ID: 968550091

View in Genome Browser
Species Human (GRCh38)
Location 4:1217624-1217646
Sequence CTAAAGCCGCGGGCCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968550082_968550091 11 Left 968550082 4:1217590-1217612 CCCCGGAAGTCGGGCTGCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550085_968550091 9 Left 968550085 4:1217592-1217614 CCGGAAGTCGGGCTGCCGGTGGC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550083_968550091 10 Left 968550083 4:1217591-1217613 CCCGGAAGTCGGGCTGCCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
968550086_968550091 -6 Left 968550086 4:1217607-1217629 CCGGTGGCGAAAACCAGCTAAAG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968550091 Original CRISPR CTAAAGCCGCGGGCCGGCGC CGG Intronic
900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG + Intergenic
900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG + Exonic
917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG + Intronic
918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG + Exonic
922753644 1:228082547-228082569 CTAAGACCGCGGCCCGGGGCAGG + Intergenic
924957687 1:248945017-248945039 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1072638881 10:97196231-97196253 CCGACGCCGCGGGCCGGGGCTGG - Intronic
1075718141 10:124568972-124568994 CTAAAGCTGTGGGAGGGCGCTGG - Intronic
1076963535 10:133786531-133786553 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1083266618 11:61549961-61549983 TTACAGCCGCGGGCCAGGGCTGG - Intronic
1083470475 11:62880832-62880854 CTTAAGGGGCGGGCCGGGGCGGG + Intronic
1083607391 11:63986894-63986916 CTCACGGCGCGGGCCGCCGCTGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1113989971 13:114353410-114353432 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG + Intergenic
1124129390 15:26971210-26971232 CTGGAGCCGCGAGCGGGCGCGGG - Intergenic
1126109419 15:45166958-45166980 CGGAAGCCGCGCGCCGGCGGAGG - Intergenic
1131888622 15:96947920-96947942 CCGAGGACGCGGGCCGGCGCGGG - Intergenic
1132387194 15:101409015-101409037 CTATATCCGGGGGCCGGAGCAGG + Intronic
1132668699 16:1094066-1094088 CGAAAGCCACGGGTCGGGGCCGG + Intronic
1146912565 17:36658048-36658070 CCAAGGCCCCGGGCCGGTGCGGG + Intergenic
1152201223 17:78947540-78947562 CCAAAGCTGCGGGACGGGGCTGG + Intergenic
1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG + Exonic
1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG + Intronic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1166858028 19:45792816-45792838 CGGAAGCCGCTGGCCCGCGCCGG + Intergenic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG + Exonic
946416850 2:219544062-219544084 CAAAGGCCGCGGGCGGGCTCAGG + Intronic
1170813001 20:19689413-19689435 CTGAAGCCAGGGGCCGGAGCTGG - Intronic
1171724433 20:28603045-28603067 CTAGAGCTGCGGGCTGGCGACGG + Intergenic
1171753627 20:29080000-29080022 CTAGAGCTGCGGGCTGGCGACGG - Intergenic
1178907665 21:36650011-36650033 CTAAAGCACCGGGCCTGCCCGGG + Intergenic
1180110136 21:45643626-45643648 CTAGCGCCGCGCGCCGCCGCCGG - Intergenic
1180297979 22:10961719-10961741 CTAGAGCTGCGGGCTGGCGACGG + Intergenic
1180410429 22:12602077-12602099 CTAGAGCTGCGGGCTGGCGAAGG - Intergenic
1180699720 22:17774566-17774588 CCACAGCCCCGCGCCGGCGCGGG - Intronic
1185430382 22:50807256-50807278 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG + Exonic
962876606 3:139540016-139540038 CTAAAGCCTCGCGCCGGTGGTGG + Intergenic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
970007789 4:11427789-11427811 CCAAAGCCGGGTGCCGGCGCGGG - Intronic
971279940 4:25234409-25234431 CTGAAACCGCGGGGCGGCTCCGG - Exonic
974047347 4:56908612-56908634 GGAGGGCCGCGGGCCGGCGCGGG - Intronic
985437046 4:189940621-189940643 CTAGAGCAGCGGGCTGGCGACGG - Intergenic
985466789 4:190203974-190203996 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG + Exonic
1007652903 6:43434200-43434222 CTCAAGCCGGGGGCCGGAACTGG + Intronic
1018063619 6:160109796-160109818 CTAAAGCCGCTGGGTGGGGCAGG - Intronic
1018686358 6:166307579-166307601 CTAGGGCCGCGGGCCCGCGGAGG - Exonic
1022768164 7:33439097-33439119 CTAAAGCCTGGGGCCAGCTCAGG + Intronic
1035356856 7:158280905-158280927 GTGTAGCCGTGGGCCGGCGCAGG - Intronic
1036664307 8:10729129-10729151 CTAAAGCCGCAGGCCCGCAGAGG - Intronic
1040423434 8:47261039-47261061 GGGAAGCGGCGGGCCGGCGCGGG + Intronic
1049592621 8:143469447-143469469 CTGAAGCCCTGGGCTGGCGCTGG + Intronic
1053725163 9:40992036-40992058 CTAGAGCTGCGGGCTGGCGACGG - Intergenic
1057705262 9:97391186-97391208 GTGAAGGCCCGGGCCGGCGCAGG - Intergenic
1057708060 9:97412105-97412127 CCCAAGCCGCGGGGCGGCTCCGG + Exonic
1203449640 Un_GL000219v1:99854-99876 CTAGAGCTGCGGGCTGGCGACGG + Intergenic