ID: 968550091

View in Genome Browser
Species Human (GRCh38)
Location 4:1217624-1217646
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968550083_968550091 10 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550085_968550091 9 Left 968550085 4:1217592-1217614 CCGGAAGTCGGGCTGCCGGTGGC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550082_968550091 11 Left 968550082 4:1217590-1217612 CCCCGGAAGTCGGGCTGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550086_968550091 -6 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type