCACTGG - Intergenic
1062876127 10:944320-944342 AGTTAGTTGGTTTTCACCACAGG + Intergenic
1066059585 10:31709925-31709947 CTTTAGCTTTTTTTCACCTCTGG - Intergenic
1074974307 10:118567821-118567843 CTGGAGCTGGTTCTCACCACAGG + Intergenic
1083741810 11:64715261-64715283 CTTTACCTGGGTTTCCCCAGTGG - Intronic
1084403488 11:68958193-68958215 CTTTGGCTGGTGCTGGCCACTGG - Intergenic
1087527652 11:99337548-99337570 CTTTAGGTGGTTTTCTGCCCTGG + Intronic
1091668646 12:2437153-2437175 CTTTAGCTGGGTTACACCAGTGG + Intronic
1093089636 12:14906638-14906660 CTGTATCTCGTTTTCTCCACAGG - Intergenic
1098267324 12:68735841-68735863 CTGTAGCTGGTTCTCAACACAGG - Intronic
1104544212 12:129696596-129696618 CTTTCGTTGCTTTTCACCACAGG - Intronic
1110386090 13:74912443-74912465 CTTTATCTGGTTCTCCCCAGTGG - Intergenic
1110867332 13:80409860-80409882 ATTTAGCCGGTTTTCTTCACTGG + Intergenic
1113949459 13:114063861-114063883 TTTAAGCAGGTTTTTGCCACCGG - Intronic
1117982673 14:61357406-61357428 CTTCATCTGGTTTTCTCCAGGGG + Intronic
1121795587 14:96732735-96732757 TTTTTGCTGGTTTAAGCCACTGG - Intergenic
1133073872 16:3264648-3264670 CTATAGCTGCTTTTCGCCGGAGG + Intronic
1140271772 16:73472672-73472694 CTTCAGCTGGGTTTGGCCAATGG + Intergenic
1140937693 16:79690120-79690142 CTTTACCTCGTTTTCCCCAATGG - Intergenic
1145788580 17:27610063-27610085 CTTTAGCTGGTTCTCACGCCTGG - Exonic
1146730434 17:35188760-35188782 CTTCATCTGATTTTTGCCACTGG + Exonic
1149680677 17:58504958-58504980 GTGTAGCTGGTTGTCGGCACTGG - Exonic
1151484354 17:74389268-74389290 CTTTTGGTGGTTTTCGCTGCAGG + Intergenic
1153788565 18:8556716-8556738 CATGACCTGGTTTTCTCCACGGG - Intergenic
1156572372 18:38271667-38271689 CTTTAGCTGGTTTTGGGACCAGG + Intergenic
1159865010 18:73693093-73693115 TTTTAGTTGTTTTTAGCCACAGG - Intergenic
1160192770 18:76728078-76728100 CTTCACCTGGTTTTCTCCAATGG + Intergenic
1161398599 19:4058061-4058083 CCTCAGCTGGGTTTCGGCACTGG - Intronic
926280301 2:11440707-11440729 CTTTTGATGGTTTTGGCCCCAGG - Intergenic
928874230 2:36018327-36018349 CTTTAACTGGGTTTCACCACGGG - Intergenic
929431224 2:41888371-41888393 CTTTAGCTGCTTTTCCCCTTGGG - Intergenic
930844538 2:55888172-55888194 CTTCAGCTGTTTTTGCCCACTGG + Intronic
937599582 2:123715319-123715341 CTTTATCTGGTTTTGACAACAGG - Intergenic
938090347 2:128427193-128427215 CTTTACCTGGTTTCCTCCAGGGG + Intergenic
946947789 2:224839648-224839670 CTTTACCTGGTTTTCCCCACTGG - Intronic
948425872 2:237886283-237886305 CTTCTGCTGGTTTTCAGCACTGG + Intronic
1169771424 20:9205529-9205551 CTTTACCCAGTTTTCCCCACTGG + Intronic
1172965022 20:38828439-38828461 CTTAAGGTGCTTTTGGCCACAGG + Intronic
1175914012 20:62417319-62417341 CTTTAGCTGTTTCCCACCACAGG - Exonic
1177683835 21:24410906-24410928 CTTTAGGTGGTTTTCCGCCCTGG + Intergenic
949205776 3:1438057-1438079 ATTTAGCTGTTCTTCGGCACTGG + Intergenic
951367014 3:21795519-21795541 TTTTAGCTTGTTTTCTCCCCGGG - Intronic
952196930 3:31085561-31085583 CTTTTTCTGGGTTTCTCCACTGG - Intergenic
953566130 3:44033423-44033445 CTTAAGCTGGATTTTGCCAGGGG + Intergenic
953731095 3:45448774-45448796 CTTTAAGTGGTTTTCCCCCCTGG + Intronic
956661668 3:71604350-71604372 CTTTGTCTGGTTTTGGCCTCAGG - Intergenic
958952051 3:100427361-100427383 CCTTGGCTGCTTTTGGCCACGGG - Intronic
960773064 3:121216488-121216510 CTTTGCCTGGTTATCACCACGGG + Intronic
961667871 3:128504803-128504825 CTCTAGCTGGCTTCCGGCACTGG - Intergenic
964572893 3:158129627-158129649 AGTTAGCTGGTTTTCGACAGAGG - Intronic
964702654 3:159586189-159586211 CCCTAGGTGGTTTTGGCCACAGG + Intronic
966495748 3:180578367-180578389 CTTTAAGTGGTTTTCGGCCCTGG - Intergenic
968550086 4:1217607-1217629 CTTTAGCTGGTTTTCGCCACCGG - Intronic
977652520 4:99486721-99486743 CTTTAAGTGGTTTTCCCCTCTGG + Intergenic
980255302 4:130372275-130372297 CTATAGCTGACTTTCCCCACCGG - Intergenic
980450182 4:132959482-132959504 CTTTAAGTGGTTTTCGACCCTGG - Intergenic
982773282 4:159417768-159417790 CTTAATCTGGTCTTTGCCACTGG - Intergenic
987031141 5:13977855-13977877 CTTTATCTTATTTTGGCCACTGG + Intergenic
990109330 5:52304642-52304664 CTTTAGGTGGTTTTCCACCCTGG - Intergenic
994343100 5:98654835-98654857 CTTCAGTTAGTTTTCCCCACTGG - Intergenic
999155696 5:149456040-149456062 CTCTAGGTTGTTTTGGCCACTGG + Intergenic
1003046550 6:2738558-2738580 CTTTTGCAGCTTTTCCCCACTGG + Intronic
1004689328 6:17978823-17978845 TTCTAGCTGGATTTCACCACCGG + Intronic
1008190677 6:48453284-48453306 CTTTAAGTGGTTTTCGGCCCTGG + Intergenic
1011527639 6:88282479-88282501 CATTAGGTGGTTTCTGCCACAGG - Intergenic
1015355885 6:132276565-132276587 CTTTAGCTAGTGTTTCCCACTGG - Intergenic
1021693171 7:23249310-23249332 CTTTACCTGGTTTGCCCCAGTGG + Intronic
1036674198 8:10816266-10816288 CTTCATCTGGTTTTCCCCAGTGG - Intronic
1044179872 8:89178656-89178678 CTCTAGCTGGTTTTGGTAACTGG - Intergenic
1050396864 9:5207450-5207472 CTTTGCCTGGTTTTTGTCACAGG - Intergenic
1053504877 9:38633760-38633782 CTTTACCTGGTTTCCCCCAATGG + Intergenic
1056444407 9:86651879-86651901 CTTTATCTGGTTTTGGCACCAGG + Intergenic
1058144165 9:101392804-101392826 CTTTGTCTGGTTTTGGCCTCAGG - Intronic
1059160276 9:112028067-112028089 CTTTTGCTTGTTTTTGCCATGGG - Intergenic
1186833944 X:13418880-13418902 CTTGGGCTTGTTTTCGTCACTGG - Intergenic
1187527788 X:20069730-20069752 CTTTACCTGGTTTCCCCCAGTGG - Intronic
1199678675 X:150208971-150208993 ATTTACCTGGTTTTCCCCAATGG + Intergenic
1200970295 Y:9145593-9145615 CTTTAAGTGGTTTTCTGCACTGG + Intergenic
1202140715 Y:21718727-21718749 CTTTAAGTGGTTTTCTGCACTGG - Intergenic
1202146150 Y:21785070-21785092 CTTTAAGTGGTTTTCTGCACTGG + Intergenic